Low intestinal tract adenomatous polyps regression in FAP patients by dietary-induced erbeta upregulatior
Testo completo
(2) CCMBM 1 2018-3bozza.qxp_- 02/05/18 12:57 Pagina 80. F. Tonelli et al.. on al i. Determination of colorectal mucosal proliferation and apoptosis Three μm sections from paraffin-embedded colon and mounted on electrostatic-treated slides (Superfrost® Plus, Medite, Italy) were processed for determining Ki-67 and ccas3 antigen immunoreactivity as described (11). The proliferative activity was expressed as labelling index (LI): number of labelled cells counted in all the crypts of the same subject/ number of cells in all the crypt sections of the same subject x 100. The distribution of proliferating cells along the crypt was expressed as the percentage of labelled cells in each compartment over the total labelled cells in the crypt section. Apoptotic activity, expressed as apoptotic index (AI), was determined in sections processed with anti c-cas3 antibody, enumerating labelled cells in all the crypts of the same subject/number of cells in all the crypt sections of the same subject x 100.. Genetic expression analysis of Estrogen Receptors Alpha (ER-α) and Beta (ER-β) The genetic expression analysis has been carried out on biopsies of patients at the basal time and subsequently every 6 months from the beginning of Adipol® administration. It has been evaluated the expression of both estrogen receptors (ERa and ERβ) genes. Total RNA was extracted from biopsies with Qiazol reagent (Qiagen) according to the manufacturer’s instructions. One mg of total RNA was reverse transcribed using Quantitect Reverse Transcription-Kit (Qiagen) according to manual instructions. To verify the successful reverse transcription, qualitative PCR was performed using 1μl cDNA as template and 10 μM of each primer (forward and reverse) (described in Table 1) of the gene housekeeping β-Actin. The genetic expression analysis was performed by quantitative real time PCR (qRT-PCR) for ERa, ERβ and for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), as housekeeping gene, using Stratagene Mx3000-P Detection System (Stratagene, La Jolla, CA, USA). Reactions were performed using a TaqMan 5’-exonuclease assay and following the thermic profile according to manual instructions (Kapa probe fast qPCR Kit, Kapa Biosystems). Primers and internal labelled oligonucleotides TaqMan probes for each cDNA, described in Table 2, were designed by IDT integrated DNA Technologies. Target gene expression was normalized to GAPDH gene.. C IC. Ed. iz. io ni In te r. Endoscopic exams The endoscopies were performed with a flexible video-endoscope (Olympus GIF 165, Tokyo, Japan) at time 0 and every 6 months. Oral administration of PEG was used for the bowel preparation. All the rectum, the rectal stump from the ileorectal anastomosis to the anal verge or the ileal pouch, were examined counting the number of the polyps and their size. The size of the polyps was assessed by comparison with the diameter of the biopsy forcep (having respectively 4 mm when closed and 8 mm when open). Polyps which had a diameter around 10 mm or greater were removed by snare polypectomy 2-3 months before the baseline endoscopy. No magnification of the endoscope was used during the exam. NBI was used for a better definition of the lesion when appropriate. Videorecordings and/or photographs of the various examined sites were regularly taken. Re-assessment of polyp number and size was subsequently made by a collegial estimate by the two endoscopists participating to the study, evaluating the images in a blind manner. At basal and after every year, biopsies were collected from at least one of the biggest polyp for histological assessment and evaluation of the grade of dysplasia. A tattooed area containing 1 or more polyps was chosen. Biopsies from macroscopically normal appearing rectal or ileal pouch mucosa, usually within 2 cm from polyps, were taken around this area for the molecular analysis of the expression of ERs and for the evaluation of proliferation and apoptosis. During the study a periodic reassessment of the polyps were performed and the necessity of polypectomies for recurrent polyps was discussed and eventually performed.. the polyps in negative (presence only of normal mucosa), presence of phloghosis, adenoma with low and high grade dysplasia, according to Vienna criteria.. na zi. familiarity for the presence of multiple (>100 adenomatous colorectal polyps) colonic polyposis. Either patients with intact colon or patients submitted to subtotal colectomy and IRA or total colectomy and IPAA were studied. The patients were enrolled in the study if the previous endoscopies documented the presence of at least 2 adenomatous polyps in the rectum or in the ileal pouch. Exclusion criteria were the use of NSAIDs during the 12 months prior to the study entry, pregnancy or lactation, hormonal contraception and/or therapy, use of phytoestrogens, administration of SERMs (specifically tamoxifene, raloxifene, toremifene), use of multivitamin supplement. The study was conducted according to ICH Good Clinical Practice. Ethical approval was obtained from Careggi Hospital Committee.. Histopathology Histological samples were processed by standard methods and the biopsy sections of the visible polyps were examinated in a blind manner. The pathologist classified the type of. Treatment The patients receveid 5 g of Adipol® twice a day, at break-. TABLE ͷǤȾ-Actin. ©. Table 1 - Primers β-Actin.. Gene. Ⱦ-Actin for Ⱦ-Actin rev 80. Primer Sequence (5ǯ-͵ǯȌ. AGCCTCGCCTTTGCCGA CTGGTGCCTGGGGCG. Amplicon size (bp). 174. Tann (°C). 60. Clinical Cases in Mineral and Bone Metabolism 2018; 15(1):79-84.
(3) CCMBM 1 2018-3bozza.qxp_- 02/05/18 12:57 Pagina 81. Low intestinal tract adenomatous polyps regression in FAP patients by dietary-induced erbeta upregulation Table 2 - Primers and Taqman Probes used for qRT-PCR.. TABLE 2. Primers and Taqman Probes used for qRT-PCR. GAPDH for GAPDH rev Probe. Amplicon size (bp). ACAGTCAGCCGCATCTTC AATCCGTTGACTCCGACCTTC. 87. F/CCACATCGC/ZEN/TCAGACACCATGGG/Q. GACTATGCTTCAGGCTACCATTA GGCTGGACACATATAGTCGTTAT. F/TCTCTTGAA/ZEN/GAAGGCCTTGCAGCC/Q. ERȾ for ERȾ rev Probe. TCGCCAGTTATCACATCTGTATGCGG GTGTCTCTCTGTTTACAGGTAAGGTGTG F/TCCCTGGTG/ZEN/TGAAGCAAGATCGCTAGAA/Q. 102. io ni In te r. ERȽfor ERȽ rev Probe. Tann (°C). on al i. Primer Sequence (5ǯ-͵ǯȌ and Taqman probes. 60. na zi. Gene. 95. 60. 60. TaqMan probes with F as reporter fluorochrome (6-carboxyfluorescein [6-FAM]) and Q as quencher fluorochrome (lowa Black® FQ); bp, base pairs of amplicon size; Tann, annealing temperature (°C).. C IC. Ed. iz. fast and dinner. This patented blend was chosen for its composition of phytoestrogens (175 mg milk thistle extract, titered at 70% in silymarin and 30% silibin, 50 mg of flaxseed extract titered at 40%, secoisolariciresinol) and insoluble and indigestible oat fiber containing cellulose, hemicellulose and lignin. Adipol® is a food supplement listed in the National Registry of Food Supplements of the Italian Ministry of Health, code: E1041842-Y. The compliance of the treatment was evaluated collecting the unused sachets every 3 months. Any side effects was recorded at the clinical controls.. ©. Statistical analysis A T test for paired data was utilized to compare the mean values of each parameter at the beginning and after the treatment with Adipol®. Differences were considered significant when P was ≤ 0.05. To test the reproducibility of the endoscopic findings interobserver agreement was calculated with kappa analysis. A score of >0.80 was judged as optimal.. Results. Endoscopic and histological exams Seventeen patients [10 M/7 F; age mean 35.7 years (range 18-65)] met the inclusion criteria and were enrolled in the study. Fourteen of them were affected by FAP and 3 by AFAP. Ten of them were submitted to subtotal colectomy Clinical Cases in Mineral and Bone Metabolism 2018; 15(1):79-84. and IRA. In the last two years, all these patients except one were submitted to polypectomies of the rectum or pouch at the endoscopies performed for surveillance. Other 5 patients were submitted to IPAA. In some of these patients the ileal pouch was anastomized on a short (3-4 cm in length) rectal stump which harboured adenomatous polyps. Finally, 2 patients were not operated and presented an intact colon at the time of the study. The time elapsed from surgery to the beginning of the study was 12.4 and 7.2 year as a mean respectively for IRA patients and IPAA patients. They were followed prospectively between 2013 and 2016. The length of the treatment lasted from 4 to 29 months (mean 17 months). The majority of the patients (10/17) undertook the treatment more than one year and seven of them more than 12 months. At baseline (T0), the mean number (±SD) of detected polyps was 22 (±15) in the rectal stump of IRA patients, 5 (±4) in the rectum of patients with intact colon and 1.5 (±0.5) in the ileal pouch. In 2 of the patients with a mechanical IPAA polyps were detected in the residual rectal stump. The dimension of the polyps varied from 1 to 3 mm. Histology confirmed the presence of tubular adenomatous polyps with a low grade dysplasia in all the patients except 3 in whom high grade dysplasia was found. Histology was negative for the presence of adenoma in one of the patients. After 6 months of treatment with Adipol® a significative decrease in the number of polyps was observed (Figure 1) moving from 14±17 to 9±10. After at least 12 months of treat-. 81.
(4) CCMBM 1 2018-2bozza.qxp_- 23/04/18 11:27 Pagina 82. F. Tonelli et al.. 35. 60. *. 30. 50. 20. 15. 40. 0 6 Months. 12 Months. 30. on al i. Polyps number. Number of Polyps. * p<0.05 25. 18 Months 24 Months 30 Months. 20. 10. 5. 36 Months. 10. 0 0. 0. 6 Months. 1. Figure 1 - Trend of polyps number in 17 patients treated with Adipol® after 6 months from the starting time of the beginning of the supplementation treatment. Data are the mean ±DS (*p<0.05 versus time 0).. 3. 4. 5. iz. Ed. C IC. 7. 8. 9. 10. 4,5. 4. 3,5. Polyps size. 3. 0 6 Months. 2,5. 12 Months 18 Months. 2. 24 Months 30 Months. 1,5. 36 Months. 1. 0,5. 0. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. Figure 3 - Trend of polyp size (mm) for single patient treated more than 12 months with Adipol®. Values are from 0 to 36 months from the starting of the beginning of the supplementation treatment. Patients. 28.3±1.9 and 27.8±2.5, before and after treatment, respectively; means±SE) (Figure 4). Since a deregulated pattern of proliferation along the crypt is a defect associated with carcinogenesis (12), we also determined the distribution of proliferating cells along the crypt before and after Adipol® treatment. As expected, the majority of proliferating cells was. B. ©. A. 6. Figure 2 - Trend of polyps number for single patient treated more than 12 months with Adipol®. Values are from 0 to 36 months from the starting of the beginning of the supplementation treatment. Patients. io ni In te r. ment the number of polyps remain stable in 5 patients and decreases in 5 patients. In the 7 patients in whom the treatment lasts more than 12 months, the number of polyps decrease with a mean of 8,5±7,5 (Figure 2). The dimension of the polyps remains stable in 11 patients and decreases in 6 (Figure 3). Only 1 patient showed recurrence of new polyps during the first 12 months of treatment. In this patient no modification of expression of ERβ was observed. However, after 24 months of treatment the polyps decreased concomitantly to the increased expression of ERβ. This is also the only patient in whom polypectomies of the rectal stump were needed during the first year of treatment. The histological evaluation shows stable adenomatous pattern with mild dysplasia in 10 patients, a passage from severe to mild dysplasia in 3 patients and a passage from adenomatous pattern to simple phlogosis in 4 patients. A good degree of concordance was encountered for the number and dimension of the polypoid lesions by the two endoscopists (k value 93%). The study was completed by all the patients. No patients complain of disturbances and any adverse effect was referred. No one stopped the treatment voluntary. Proliferative activity of the normal mucosa was determined in seven FAP patients before and after treatment with Adipol® for at least 12 months. The results showed that proliferative activity was not significantly varied by Adipol® (LI was. 2. na zi. Time. Figure 4 - Panel A: labelling Index in individual patients before and after treatment with Adipol®. Panel B: distribution of proliferative activity in the three crypt compartments (lower, mid, upper) expressed as % of proliferation in each compartment (labelled cells in each compartment/total labelled cells in the crypt x 100); bars represent means of six values + SE.. 82. Clinical Cases in Mineral and Bone Metabolism 2018; 15(1):79-84.
(5) CCMBM 1 2018-2bozza.qxp_- 23/04/18 11:27 Pagina 83. 1,60E+03. 1,20E+03. mRNA (ERȾ/GAPDH). T3. T4. Figure 7 - Expression of ERα, evaluated by real-time PCR in 17 patients. mRNA expression was evaluated in rectum or pouch biopsies at T1 (6 months), T2 (12 months), T3 (18 months), and in some cases T4 (24 months), after the starting time of the beginning of the treatment. Data are normalized against GAPDH mRNA. Pouch cases are number 6, 7 and 12. Ti me. gressive decrease of the number and size of the polyps. On the contrary, ERα mRNA expression has not changed over the months during the treatment (Figure 7).. *. 1,40E+03. * p<0.05. 1,00E+03. Discussion. 8,00E+02. *. 6,00E+02. 4,00E+02. 2,00E+02. 0,00E+00. Tempo T1 0. T2. T3. Time. T4. log10 (ERȾ/GAPDH). C IC. Ed. iz. Figure 5 - Trend expression of ERβ, evaluated by real-time PCR at four times in 17 patients. Data are normalized against GAPDH mRNA and are the mean ± SE (*p<0.05 versus T1, Wilcoxon Test). T1 (6 months), T2 (12 months), T3 (18 months), T4 (24 months).. ©. T2. io ni In te r. F. T1. on al i. Genetic expression analysis of Estrogen Receptors Alpha (ER-α) and Beta (ER-β) The expression of both estrogen receptors α and β genes during the administration of the dietary supplement with Adipol®, has been evaluated in 17 patients on a treatment time of 6, 12, 18 and in some cases 24 months. The quantitative analysis has demonstrated that in intestinal mucosa either of the rectum or of the ileal pouch, basal ERβ mRNA significantly increased (p<0.01) at 12, 18, and 24 months from the administration of Adipol® (Figure 5). The biological effect increased with time in the majority of patients (Figure 6). In some patients the upregulation of ERβ happened only after several months and this data was correlated with a pro-. na zi. found in the lower and mid parts of the crypt, while only a small percentage of proliferating cells was present in the upper crypt compartment. This pattern of proliferation was not varied by Adipol® treatment (Figure 4, panel B). Similarly, apoptotic activity in the mucosa was not significantly varied by Adipol® (AI: 0.36±0.15 and 0.18±0.06, before and after treatment, respectively; means±SE).. log10 (ERȽ/GAPDH). Low intestinal tract adenomatous polyps regression in FAP patients by dietary-induced erbeta upregulation. Figure 6 - Expression of ERβ, evaluated by real-time PCR in 17 patients. mRNA expression was evaluated in rectum or pouch biopsies at T1 (6 months), T2 (12 months), T3 (18 months), and in some cases T4 (24 months), after the starting time of the beginning of the treatment. Data are normalized against GAPDH mRNA. Pouch cases are number 6, 7 and 12. T1. T2. T3. T4. Clinical Cases in Mineral and Bone Metabolism 2018; 15(1):79-84. FAP represents a human model of adenoma-carcinoma sequence in which all the glandular mucosa of the intestine is genetically predisposed to the development of adenomas and carcinomas with time. The high content of phytoestrogens in the eastern diet is considered among factors responsible for the lower colorectal cancer incidence and mortality in western population in confront to USA population (13). It has been also shown that dietary intake of phytoestrogens is inversely related to the colorectal cancer risk (14). Phytoestrogens are an heterogenous group of polyphenolic plantderived compounds which on the basis of their chemical structure are classified into four classes: isoflavones, flavonoids, lignans and coumestans. The dietary compounds are present in the food as inactive precursors and are processed by the intestinal microflora into active hormonal molecules. Eviendep® is a patended blend of phytoestrogens (silymarin and lignans) and non-starch insoluble fibers which has been tested both in APC mutated mice and in FAP patients. The number and the degree of dysplasia of the intestinal polyps significantly decreases in the animals after 3 months of phytoestrogens supplementation (15). Also the number and the size of the duodenal adenomatous polyps of FAP patients are reduced after 3 months of oral supplementation with Eviendep® (16). From 2014 Eviendep® has been changed name in Adipol®. The effect of Adipol® on the rectal or ileal pouch mucosa has not been tested until now. The protective effect of the phytoestrogens is due to their structure which resembles that of the estrogens and can bind to estrogen receptors (ERs). ERs are widely distributed in human colorectal cells. Two subtypes of ERs are identified: ERα and ERβ. ERβ is the predominant subtype. The expression of ERβ is progressively reduced in the colorectal tumors and its decrease is inversely proportional to the degree of. 83.
(6) CCMBM 1 2018-3bozza.qxp_- 03/05/18 15:30 Pagina 84. F. Tonelli et al. References. 3. 4. 5. 6. 7. 8. 9.. 10.. on al i. 2.. De Cosse JJ, Bulow S, Neale K, et al. Rectal cancer risk in patients treated for familial adenomatous polyposis. Br J Surg. 1992;79:13721375. Parc Y, Piquard A, Dozois RR, et al. Long-term outcome of familial adenomatous polyposis patients after restorative coloproctectomy. Ann Surg. 2004;239:378-382. Tonelli F, Ficari F, Bargellini T, Valanzano R. Ileal pouch adenomas and carcinomas after restorative proctocolectomy for familial adenomatous polyposis. Dis Colon Rectum. 2012;55:3-10. Giardiello FM. Treatment of colonic and rectal adenomas with slindac in familial adenomatous polyposis. N Engl J Med. 1993;328:1313-1316. Steinbach G, Lynch PM, Phillips RK, et al. The effect of celecoxib, a cyclooxygenase-2 inhibitor, in familial adenomatous polyposis. N Engl J Med. 2000;342:1946-1952. Tonelli F, Valanzano R, Messerini L, Ficari F. Long-term treatment with sulindac in familial adenomatous polyposis. Is there an actual efficacy in prevention of rectal cancer? J Surg Oncvol. 2000;74:15-20. Solomon SD, McMurray JJ, Pfeffer MA, et al. Cardiovascular risk associated with celecoxib in a clinical trial for colorectal adenoma prevention. New Engl J Med. 2005;352:1071-1080. Bussey HJ, DeCosse JJ, Deschner EE, et al. A randomized trial of ascorbic acid in polyposis coli. Cancer. 1982;50:1434-1439. West NJ, et al. Eicosapentoic acid reduces rectal polyp number and size in familial adenomatous polyposis. Gut. 2010;59:918-925. Cruz-Correa M, et al. Combination treatment with curcumin and quercetin of adenomas in familial adenomatous polyposis. Clin Gastroenterol Hepatol. 2006;4:1035-1038. Femia AP, Salvianti F, Luceri C, Dolara P, Salvadori M, Pinzani P, Caderni G. Sustained proliferation and resistance to apoptosis after a cytotoxic insult are early alterations in rat colon carcinogenesis. Int J Cancer. 2012;131:529-536. Lipkin M. Biomarkers of increased susceptibility to gastrointestinal cancer: new applications to studies of cancer prevention in human subjects. Cancer Res. 1988;48:235-245. Whittemore A, Wu-Williams AH, Lee M, et al. Diet, physical activity, and colorectal cancer among Chinese in North America and China. J Natl Cancer Inst. 1990;82:915-926. Cotterchio M, Boucher BA, Manno M, Gallinger S, Okey A, Harper P. Dietary phytoestrogen intake is associated with reducede colorectal cancer risk. J Nutr. 2006;136:3046-3053. Barone M, Tanzi S, Lofano K, et al. Dietary induced ERb upregulation counteracts intestinal neoplasia development in intact male APC Min/1 mice. Carcinogenesis. 2010;31:269-274. Calabrese C, Praticò C, Calafiore A, et al. Eviendep reduces number and size of duodenal polyps in familial adenomatous polyposis patients with ileal pouch-anal anastomosis. World J Gastroent. 2013;19:5671-5677. Kostantinopoulos PA, Kominea A, Vandoros G, et al. Oestrogen receptor beta is abundantly expressed in normal colonic mucosa, but declines in colon adenocarcinoma paralleling the tumour’s dedifferentiation. Eur J Cancer. 2003;39:1251-1258. Martineti V, Picariello L, Tognarini I, et al. ERbeta is a potent inhibitor of cell proliferation in the HCT8 human colon cancer cell line through regulation of cell cycle components. Endocrine-Related Cancer. 2005;12:445-469. Principi M, Di Leo A, Pricci M, Scavo MP, Guido R, Tanzi S, Piscitelli D, Pisani A, Ierardi E, Comelli MC, Barone M. Phytoestrogens/insoluble fibers and colonic estrogen receptor β: randomized, double-blind, placebo-controlled study. World J Gastroenterol. 2013;19:4325-4333. Calabrese C, Rizzello F, Gionchetti P, Calafiore A, Pagano N, De Fazio L, Valerii MC, Cavazza E, Strillacci A, Comelli MC, Poggioli G, Campieri M, Spisni E. Can supplementation of phytoestrogens/insoluble fibers help the management of duodenal polyps in familial adenomatous polyposis? Carcinogenesis. 2016;37:600-606. Thomas C, Gustaffson J. The differente roles of ER subtypes in cancer biology and therapy. Nature Reviews Cancer. 2001;11:597-608. Lynch PM. Chemoprevention of familial adenomatous polyposis. Famil Cancer. 2016;15:467-475.. na zi. 1.. ©. C IC. Ed. iz. io ni In te r. the dysplasia and the stage of the cancer (17). Conversely, ERα remains substantially unchanged between normal mucosa and neoplastic mucosa. Therefore, the protective effect of the estrogens against colorectal carcinogenesis seems related to a low ERα/ERβ ratio and the consequent prevalent estrogen binding to ERβ. It has also been shown on cultures of the colorectal cancer cells that the over-expression of ERβ in human colon cancer cells inhibits their proliferation by modulation of some key molecular regulators of the cell cycle (decrease in cyclin E and increase in the CDK inhibitor p21C1P1) (18). Dietary supplement with Eviendep® administered for 2 months is able to increase the expression of ERβ in the colonic mucosa of patients scheduled to undergo surveillance colonoscopy for previous sporadic colonic adenomas (19). Similarly an upregulation of ERβ has been shown in the duodenal polyps of patients with FAP after admistration of Adipol®. Interestingly, the changes of molecular factors involved in the carcinogenesis after Adipol® supplementation have been studied on biopsies of the duodenal adenomas showing a decrease of mRNA expression of some oncogenes such as COX-2, PCNA and MUC1 and an increase of mRNA expression of inhibitors genes such as MUC. Also microRNAs could be modified after supplementation with Adipol®: the expression of miR-101 which suppresses growth and invasiveness of colorectal cancer have been found to increase after Adipol® supplementation (20). The present experience shows that the treatment with Adipol® allows to abolish the growth of new adenomatous polyps in all patients and can reduce the number and size of the adenomas observed at the beginning of the treatment. It is also important to note that none of the patients (except 1) required to perform removal of recurrent polyps for over two years, differently from what was observed before starting treatment with Adipol®. Furthermore, the positive effect is maintained during all the period of supplementation of Adipol® showing that there is not an escape of its effect. Of note, Adipol® does not induce or potentiate ERα expression in the rectal mucosa, demonstrating its selective effect on the ERβ. In our study the decrease of the polyps was accompanied by a decrease of dysplasia and an increase of ERβ expression. As in other reports, this effect seems not due to the modification of the proliferative activity or apoptosis in the rectal mucosa (21). Our data confirm the absence of collateral effects and the tolerability of this patented blend. Currently, there are no approved therapies for the primary chemoprevention of FAP (22). Despite the evidence that NSAIDs may regress adenomas after colectomy with IRA, their effect is lost with time and no evidence exists that the drug prevents the development of malignancy in the rectal stump (6, 22). In conclusion, taking in account that surgery does not eliminate the recurrence of adenomatous polyps in the lower intestinal tract of operated FAP patients, dietary supplementation with phytoestrogens can prevent the formation of new polyps with good tolerability and in absence of side effects. In the future, it will be necessary a controlled clinical trial to confirm our findings.. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20.. 21. 22.. 84. Clinical Cases in Mineral and Bone Metabolism 2018; 15(1):79-84.
(7)
Documenti correlati
This research examines the 2010 financial statements under IFRS of 189 Italian listed groups and their compliance with mandatory disclosure on intangible assets and presents an
Per fornire un saggio a illustrazione dell’opera ho scelto la parte iniziale del canto VI, quindi cir- ca a metà dell’opera che consta di tredici canti, ove si realizza l’evento
In this work, we present a set of preliminary results on measuring the population diversity during the DE process, to investigate how different DE strategies and population sizes
Indirizzo Autori: (1) Department of Agricultural, Food and Forestry Systems, Università Degli Studi Di Firenze, Firenze, Italy; (2) Institute of Plant Protection, Italian
16 We have previously shown that oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine (oxPAPC) increased the generation of ROS in
According to the present and previous 23–26 photoemission results and theoretical results, 30 the intense feature in region II with maximum at 1.5 60.2 eV of binding energy can
Given the potentially large systematic uncertainties that can affect stellar masses, and particularly SFRs, derived via spectral energy distribution (SED) fitting, it is
specific biological target, thanks to its selective affinity in receptor binding (biological target) and a linker spacer (linker) was inserted between ligand and the