Kernel bioassays are generally accepted in many laboratories as relatively easy tools to study mycotoxin producing fungal pathogens and their interactions with the host seed (Christensen et al., 2012). Despite the increasing number of publications about the F. verticillioides-maize ecosystem, several key aspects of this pathosystem remain unclear. Specifically, following inoculation of the seed, the critical times of the highly dynamic processes of fungal development, pathogenicity and disease progression including the time points at which the pathogen undergoes vegetative growth and seed colonization, asexual reproduction and production of mycotoxins.
Therefore, this study aimed at answering some of these questions using a well-defined model system, maize B73 inbred line and F. verticillioides strain 7600, the genomes of which has been sequenced.
This study showed that, with the inoculation method used, the pathogen completed tissues colonization at day 9, as evidenced by the finding that no more ergosterol was produced after 9 h of infection. Conidial production continued until day 12 and no further significant changes in spore production were observed, similarly to the findings of an in vitro experiment by Rossi et al. (2009). However, conidia production rate, as calculated per unit of fungal biomass, showed a strong increase on day 12 and 15 and it could be considered a reaction to nutritional source depletion;
exhausting itself and the growth substrate, the fungus produced conidia to enhance its survival and dissemination.
89
The dynamics of conidia production and FB1 synthesis followed a similar pattern during the incubation period and the two processes were highly and positively correlated. Many studies supported the idea of a correlation between these two pathways (Brodhagen and Keller, 2006; Calvo et al., 2002). Shim and Woloshuk (2001) discovered that the disruption of FCC1, a Fusarium cyclin C1-like gene, resulted in the inhibition of conidia production and the suppression of FB1 synthesis, caused by the inactivation of FUM5, the polyketide synthase gene involved in fumonisin synthesis. Furthermore, the disruption of maize 9-lipoxygenase, ZmLOX3 gene, also resulted in a severe reduction of both conidia production and FB1 synthesis (Gao et al., 2007).
No correlation between Fusarium biomass, as measured by ergosterol content, and FB1 synthesis was found, in a study on more than 20 strains of Fusarium by Melcion et al. (1997). Bluhm et al. (2008), tried to correlate the growth and toxin production by the deletion of a gene (ZFR1) but even if the grow of mutant (Δzfr1) was reduced on certain substrate and fumonisin production was decreased, no correlation was found.
Recently, a relationship between plant- and fungus-produced oxylipins and fungal metabolism, including sporulation, tissue colonization and mycotoxin synthesis, was demonstrated (Brodhagen and Keller, 2006; Christensen and Kolomiets, 2011;
Tsitsigiannis and Keller, 2007). All these fungal developmental and pathogenicity processes can either be enhanced or inhibited by the presence of oxidized metabolites. It has been hypothesized that the potent regulatory functions of both plant and fungal oxylipins is likely due their extreme structural similarities and thus, plant oxylipins can mimic fungal oxylipins in their endogenous signaling roles.
Oxylipins are produced by the action of enzymes including lipoxygenases, in plants, or linoleate diol synthases, in fungi, encoded by gene families. The genes required for oxylipin synthesis are differently expressed in a space and time-dependent manner, depending on the genotypes, tissue and on the environmental stimuli. This differential expression of specific branches of the oxylipin pathway leads to the production of a
90
mixture of diverse oxylipins, the so called “oxylipin signature” profile, of the considered tissue and time after a specific stimulus is applied.
An important outcome of this study is the finding of the time at which the host seeds completely succumb to fungal infections and die. The vitality of seeds has been tested by measuring the expression of the constitutively expressed plant housekeeping gene, cullin, at every time point tested in this study. Starting at day 12, the transcripts of the cullin gene were hardly detectable in the infected kernels, suggesting that between days 9 and 12 seeds are no longer viable. Therefore, we conclude that starting at day 12 (or earlier), once the seed is no longer responsive to infection, the fungus switches to a saprofitic mode of nutrition. This finding is important for any study involving plant-pathogen interactions, i.e. when the host is no longer alive to be able to organize any type of defensive reactions. Interestingly after day 12, no significant changes in conidia production, ergosterol and FB1 synthesis were noticed.
In this study, several selected maize lipoxygenase (LOX) genes were tested in their response to F. verticillioides colonization of the seed. The host LOX genes selected were either those whose function in the interactions with this pathogen was reported previously such as LOX3, LOX4, LOX5 and LOX12 or the genes closely related to the 9-LOX gene subfamily, LOX1 and ZmLOX2. LOX1 and LOX2 were induced to the highest levels compared to other LOX genes tested. Despite the high sequence identity between these two genes (more than 90% nucleotide and amino acid sequence identity), LOX1 and LOX2 were differentially induced by infection. While LOX1 was induced 10-fold as early as at day 3 and then declined to about a 4-fold induction level at day 9, LOX2 was induced up to 4 to 5 fold and remained induced at the same level for the rest of seed life (9 days). The level of expression of these two genes followed an opposite trend with respect to the others; they were strongly expressed at 3 dpi with an expression decrease in the following time points, while other genes were expressed later. Maize LOX1 gene encodes for a dual positional specific lipoxygenase (Huon et al., 2009) and its expression is induced in plant leaf in response to wounding. The expression of this gene is also stimulated by methyl
91
jasmonate treatments of leaves (Kim et al., 2003). Despite the possibility that methyl jasmonate accumulation was avoided by vial cap loosening , that permitted gases exchange with the external environment, the sudden and strong expression of this gene versus the others is not surprising because, during sample preparation for the inoculation, a wound in the kernel embryo was made. To date, the function of LOX1 and LOX2 genes in the interactions with F. verticillioides is unknown, precluding any speculation about the relevance of highly induced expression of these two genes in response to F. verticillioides infection.
Published studies by Gao et al. (2007, 2009) showed that ZmLOX3-mediated signaling is involved in the regulation of fungal secondary metabolism including biosynthesis of fumonisins and aflatoxins. In particular, Gao et al. (2007) demonstrated that the maize knock-out lox3-4 mutant, in which this gene is not expressed, significantly accumulated lower levels of fumonisins as compared to the wild type seed after the inoculation with the wild type F. verticillioides strain. We have observed that this gene began to be significantly expressed from day 6, which coincided with a significant increase of fumonisin contamination, further underlining the relationship between these two pathways.
LOX4 and LOX5 are also close paralogs, sharing over 95% identity at both aminoacid and nucleotide levels (Park et al., 2010). LOX4 andLOX5 are expressed at relatively low levels in uninfected maize organs tested. LOX4 is preferentially expressed in the below-ground organs, while transcripts of LOX5 were only strongly induced in wounded leaves as well as in response to insect infestation, suggesting the role of ZmLOX5 in plant resistance response against herbivore insects (Park, 2013).
Furthermore, the LOX4 and LOX5 mutants were similar to each other in their enhanced response to kernel colonization and conidia production by F. verticillioides (Park, 2013), suggesting that the two genes are required for the defense reaction against this pathogen. This study showed that both genes were induced in response to pathogen inoculation, although their induction was not as strong as that of LOX1 and
92
LOX2. It is possible that relatively low and late response of these two genes is the reason why B73 seeds were susceptible to F. verticillioides infections.
In the most recent study, ZmLOX12 was demonstrated to be implicated in maize defense against F. verticillioides as the knock-out disruption of this gene resulted in a dramatic increase in susceptibility to F. verticillioides not only in the kernels but in all the below- and above-ground organs tested, including increased susceptibility and increased conidiation and fumonisin B1 production in the kernels (Christensen et al., 2013). Here, we observed a very low and late induction of this gene, prompting our hypothesis that the low expression of this gene in B73 is yet another potential reason behind the well documented susceptibility of B73 to fumonisin contamination and Fusarium ear rot.
Regarding the expression study of the fungal oxylipin biosynthetic genes, transcript accumulation of one lipoxygenase and two linoleate diol synthase (LDS) genes were tested. In Aspergillus spp. and other fungal genera, the LDS genes are named Ppo (psi producing oxygenase) as they are known to produce a mixture of oxidized molecules called Psi factors. The change in the ratio between these oxidized lipids affect the production of spores, increasing the production of sexual or asexual spores, depending on specific oxylipin composition or secondary metabolism such as mycotoxin synthesis. The silencing of specific Ppo genes resulted in the reduced ability to colonize tissues by the fungus and an altered ratio between sexual/asexual sporulation (Tsitsigiannis and Keller, 2006; Tsitsigiannis and Keller, 2007). In this study we observed a positive correlation between the pattern of expression of these three genes and ergosterol synthesis. Also a positive correlation was observed between the expression of LDS1 and LDS2 and conidia production (Table 3.3).
Interestingly, a positive strong correlation was also observed between the expression of LDS1 and FB1 synthesis, supporting the notion that the production of this mycotoxin may be regulated by the oxylipin products of the LDS1 isoform.
93 Table 3.1 Sequences of the primers used for molecular analyses.
Primers Sequence Amplicon size
(bp) Plant Primers
MLOX1 F5' TTCCGTGAAGTGTGGTTCTC 3' R5' GAGCCTTATTACAACAGTCCTCA 3'
LOX2 F5' GCTGGCGGTAACCACTTATTA 3' R5' ACACCATGCATGTGACCAATA 3'
LOX3 F5' TACCACTACCACCCCAGGAGT 3' R5' AGCACTGCGAAACGACTAGAA 3'
LOX4 F5' TGAGCGGATGGTTTGTAGAT 3' R5'ATTATCCAGACGTGGCTCCT 3'
LOX5 F5' GGGCAGATTGTGTCTCGTAGTA 3' R5' ATATTCAAGCGTGGACTCCTCT 3'
LOX12 F5' AATTGACAAGCTGCGTCCTT 3' R5' TCCAAACCAATCATCGCAA 3'
Cullin F5' GCGTTTGCTCCATTCACTTT 3' R5' CCATAACTTTGCGGCTCTTC 3'
Fungal Primers
FLOX1 F5’ACGATTCCCAAAGACGAGCAAGTG3’
R5’AGGCCGATGTTGTGTCCTTGTTCA3’ 215 LDS1 F5’GGACTCGCTGCGATCGTGTGG3’
R5’TCGCCCTTCTGGGCAATGGC3’ 210 LDS2 F5’AGACCCCCACCGAGGCCAAG3’
R5’CCACTGCCCAGCCTCCCAGA3’ 191 Β Tubulin F5’ACATTCGTCGGAAACTCCAC3’
R5’CAGCATCCTGGTACTGCTGA3’ 190
94 Table 3.2 A) Average values (mean of biological replicates) of conidia counting (number of conidia/g kernel), ergosterol (µg ergosterol/g kernel) and fumonisin B1 (µg fumonisin B1/g kernel) calculated for each time point: different letters are referred to significantly different values; B) Average values of the fold change of gene expression in response to F. verticillioides infection compared to day 0: different letters are referred to significantly different values.
Table 3.2 A
Day
Conidia (x106/g kernel)
Ergosterol (µg/g kernel)
Fumonisin B1 (µg/g kernel)
Conidia/Ergost.
(x106/ µg)
FB1/Ergost.
(µg/ µg)
3 15 c 3 c 267 c 5 c 98 bc
6 536 c 21 b 1032 c 27 b 53 c
9 1546 b 38 a 8755 b 41 b 245 b
12 2471 a 22 b 12721 a 114 a 590 a
15 2275 a 18 b 12049 a 126 a 672 a
Table 3.2 B
Fusarium verticillioides primers
Maize primers
FLOX1 LDS1 LDS2 MLOX1 LOX2 LOX3 LOX4 LOX5 LOX12
Time ** * ns * ns * ns ns **
day3 -9.7 b -2.1ab -4.3 10.5 a 3.9 -0.8 b 0.1 -1.4 -3.1 b day6 -5.9 a -4.5 a -4.2 5.7ab 4.3 2.2 a -0.9 -1.4 4.8 a day9 -5.4 a -0.9 b -3.6 4.2 b 6.1 1.5 a 1.3 -5.6 5.8 a
** p≤0.01; * p≤0.05; - not significant
95 Table 3.3 Significant correlation expressed as Pearson’s coefficients (2-tails test), the lack of value means no correlation. LOX2, and LOX5 were not included because no significant correlations were found.
ergosterol FB1 FLox1 Lds1 Lds2 MLox1 Lox4 Lox12
conidia 0.49* 0.91** - 0.85** 0.78* - - -
ergosterol - 0.68* 0.71* 0.88** -0.70* - -
FB1 - 0.95** - - 0.67* -
FLox1 - 0.93** -0.98** - 0.77*
Lds1 - - 0.80** -
Lds2 -0.93** - -
MLox1 - -0.74*
Lox3 - 0.96**
** p≤0.01, * p≤0.05
96 Fig. 3.1 Visual observation of the inoculated kernels at each time point.
97 Fig. 3.2 Dynamics of conidia production (A), colonization expressed as ergosterol content (fungal biomass) (B), production of conidia expressed on ergosterol production (C), fumonisin B1 synthesis (D), fumonisin B1 expressed on ergosterol production (E) and relative percentages of conidia production, ergosterol and fumonisin B1 calculated on the maximum value observed (F) during the incubation period (dpi=days post inoculation).
98 Fig. 3.3 Relative expressions (RQ=relative quantification) of the selected genes normalized with the comparison to the reference gene expression (Cullin for maize and β-tubulin for Fusariumverticillioides), as compared to the expression level at day 0 (bars) or evaluating the expression increment (lines): standard errors were calculated between biological replicates.
99
References
Affeldt K.J., Brodhagen M., Keller N.P. (2012) Aspergillus oxylipin signaling and quorum sensing pathways depend on G protein-coupled receptors. Toxins 4:695-717.
Andreou A., Brodhun F., Feussner I. (2009) Biosynthesis of oxylipins in non-mammals. Progress in Lipid Research 48:148-170.
Blée E. (2002) Impact of phyto-oxylipins in plant defence. Trends in Plant Science 7:315-321.
Bluhm B.H., Kim H., Butchko R.A.E., Woloshuk C.P. (2008) Involvement of ZFR1 of Fusarium verticillioides in kernel colonization and the regulation of FST1, a putative sugar transporter gene required for fumonisin biosynthesis on maize kernels. Molecular Plant Pathology 9:203-211.
Brodhagen M., Keller N.P. (2006) Signalling pathways connecting mycotoxin production and sporulation. Molecular Plant Pathology 7:285-301.
Burow G.B., Nesbitt T.C., Dunlap J., Keller N.P. (1997) Seed lipoxygenase products modulate Aspergillus mycotoxin biosynthesis. Molecular Plant-Microbe Interactions 10:380-387.
Cahagnier B., Lesage L., Richard-Molard D. (1993) Mould growth and conidiation in cereal grains as affected by water activity and temperature. Letters in Applied Microbiology 17:7-13.
Calvo A.M., Wilson R.A., Bok J.W., Keller N.P. (2002) Relationship between secondary metabolism and fungal development. Microbiology and Molecular Biology Reviews 66:447-459.
Camera S.l., Gouzerh G., Dhondt S., Hoffmann L., Fritig B., Legrand M., Heitz T. (2004)
Metabolic reprogramming in plant innate immunity: the contributions of phenylpropanoid and oxylipin pathways. Immunological Reviews 198:267-284.
Christensen S., Nemchenko A., Park Y.-S., Schmelz E., Kunze S., Feussner I., Yalpani N., Meeley R., Kolomiets M. (2013) The novel maize 9-lipoxygenase, ZmLOX12, is required to mount an effective defense against Fusarium verticillioides. Molecular Plant-Microbe Interactions, accepted.
Christensen S., Borrego E., Shim W., Isakeit T., Kolomiets M. (2012) Quantification of Fungal Colonization, Sporogenesis, and Production of Mycotoxins Using Kernel Bioassays. Journal of Visualized Experiments 62, e3727:1-5.
Christensen S.A., Kolomiets M.V. (2011) The lipid language of plant-fungal interactions. (Special Issue: Fungal secondary metabolism.). Fungal Genetics and Biology 48:4-14.
Feussner I., Wasternack C. (2002) The lipoxygenase pathway. Annual Review of Plant Biology 53:275-297.
Gao X.Q., Brodhagen M., Isakeit T., Brown S.H., Gobel C., Betran J., Feussner I., Keller N.P., Kolomiets M.V. (2009) Inactivation of the lipoxygenase ZmLOX3 increases susceptibility of maize to Aspergillus spp. Molecular Plant-Microbe Interactions 22:222-231.
Gao X.Q., Kolomiets M.V. (2009) Host-derived lipids and oxylipins are crucial signals in
modulating mycotoxin production by fungi. (Special issue: Emerging issues in mycotoxin research- Part II.). Toxin Reviews 28:79-88.
Gao X.Q., Shim W.B., Gobel C., Kunze S., Feussner I., Meeley R., Balint-Kurti P., Kolomiets M.
(2007) Disruption of a maize 9-lipoxygenase results in increased resistance to fungal pathogens and reduced levels of contamination with mycotoxin fumonisin. Molecular Plant-Microbe Interactions 20:922-933.
Huon T., Jang S., Cho K., Rakwal R., Woo J.C., Kim I., Chi S.-W., Han O. (2009) A substrate serves as a hydrogen atom donor in the enzyme-initiated catalytic mechanism of dual positional specific maize lipoxygenase-1. Bull. Korean Chem. Soc 30:13.
Kim E.-S., Choi E., Kim Y., Cho K., Lee A., Shim J., Rakwal R., Agrawal G.K., Han O. (2003) Dual positional specificity and expression of non-traditional lipoxygenase induced by wounding and methyl jasmonate in maize seedlings. Plant molecular biology 52:1203-1213.
100 Melcion D., Cahagnier B., Richard-Molard D. (1997) Study of the biosyntesis of fumonisins B1, B2
and B3 by different strains of Fusarium moniliforme. Letters in Applied Microbiology 24:301-305.
Mosblech A., Feussner I., Heilmann I. (2009) Oxylipins: structurally diverse metabolites from fatty acid oxidation. Plant Physiology and Biochemistry 47:511-517.
Park, Y. S., Kunze, S., Ni, X., Feussner, I., & Kolomiets, M. V. (2010). Comparative molecular and biochemical characterization of segmentally duplicated 9-lipoxygenase genes ZmLOX4 and ZmLOX5 of maize. Planta, 231(6), 1425-1437.
Rossi V., Scandolara A., Battilani P. (2009) Effect of environmental conditions on spore production by Fusarium verticillioides, the causal agent of maize ear rot. European Journal of Plant Pathology 123:159-169.
Roze L.V., Beaudry R.M., Arthur A.E., Calvo A.M., Linz J.E. (2007) Aspergillus volatiles regulate aflatoxin synthesis and asexual sporulation in Aspergillus parasiticus. Applied and
Environmental Microbiology 73:7268-7276.
Scala V., Camera E., Ludovici M., Dall'Asta C., Cirlini M., Giorni P., Battilani P., Bello C., Fabbri A.A., Fanelli C., Reverberi M. (2013) Fusarium verticillioides and maize interaction in vitro: relationship between oxylipin cross-talk and fumonisin synthesis. World Mycotoxin Journal 6:343-351.
Shim W.-B., Woloshuk C.P. (2001) Regulation of fumonisin B1. Biosynthesis and conidiation in Fusarium verticillioides by a cyclin-like (c-type) gene, FCC1. Applied and Environmental Microbiology 67:1607-1612.
Tsitsigiannis D.I., Keller N.P. (2006) Oxylipins act as determinants of natural product biosynthesis and seed colonization in Aspergillus nidulans. Molecular Microbiology 59:882-892.
Tsitsigiannis D.I., Keller N.P. (2007) Oxylipins as developmental and host-fungal communication signals. Trends in Microbiology 15:109-118.
Tsitsigiannis D.I., Kowieski T.M., Zarnowski R., Keller N.P. (2004a) Endogenous lipogenic regulators of spore balance in Aspergillus nidulans. Eukaryot Cell 3:1398-1411.
Tsitsigiannis D.I., Zarnowski R., Keller N.P. (2004b) The lipid body protein, PpoA, coordinates sexual and asexual sporulation in Aspergillus nidulans. Journal of Biological Chemistry 279:11344-11353.
Udvardi M.K., Czechowski T., Scheible W.-R. (2008) Eleven golden rules of quantitative RT-PCR.
The Plant Cell Online 20:1736-1737.
101
CHAPTER 4
Effects of drying treatments on the presence on fungal species and fumonisin contamination in maize kernels
102
Effects of drying treatments on fungal species and fumonisin contamination in maize kernels
Paola Giorni1, Gregori Rossella1, Dall’Asta Chiara2, Cirlini Martina2, Galaverna Gianni2, Battilani Paola1
1Istituto di Entomologia e Patologia Vegetale, Università Cattolica del Sacro Cuore, 29122 Piacenza, Italia; 2Dipartimento di Scienze degli Alimenti, Università di Parma, 43100 Parma, Italia;
Abstract
This study aimed to verify the effect of drying thermal treatments on fumonisin content in maize, both in free and hidden forms. Two drying temperatures x time conditions (70°Cx24h; 95°Cx9h) where applied and fungal incidence and fumonisins contamination were determined before and after the treatment. Drying treatments showed to decrease the fungal population in kernels. Referring to fumonisin, the contamination increased after the drying treatment. An explanation for this seems to be the release of some fumonisin from maize matrix, due to the changes in matrix components caused by drying temperature.
103