UNIVERSITÀ DEGLI STUDI DI BRESCIA
DIPARTIMENTO DI MEDICINA MOLECOLARE E
TRASLAZIONALE
DOTTORATO DI RICERCA IN GENETICA MOLECOLARE,
BIOTECNOLOGIE E MEDICINA SPERIMENTALE
XXXIII ciclo
Settore scientifico disciplinare: BIO/10 - Biochimica
Modelling Chronic Myeloid Leukemia in Zebrafish
Supervisor: PhD student:
Prof. Eugenio Monti Marco Varinelli
Anno accademico 2019-2020
Riassunto
Danio rerio (zebrafish) sta assumendo un ruolo di sempre maggior rilievo in ambito
scientifico, non solo nella ricerca di base, ma anche negli studi comportamentali, negli studi di patologie neurodegenerative, nella ricerca farmacologica e negli studi di malattie ereditarie e congenite. Negli ultimi anni, questo modello animale è stato utilizzato per lo studio dei tumori del sangue, in quanto i diversi pathways biochimici, le cellule ed i principali geni coinvolti nei processi ematopoietici di zebrafish sono molto simili a quelli dell’uomo. L’obiettivo del mio progetto di ricerca è stato la generazione di un modello animale zebrafish per lo studio della leucemia mieloide cronica (LMC). Tale patologia è causata da un peculiare difetto genetico: la traslocazione tra i cromosomi 9 e 22 con conseguente fusione dei geni BCR e ABL1 e formazione del cromosoma Philadelphia. Nel modello animale zebrafish i geni bcr e abl1 sono localizzati su cromosomi distinti e presentano lo stesso numero di esoni e la stessa organizzazione genica dei geni descritti nell’uomo. Lo studio delle sequenze amminoacidiche delle proteine codificate dai geni bcr e abl1 mi ha permesso di riscontrare un livello particolarmente elevato di identità con le corrispondenti proteine umane, pari al 78% per Bcr e al 73% per Abl1. Nel caso di Abl1 la percentuale di identità sale al 97% se si considera il solo dominio tirosin-chinasico della proteina. Tale dato mi ha indotto a sviluppare un modello transgenico per studiare l’effetto dell’induzione dell’espressione ubiquitaria della proteina p210 codificata dal gene BCR/ABL1 in embrioni di zebrafish. L’overespressione del gene di fusione responsabile della malattia nell’uomo porta nel modello zebrafish, a poche ore dall’induzione, ad alterazioni nel profilo d’espressione di geni coinvolti nei principali processi ematopoietici, in particolare quelli relativi alla linea bianca. A distanza di mesi dall’induzione, analisi di citometria condotte su sangue di animali transgenici rilevano differenze sostanziali rispetto ad individui wild type. Dopo un anno, all’analisi istologica i principali organi ematopoietici presentano importanti alterazioni anatomiche nei pesci transgenici che riportano alla patologia oggetto di studio.
Oltre al modello transgenico, ho utilizzando la tecnologia CRISPR/Cas9 per riprodurre la traslocazione cromosomica nello zebrafish e sviluppare un modello di LMC. Ho individuato sgRNA specifici per le zone introniche dei geni bcr e abl1 e ho valutato la capacità degli stessi di indurre rotture a livello genico. Ho successivamente messo a punto un sistema di
screening per la ricerca di riarrangiamenti genomici positivi mediante digital PCR su
campioni di cDNA. Analisi preliminari condotte su pesci portatori della traslocazione hanno rilevato interessanti caratteristiche a livello istologico. L’analisi della progenie ottenuta
dall’incrocio con la linea transgenica kdrl:EGFP suggerisce la presenza di anomalie nei processi di sviluppo del plesso venoso caudale.
Infine, ho utilizzato linee cellulari leucemiche umane e ho messo a punto un modello di xenotrapianto, andando a studiare il comportamento delle cellule, la loro aggressività e la loro capacità di proliferazione nei giorni successivi all’iniezione in embrioni di zebrafish.
1. Introduction... 1
1.1 Chronic Myeloid Leukemia ... 1
1.2 The Zebrafish Animal Model ... 3
1.3 Zebrafish as Animal Model to Study Hematological Diseases ... 4
1.4 Aims and Objectives ... 6
2. Materials and Methods ... 8
2.1 Bioinformatic Analysis ... 8
2.2 Fish Breeding, Embryo Collection, and Treatments ... 8
2.3 Microinjection ... 8
2.4 Transgenesis tol2 Mediated ... 9
2.5 Activation of the Transgenic Promoter hsp70 ... 9
2.6 Digital PCR ... 10
2.7 Whole-mount in situ Hybridization ... 11
2.8 RNA Extraction and Real-time PCR ... 11
2.9 PH3 Immunofluorescence ... 12
2.10 Acridine Staining ... 13
2.11 Blood Extraction ... 13
2.12 Histological Analysis ... 14
2.13 Cytometry ... 14
2.14 CRISPR-mediated Genome Editing ... 14
2.15 Syntetic Gene, Primers, and Probe Design ... 15
2.16 Digital PCR for Screening ... 16
2.18 Cell Preparation and Injection ... 16
2.19 Ki67 Immunofluorescence ... 17
2.20 Imaging ... 17
2.21 Statistical analysis ... 17
3. Results ... 19
3.1 Identification and Characterization of Zebrafish bcr and abl1 Genes ... 19
3.2 Generation of BCR/ABL1 Transgenic Line ... 21
3.3 Expression Confirmation through Direct Visualization of CFP ... 22
3.4 Expression Confirmation through Digital PCR with Human Primers ... 23
3.5 Rapid Accumulation of Hematopoietic Cells ... 24
3.6 Molecular Characterization of Transgenic Line ... 24
3.8 Absence of Abnormal Apoptosis ... 28
3.9 Histological Alterations as Long-term Drawbacks ... 29
3.10 Alterations in Blood Cell Populations ... 33
3.11 Generation of Translocated Fish ... 33
3.12 Screening on cDNA ... 36
3.13 Electrophoresis of PCR Mixtures... 36
3.14 Digestion as Internal Control ... 37
3.15 Results of Sequence Analysis ... 38
3.16 Histological Analysis of Genome Engineered Animals ... 39
3.17 Phenotypes of bcr/abl1 Fish in Transgenic Background ... 42
3.18 HL-60 Injection... 43
3.19 Ki67 Immunofluorescence ... 44
4. Discussion ... 46
References ... 50
Acknowledgments... 56 DICHIARAZIONE DI CONFORMITÀ DELLE TESI ... Errore. Il segnalibro non è definito.
1. Introduction
1.1 Chronic Myeloid Leukemia
Chronic myeloid leukemia (CML) is a cancer of the white blood cells with an annual incidence of 2 cases every 100,000 persons, accounting for 15%-20% of all adult leukemias. CML is characterized by uncontrolled proliferation of myeloid cells and their progenitors in the peripheral blood (PB) and bone marrow (BM).
CML is associated with a characteristic chromosomal translocation named the Philadelphia (Ph) chromosome. The Ph chromosome is the result of a reciprocal translocation between chromosome 9 and 22, where an oncogene, ABL1 (Abelson murine leukemia), on chromosome 9 is fused with a formerly unknown gene, BCR (breakpoint cluster region), on chromosome 22 (Figure 1). BCR-ABL1 fusion products are present in approximately 95% of CML.
There are three main BCR-ABL1 variants due to alternative splicing or translocation at different breakpoints between the BCR and ABL1 exons, which correspond to three proteins of approximately 190, 210, and 230 kD. In CML, the break in the BCR gene is in a region designated as the major breakpoint cluster region and the fusion protein is approximately 210 kD (Ma et al. 2015).
Figure 1. The translocation between the q (long) arm of chromosome 9 and the one of chromosome 22 brings to the fusion of BCR and ABL1 genes and the formation of the Philadelphia (Ph) chromosome (Winslow et al. 2007).
Clinically, the progression of the disease is generally triphasic, beginning with the chronic phase (CP), which then progresses to the accelerated phase (AP), finally leading to the blast phase (BP). In the chronic phase, the white blood cell (WBC) count in patients progressively increases. In the peripheral blood (PB), blasts account for less than 15% of the WBC count, and symptoms like splenomegaly, weight loss, and B cell symptoms (fever, night sweats, and weight loss) may occur. The course from the chronic phase to the more aggressive phases without treatment is 3.5-5 years. In the accelerated phase, patients have increasingly worse blood cell counts, which show blasts accounting for 15% to 30% in the PB, and organomegaly. In the blast phase, patients develop symptoms like those of acute leukemia, including bone pain and B cell symptoms. There are increasing numbers of blast cells, both in the PB and the bone marrow (BM). This stage is diagnosed when blasts account for more than 30% of the PB (Chereda et al. 2015). Different molecular signaling pathways essential for the pathogenesis of chronic leukemia have been found to be downstream of the BCR-ABL1 protein. The fusion protein BCR-ABL1 is a constitutively active tyrosine kinase that constantly activates various signaling pathways regulating cell proliferation, transformation, and survival, thereby promoting leukemogenesis. In fact, after the fusion with BCR, the internal control mechanism of the kinase activity of ABL1 is blocked, leading to the accumulation of the BCR-ABL1 protein in the cytoplasm of tumor cells, where the protein plays its leukemogenic role. In the cells, BCR-ABL1 induces the activation of transductional signaling pathways which lead to the reduction of the apoptosis, the increase of the cellular proliferation, and the alteration of the interations between cell and the extracellular matrix, with the consequent increase of cell motility and neoplastic transformation. Since 2001, tyrosine kinase inhibitors (TKIs) have been used as first line treatments. The therapeutic use of TKIs, such as imatinib, dasatinib, and bosutinib, has transformed the management of CML, largely turning a lethal disorder into a chronic condition. However, conventional TKI therapy for CML still presents challenges, including the appearance of TKI-resistant BCR-ABL1 mutants and the relative resistance of CML leukemia stem cells to TKIs. Additionally, all TKIs have a similar spectrum of toxic effects that can negatively affect the patient’s quality of life. Furthermore, CML and other malignancies include a population of cancer stem cells (CSCs) that is able to regenerate or self-renew, resulting in therapeutic resistance and disease progression. The inability to eradicate these CSCs remains a significant hindrance to curing these diseases (Radich et al. 2017). Biomedical research requires suitable animal disease models for studying the mechanisms responsible for the cellular and molecular pathologies and testing certain therapeutic methods.
1.2 The Zebrafish Animal Model
Zebrafish (Danio rerio) is a freshwater teleost fish that has emerged as a model organism in many research fields. First, the zebrafish was used as a classical developmental and embryological model thanks to the combination of external fertilization and optical transparency of embryos and larvae. Recently, the development of genetic techniques, such as transgenesis, has highlighted the power of zebrafish to model human acquired disease, and different transgenic strategies have been developed with the aim of inducing gene and oncogene expression in specific tissues and organs (Ablain et al. 2013). One of these strategies is repredented by the GAL4/upstream activation sequence (UAS) transgenic system, popularly used in Drosophila and also successfully tested in zebrafish. In the GAL4/UAS system, the yeast transcription activator GAL4 binds its target sequence UAS and activates transcription of UAS-linked genes. The main benefit of the GAL4/UAS system is that the
GAL4 gene and UAS target gene are located in two transgenic lines, and their mating is
fundamental to generate a binary transgenic system. In the GAL4 line, the GAL4 gene is placed downstream of a selected promoter; the activator protein GAL4 may be present but has no target gene to activate. In the UAS line, UAS is fused to a target or effector gene which is silent in the absence of the GAL4 activator. When the GAL4 and UAS lines are crossed, the target genes are turned on in the double-transgenic progeny, following the expression pattern of GAL4 in the activator lines (Zhan et al. 2010). Therefore, the GAL4/UAS system has been widely used to regulate gene expression in a cell-specific and temporally restricted manner and has provided a powerful tool to test the function of the genes that may be lethal or sterile, trace transgene expression during development, and monitor subcellular structures and target tissues for selective ablation or physiological analyses (Kawasami et al. 2016).
In addition to the transgenic models, new genome editing technologies have been applied to establish animal models with increasing rapidity (Liu et al. 2017). The CRISPR/Cas9 type II system of Streptococcus pyogenes has been optimazed and successfully used in vertebrate cells to edit genomes. In zebrafish this method relies on injecting the Cas9 protein together with sgRNA into embryos at the one cell-stage. The catalytic activity of the Cas9 protein generates double-strand breaks (DSBs) in target DNA. Cleaved DSBs will be repaired either by a non-homologous end joining (NHEJ) mechanism, which is error-prone and therefore generates indel mutations, or by homologous recombination (HR), a process that can be exploited for more precise genomic modification (Hruscha et al. 2013, Gagnon et al. 2014). Among its many applications, the CRISPR/Cas9 type II system offers the exciting possibility of engineering small and large portions of chromosomes to induce a variety of structural alterations, such as deletions, inversions, insertions, and interchromosomal translocations
(Choi et al. 2014, Ghezraoui et al. 2014, Torres et al. 2014, Chen et al. 2015, Lagutina et al. 2015, Lekomtsev et al. 2016, Cheong et al. 2018).
Moreover, zebrafish provides a unique opportunity for studying human cancer cell behavior in xenotransplantation assay, due to the optical transparency of the model and the ease of its manipulation. Xenotransplantation is the transfer of living cells or tissue from one species to another. The appeal of zebrafish xenotransplantation of human cancers for drug discovery and evaluation lies in the possibility of observing directly the drug response of human tumor material, particularly primary patient-derived biopsy specimens that are often hard to maintain
in vitro, in a cost-effective, time-efficient manner. The approach circumvents some of the
current hurdles with rodent xenografts, such as those related to availability of sufficient patient material, as well as the challenges of optimizing murine hosts to enhance engraftment. Zebrafish xenotransplantation approaches have the potential to serve as a first step in a preclinical pipeline to screen for drugs, before moving on to the more costly and time-consuming mouse and ultimately human trials (Veinotte et al. 2014). The zebrafish xenograft platform could also, for the first time, provide a bona fide real-time in vivo platform for personalizing cancer therapeutics (Idilli et al. 2017). Given their size and permeability to small molecules, zebrafish embryos are suitable for testing a variety of different compounds in highthroughput, large-scale chemical screens (Zhang et al. 2012, Guarienti et al. 2015, Deveau et al. 2017). Zebrafish are the ideal model for high- and medium-throughput screens, because their small size enables the fish to be arrayed in a variety of isolated well plates and to be bathed in water that contains the compounds of interest. This approach provides a highthroughput platform that is substantially more rapid than injecting mice. Furthermore, embryo screens have the potential to reveal important information on absorption, distribution, metabolism, and excretion when whole organisms are exposed to a drug.
1.3 Zebrafish as Animal Model to Study Hematological Diseases
By virtue of its considerable advantages, zebrafish is becoming a valuable tool for understanding physiological and pathological mechanisms involved in human hematopoiesis. Zebrafish shares with other vertebrates all major blood cell types generated by similar developmental pathways. Additionally, many of the genes known to regulate erythropoiesis in mammals have been identified in zebrafish. This animal model is also characterized by a high conservation of transcription factors and major signaling pathways involved in hematopoietic stem cell (HSC) differentiation and maturation. Notably, zebrafish possesses blood-forming marrow, spleen, and thymus which exist only in jawed vertebrates, and it lacks lymph nodes (Gore et al. 2018).
In mammals, primitive hematopoiesis is largely erythropoietic and occurs outside the embryo in the blood islands of the yolk sac. In the later stages of development, hematopoiesis moves to the aorta-gonad-mesonephros region and the fetal liver. Definitive hematopoiesis occurs in adults in the bone marrow, where all blood cell lineages are produced (Golub et al. 2013). By contrast, primitive hematopoiesis in zebrafish occurs in the intermediate cell mass (ICM, a tissue derived from ventral mesoderm), anteriorly in the paraxial mesoderm over the yolk, and posteriorly in a small ventral cluster of cells located in the developing tail, which is referred to as the posterior blood island. The ICM is a region analogous to the blood islands of the yolk sac in mammals. Hematopoietic progenitor cells from the posterior blood island enter the circulation slightly later than those in the ICM and may represent the end stage of primitive hematopoiesis. As in mammals, zebrafish blood development involves three sequential waves: the primitive wave, the erythromyeloid progenitor (EPM-derived) wave, and the definitive wave, each of which occurs in different embryonic locations (Figure 2). The primitive wave starts at 11 hours post-fertilization (hpf) and it is characterized by the presence of “primitive” macrophages and the first circulating erythrocytes (Paik et al. 2010). At 12 hpf (5 somites), when ICM precursors adopt a cell fate they express three different transcription factors: gata1, considered as a key regulator of erythroid cell fate, pu.1 (spi1b), a master regulator of myeloid lineage, and kdr, expressed in angioblasts (Cantor et al. 2002, Hu et al. 2014). Few identified factors have been shown to act upstream of gata1 or pu.1 to regulate the balance between erythroid and myeloid cell fate (Galloway et al. 2005, Rhodes et al. 2005). Definitive hematopoiesis in zebrafish has been shown to initiate around 28-30 hpf; it gives rise to definitive adult-like hematopoietic stem cells (HSPc), which have both self-renewal capacity and erythroid, myeloid, and lymphoid potential. In zebrafish, these newly formed HSCs rapidly enter the circulation through the lumen of the caudal vein, whereas in mammals and chick embryos they proliferate and differentiate locally. In mammals, the HSCs created during embryogenesis sustain blood production throughout life. In zebrafish, between 48 and 96 hpf the newly emerged HSCs enter the circulation and migrate to colonize the Caudal Hematopoietic Tissue (CHT) in the posterior tail region during a transient wave of definitive hematopoiesis. The zebrafish CHT is comparable to the mammalian placenta and fetal liver, being the tissue where the nascent HSCs undergo proliferation and maturation before colonizing the kidney marrow (KM), which, similarly to the mammalian bone marrow, functions as the adult hematopoietic niche. In both zebrafish and mammals, the adult niche is characterized by a complex system of vessels that interacts with HSCs and acts as an interface between blood circulation and stromal cells. The KM represents the ultimate site of definitive
hematopoiesis and produces mature myeloid and lymphoid cells from two weeks of development.
In the last decade, a significant number of human hematopoietic malignancies have been modelled in zebrafish (Ma et al. 2009, Gjini et al. 2015).
Figure 2. Schematic representation of hematopoiesis in zebrafish. The primitive wave commences in two locations, the anterior lateral mesoderm (ALM) (orange), which gives rise to primitive monocytes, and the intermediate cellular mass (ICM) (violet), which generates mostly primitive erythrocytes before 24 hpf. A transient “intermediate” wave occurs in the posterior blood island (PBI), where both erythrocytes and heterophils are formed (grey). Definitive hematopoietic stem cells (HSCs) are initially formed by budding from the hemogenic endothelium on the ventral wall of dorsal aorta (blue). A subset of these HSCs migrate to the caudal hematopoietic tissue (CHT) (yellow) to produce several cell lineages and to the thymus (purple), where T lymphocyte production occurs. Finally, HSCs seed the developing kidney (green), the final site of definitive hematopoiesis where erythroid, myeloid, and B lymphocyte production occurs. The lineage-specific transcription factors that serve to regulate this process are in red (Rasighaemi et al. 2015).
1.4 Aims and Objectives
The aim of my project is the creation of a faithful zebrafish model that could recapitulate the main phenotypes of chronic myeloid leukemia. There are existing zebrafish models for acute
myeloid leukemia (Alghisi et al. 2013, Skayneh et al. 2019), acute lymphoblastic leukemia (Frazer et al. 2009, Sinha et al. 2019), chronic lymphocytic leukemia (Auer et al. 2007), and lymphomas (Feng et al. 2007, Frazer et al. 2009). The first and only model of CML-like disease to my knowledge has been presented recently (Xu et al. 2020). Given the high homology between the BCR and ABL1 human genes and their counterpart in zebrafish, I decided to create two models using different techniques. First, I generated a transgenic model for chronic myeloid leukemia, expressing the human fusion gene BCR/ABL1. Using the Gal4/UAS system, I generated a transgenic fish expressing the human cDNA encoding for the fusion protein p210 involved in the chronic myeloid leukemia. This model will help to understand the pathogenic role of a human protein in an animal model. For the second model, I used the CRISPR/Cas9 technique to recreate directly in the animal the condition for the formation of the fusion gene that leads to the disease. Generating in zebrafish a double break of the two genes that in human are involved in the translocation, I tried to reproduce the conditions for the onset of the genomic rearrangement. The latter attempt at creating a zebrafish model has never been made before, but may represent a more effective alternative for the generation of an animal model for a human disease. Finally, I generated a xenograph model injecting acute leukemia cells in zebrafish. The latter model allows to evaluate the behaviour of leukemic cells once they are in the blood circulation of the zebrafish.
2. Materials and Methods
2.1 Bioinformatic Analysis
Genomic sequences of zebrafish were analyzed using the University of California Santa Cruz (UCSC) Genome Browser on the GRCz11 (May 2017) Danio rerio assembly and the Ensembl zebrafish genome database. Synteny analysis was performed by using the Synteny Database. Nucleotide and amino acid sequences were compared to the non-redundant sequences present at the NCBI (National Center for Biotechnology Information) using the Basic Local Alignment Search Tool (BLAST). Multiple sequences alignment was performed using the MUSCLE algorithm.
2.2 Fish Breeding, Embryo Collection, and Treatments
Wild type zebrafish AB strain and the transgenic lines Tg(kdrl:EGFP) were used for the experiments. Both were kept in tanks containing 3-5 l of water at 28 °C on a 14 h light/10 h dark cycle. Adult zebrafish were bred by natural crosses and collected embryos were raised at 28 °C in fish water (0.1 g/l Instant Ocean Sea Salts, 0.1 g/l sodium bicarbonate, 0.19 g/l calcium sulfate, 0.2 mg/l methylen blue, H2O) until the desired developmental stage was reached. To examine post-gastrulation stages, regular fish water was replaced by 0.0045% PTU (1-phenil-2-thiourea, Sigma) solution. Embryos were dechorionated by hand using sharpened forceps and then fixed in 4% paraformaldehyde overnight at 4 °C (or 2 h at room temperature), into 2-ml tubes, dehydrated through sequential washes in 25%, 50%, 75% methanol/PBS, 100% methanol, and stored at least overnight at −20 °C. The oldest age at which the zebrafish embryos were sacrificed is 96 hpf.
Zebrafish were maintained and used following protocols approved by the local committee (Organismo Per il Benessere Animale – Committee for Animal Health) (No. 211B5-10) and the Italian Ministry of Health (Project n° 287/2018), and in accordance with European rules of animal use.
2.3 Microinjection
Injections were carried out on one-cell-stage embryos (with Eppendorf FemtoJet Micromanipulator 5171); the dye tracer phenol-red was co-injected as a control. After microinjection, embryos were incubated in fish water supplemented with 0.003% PTU at 28 °C to prevent pigmentation processes. Embryo development was evaluated at 24 hpf, 48 hpf, and 72 hpf.
2.4 Transgenesis tol2 Mediated
A transposon-donor plasmid named Tol2, containing the p210 human cDNA linked with CFP under the control of UAS promotor, was used. This plasmid was microinjected into fertilized eggs together with a synthetic mRNA encoding the transposase, in order to catalyze DNA excision and recombination within the targeted genome. Every embryo was injected with 4 nl of the injection mix.
Injection mix: 250 ng mRNA tol2
600 ng pUAS: CFP-BCR-ABL1 2µl Phenol Red
H2O to a final volume of 10µl
The transposase mRNA was obtained starting from the pCS-TP plasmid, digested with NotI and transcribed with “Ambion SP6 mMessage mMachine”.
After the microinjection, the embryos were allowed to grow until the third month post fertilization. Tail fin was excised from each fish for genotyping. DNA was extracted and amplified using specific primers (For and Rev BA Human cDNA); amplified DNA was analyzed to search for fish carrying the transgene. Agarose gel electrophoresis was used for the detection of positive samples. The fish positive for the transgene were then out-crossed with wild type fishes to produce the Tg(UAS: CFP-BCR-ABL1) +/-, subsequently crossed with Tg(hsp70: GAL4) to produce the stable line Tg(hsp70: CFP-BCR-ABL1) (Figure 3).
2.5 Activation of the Transgenic Promoter hsp70
Embryos at 15-20 somites stage were transfered to a Petri dish with prewarmed fish water at 40 °C. The dish was incubated 1h in the hybridizer (40 °C) or in the incubator (40 °C). After 1h the dish was taken out and the embryos were relocated in a new dish with fish water at room temperature. Then the dish was transfered to the incubator at 28 °C. Once the embryos reached the stage of 24 hpf, they were collected for the subsequent experiments. The fluorescence first appeared 3h after the activation by heat-shock and increased until reaching a maximum of fluorescence at 12h post activation.
Figure 3. Representation of the generation process of the transgenic line studied. After the injection, the possible founders, identified with PCR screening, are crossed with wild type fish. The offsprings are screened and the fish eterozygote for the transgene are crossed with the stable transgenic lines hsp70:GAL4. The offsprings are activated at 15-20 somites and used for all the experiments.
2.6 Digital PCR
BCR-ABL1 transcript absolute quantification was performed by digital PCR (dPCR), due to
its reported sensitivity in human BCR-ABL1 transcript detection. The dPCR analysis was carried out at the Laboratory CREA (Centro di Ricerca Emato-Oncologico AIL) of the ASST Spedali Civili in Brescia and performed as follows (Bernardi et al. 2019). The cDNA was quantified using a QuantiT™ OliGreenR ssDNA kit (Thermofisher Scientific) by Infinite200 (Tecan) and diluted at 50 ng/µl, since this quantity proved to be the best to obtain a deep quantification and avoid the saturation of the chip. A mix of 16 µl containing 8 µl of 2X QuantStudio 3D Digital PCR Master Mix (Thermofisher Scientific), 0.8 µl of 20X TaqMan-MGB-FAM-probe assay, 1.1 µl of diluted cDNA, and 6.1 µl of nuclease-free water
(Qiagen) was prepared. The negative control reaction mix contained 8 µl of 2X QuantStudio 3D Digital PCR Master Mix, 0.8 µl of 20X TaqMan-MGB-FAM-probe assay, and 7.2 µl of nuclease-free water. One negative control containing samples prepared with the same mix was loaded at every thermal cycling run. The reverse transcription negative control reaction mix contained 8 µl of 2X QuantStudio 3D Digital PCR Master Mix, 0.8 µl of 20X TaqMan-MGB-FAM-probe assay, 1.2 µl of reverse transcription blank, and 6.1 µl of nuclease-free water. For each sample, 15 µl of the reaction mixes were loaded onto a QuantStudio 3D Digital PCR 20K Chip (Thermofisher Scientific) using the automatic chip loader, and the signal was amplified by the following thermocycling profile: 95 °C for 8 minutes, 45 cycles at 95 °C for 15 seconds, and 60 °C for 1 minute, with a final extension step at 60 °C for 2 minutes. The amplification was followed by the chips imaging and the secondary analysis was performed with the QuantStudio 3D AnalysisSuite Cloud Software. Human primers for screening:
Forward: 5’-TCCGCTGACCATCAAYAAGGA-3’ Reverse: 5’-CACTCAGACCCTGAGGCTCAA-3’ Probe: 5’-TTCAGCGGCCAGTAGCAT-3’
2.7 Whole-mount in situ Hybridization
Whole-mount in situ hybridization (WISH) was performed according to a standard protocol by Thisse and Thisse (Thisse et al. 2008). Embryos and larvae were collected, dechorionated, and incubated at 28 °C at different stages. Embryos were fixed overnight in 4% paraformaldehyde (PFA) at 4 °C, dehydrated through an ascending methanol series, and stored at −20 °C. After treatment with proteinase K (10 µg/ml, Roche), the embryos were hybridized overnight at 68 °C with DIG-labeled antisense or sense RNA probes (400 ng). Embryos were washed with ascending scale of Hybe Wash/PBS and SSC/PBS, then incubated with anti-DIG antibody conjugated with alkaline phospatase over night at 4 °C. The staining was performed with NBT/BCIP (blue staining solution, Roche) alkaline phosphatase substrates. When injected and not-injected fish had to be compared, all incubations were carried out at the same time and at the same probe concentration. WISH images were taken with Axiozoom.
2.8 RNA Extraction and Real-time PCR
Total RNA was extracted from 30 embryos for each developmental stage analyzed, using TRI-Reagent (Sigma) according to the manufacturer’s protocol. RNA was quantified using
the My Spect spectrophotometer (Biomed) and controlled by electrophoretic separation on a 1% TAE-agarose gel. 1.0 µg of total RNA was retro-transcribed to cDNA using Im-Prom reverse transcriptase (Promega) and oligo (dT) primers following the manufacturer’s protocol. Primers were designed with the PrimerQuest and Real-time PCR Tool from IDT. Real-time PCR was performed using the Eco-Illumina system. Reactions were performed in a 10 µl volume, with 2 µM of primer, 12.5 µl of Syber Green Master Mix (Biorad), and 20 ng of cDNA. The amplification profile consisted of a denaturation program (95 °C for 1 min), 40 cycles of two steps amplification (95 °C for 15 s and 60 °C for 30 s) followed by a melting cycle. Each reaction was performed in triplicate and when possible elongation factor 1α was used as a reference gene. Relative levels of expression were calculated through the ΔΔCT method and with respect to the 24 hpf stage. As shown in the following table, different primers were used: scl, lmo2, gata1, pu.1, runx1, c-myb, and mpx.
Table 1:
2.9 PH3 Immunofluorescence
Embryos at 20-24 hpf were fixed overnight in 4% paraformaldehyde (PFA) at 4 °C, dehydrated through an ascending methanol series, and stored at −20 °C. The first day the embryos were rehydrated in PBT and washed in Tris Buffer (150mM Tris HCl pH 9.0) for 5 min. The embryos were then incubated in Tris Buffer for 15 min at 70 °C and washed twice for 5 min in PBT and in H2O in ice. The embryos were then incubated in acetone at –20 °C for 20 min and blocked in blocking buffer for 4h at 4 °C. The embryos were incubated with the primary Ab PH3 in blocking buffer at 4 °C over night, then washed four times for 30 min with PBT and incubated with the secondary Ab for 3h at R.T in the dark. The embryos were washed five times for 5 min in PBD and fixed for 20 min with PFA 4%, then washed five times for 5 min in PBT and observed under the microscope.
FORWARD REVERSE
scl 5'-CCGCTCGCCACTATTAACAG-3' 5'-GTTCGTGAAAATCCGTCGC-3' lmo2 5'-ACTACAAACTCGGCAGAAAGC-3' 5'-CACGCATGGTCATTTCAAAGG-3' gata1 5'-TGAATGTGTGAATTGTGGTG-3' 5'-ATTGCGTCTCCATAGTGTTG-3'
pu.1 5'-CCATTAGAGGTGTCCGATGAG-3' 5'-ACCAGATGCTGTCCTTCATG-3' runx1 5'-CCCCGCCCACAGCCAGATTC-3' 5'-GACGGGCGTGGGGGTGTAGGT-3' c-myb 5'-GGAAAGTGGAGCAAGAAGGTTA-3' 5'-TCGCTGTAGTGTCTCTGGATAG-3' mpx 5'-TGATGTTTGGTTAGGAGGTG-3' 5'-GAGCTGTTTTCTGTTTGGTG-3'
2.10 Acridine Staining
Acridine orange (AO) staining is a nucleic acid selective metachromatic stain technique that can identify cell death. For AO staining, embryos at 48 hpf were incubated for 30 min in fish water containing acridine orange at 10 mg/l. Embryos were then rinsed three times in fish water, anesthetized with tricaine, and quickly imaged by epifluorescent microscopy.
2.11 Blood Extraction
I followed two different protocols to collect blood from adult fish. As per the first protocol, I used a glass needle to obtain a little amount of blood (2-5 ul) without sacrificying the animal. Anesthetized zebrafish were transfered to a petri dish, blood was collected by inserting the needle in the caudal vein, and the blood was let flow through the needle via capillarity. Then all the blood was transfered to a microscope slide, a blood smear was made, and the slide was stained with haematoxylin and eosin.
Figure 4. Schematic representation of the blood collection procedure by means of glass needles. Dorsal aorta (DA), posterior cardinal vein (PCV), and spinal cord (S) are indicated (Zang et al. 2015).
In adopting the second protocol (Babaei et al. 2013), based on the use of low centrifugal force to collect blood from a wound, animals were sacrificed, but a major amount of blood was collected (10µl).
Zebrafish were anesthetized and amputated. Each fish was placed, wound pointing down, into a homemade 0.5 mL microcentrifuged tube that had been previously perforated. Then, the tubecontaining the amputated fish was placed into a 1.5 mL microcentrifuge tube that contained 10 µL of heparin (500 I.U.). Subsequently, the assembly was put into a benchtop centrifuge and centrifuged at 40 g for 5 min at 11 °C.
Figure 5. Schematic representation of the blood collection procedure through tail amputation and centrifuge of the animal (Babaei et al. 2013).
The final volume of blood plus heparin was sufficient for several experiments.
A little amount (5 µl) was used for a blood smear, the remaining was diluted in PBS (100 µl) and fixing solution (100 µl) for cytometry analyses.
2.12 Histological Analysis
Adult fish 8 mpf old were fixed for 24 h in Bouin’s solution at room temperature. The samples were dehydrated through a graded series of ethanol and embedded in Paraplast plus (Leica). The samples were serially cut into 7/8 µm sections on a LKB microtome. After rehydration, the sections were stained with haematoxylin and eosin and mounted with Eukitt (BioOptica) for microscopic examination.
2.13 Cytometry
The blood collected after the centrifuge was resuspended with 100 µl of PBS and 100 µl of cell fixative, and kept in ice. At the analysis laboratory of the ASST Spedali Civili in Brescia, 200 µl of PBS were added to the sample, which was then analyzed.
2.14 CRISPR-mediated Genome Editing
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9-mediated genome editing was used to generate bcr/abl1 translocated zebrafish lines. The sgRNA
sequence (shown in Table 2) was designed using the CHOP-CHOP software tool and produced following the protocol by Gagnon (Gagnon et al, 2014). A mix of bcr and abl1 sgRNA together with CAS9 protein (Integrated DNA Technologies) was microinjected in embryos (4nl). Embryos at 5 dpf were collected one by one to test the efficiency of the two sgRNA. DNA was extracted and amplified using specific primers for both bcr and abl1 genes (Table 2); amplified DNA was analyzed to verify whether the fish carried mutation or not. HMA analysis was used for the detection of genomic alterations. Mutations were confirmed through Sanger’s method. After this crucial step, a second microinjection was performed and the embryos were allowed to grow until the third month post fertilization. Tail fin was excised from each fish, the RNA was extracted, and the cDNA was analyzed by means of digital PCR (dPCR). Injection mix: 2 µl Phenol Red 600 ng abl1 sgRNA 600 ng bcr sgRNA 80 ng Cas9 protein
H2O to a final volume of 10 µl
2.15 Syntetic Gene, Primers, and Probe Design
The digital PCR primers and probe for the screening were designed on the cDNA sequence of the supposed fusion gene. This gene contains exon 14 of bcr fused with exon 2 of abl1.
A syntetic gene of 300 bp, produced by Twist Bioscience, was used as a positive control. This gene differs from the hypothetic fusion gene in that it has a modified base (an A instead of a T) leading to the formation of a site recognized and cut by EcoRI enzyme.
AAGGAAGTGATCCGAGAACAGCAGAAGAAATGCTTTAAGACCTTCAACTTGTCATCCATGGAGCTT CAGATGCTCACCAACTCTTGTGTCAAACTCCAGACGGTCCATCAGTTGCCTCTCACTGTCAATAAAG AGGAGTCTCGGCCGGAATTCGATCCCCCCGGTCTTTCAGAAGCGGCGCGCTGGAACTCTAAAGAG AACCTGCTGTCGGGACCCAGCGAAAATGACCCCAATCTGTTCGTGGCGCTGTACGACTTTGTGGCG AGCGGCGACAACACTCTCAGCATAACTAAAGGAGAG
EXON 14 bcr EXON 2 and 3 abl1
Fw TCCATCAGTTGCCTCTCAC (57 °C) Rev ACAGCGCCACGAACAGATTG (58 °C)
Probe TTCAGAAGCGGCGCGCT (63 °C) EcoRI (Modified base)
Polymorphisms
2.16 Digital PCR for Screening
The dPCR analysis was performed as previously described. A mix of 16 µl containing 8 µl of 2X QuantStudio 3D Digital PCR Master Mix (Thermofisher Scientific), 0.8 µl of 20X TaqMan-MGB-FAM-probe assay, 6 µl of cDNA, and 1.2 µl of nuclease-free water (Qiagen) was prepared. For each sample, 15 µl of the reaction mixes were loaded onto a QuantStudio 3D Digital PCR 20K Chip (Thermofisher Scientific) using the automatic chip loader and the signal was amplified using the following thermocycling profile: 95 °C for 8 minutes, 45 cycles at 95 °C for 15 seconds, and 56 °C for 1 minute, with a final extension step at 56 °C for 2 minutes. The amplification was followed by the chips imaging, and the secondary analysis was performed with the QuantStudio 3D AnalysisSuite Cloud Software.
2.18 Cell Preparation and Injection
The acute leukemia HL-60 cell line was used for all the experiments. Before injection, the cells were labeled in vitro using the Cell Tracker™ Red CMTPX Dye (Thermo Fisher Scientific). The CellTracker™ Red CMTPX fluorescent dye is designed to pass freely through the cell membranes into the cells, where it is transformed into cell-impermeant reaction products. CellTracker™ Red CMTPX dye is retained in living cells through several generations. The dye is transferred to daughter cells but not to adjacent cells in a population. CellTracker™ Red CMTPX dye is designed to display fluorescence for at least 72 hours, and the dye exhibits ideal tracking properties: it is stable, nontoxic at working concentrations, well retained in cells, and brightly fluorescent at physiological pH. Additionally, the excitation and emission spectra of CellTracker™ Red CMTPX dye are well separated from GFP (green fluorescent protein) spectra, allowing for multiplexing. We used the dye at a final concentration of 2.5 µM.
The following is the protocol for the preparation of the cells:
• Harvest cells by centrifugation and aspirate the supernatant.
• Resuspend the cells gently in pre-warmed CellTracker™ Working Solution.
• Incubate for 15-45 minutes under growth conditions appropriate for the particular cell type. Centrifuge the cells and remove the CellTracker™ Working Solution.
• Wash the cells with sterile PBS.
About 200 cells in a volume of 4 nl were injected in each embryo. The transgenic lines Tg(kdrl:EGFP) was used for all the experiments.
2.19 Ki67 Immunofluorescence
6-7 dpf embryos were fixed overnight in 4% paraformaldehyde (PFA) at 4 °C, dehydrated through an ascending methanol series, and stored at −20 °C.
The first day the embryos were rehydrated in PBT and permealyzed for 1h in proteinase K, then the embryos were fixed for 20 min-1h in PFA 4% and washed several times in PBT in agitation. After the washes, the embryos were incubated first with blocking buffer for 2-3 h in agitation, then with the Ki67 primary Ab 1:200 in blocking buffer overnight at 4 °C.
The second day, the embryos were washed three times in PBT for 1h and three times in blocking buffer for 1h. The embryos were then incubated with the secondary Ab 1:400 in blocking buffer overnight at 4 °C.
The third day the embryos were washed several times in PBT (5-6 times for 1h) and then observed under the microscope.
2.20 Imaging
The WISH imaging and in vivo imaging of transgenic and control embryos (anaesthetized with 0.04% tricaine, embedded in 0.8% low melting agarose, and mounted on a depression slide) were captured using a Zeiss Axio Zoom V16 equipped with a Zeiss Axiocam 506 colour digital camera and processed using Zeiss Zen Pro software.
2.21 Statistical analysis
Data were analyzed using Graph Pad Prism software V6. The comparison of different groups of samples was performed using Student’s t-test with a confidence interval of 95%. The P-value is indicated with asterisks: *P<0.05%, **P <0.01%, ***P<0.001%, and ****P<0.0001%. Differences were considered significant at P-values of less than 0.05.
Table 2:
Oligo Name
Sequence (5'→3')
Purpose
Forward1 BA cDNA AGACTGTCCACAGCATTCCG tg screening Reverse1 BA cDNA GCAACGAAAAGGTTGGGGTC tg screening Forward2 BA cDNA GATGCTGACCAACTCGTGTG tg screening Reverse2 BA cDNA GACCCGGAGCTTTTCACCTT tg screening
sgRNA bcr ATTTAGGTGACACTATACTTTAT ATAAAAACACAGCGGTTTTAGA
GCTAGAAATAGCAAG
gene editing
sgRNA abl1 ATTTAGGTGACACTATAGAACA TTTAGGATCAGGGGGGTTTTAGA
GCTAGAAATAGCAAG
gene editing
bcr Forward CTAAGCCGAAAAGAACACGAAT Translocated DNA screening bcr Reverse CACATGACCTTTTTCTTGTGTTG Translocated DNA screening abl1 Forward CACCACATTCACTCATCACTCA Translocated DNA screening abl1 Reverse GCACCATTAAAAGTGCATTCAG Translocated DNA screening Forward1 bcrT TGTCAAACTCCAGACGGTCC Translocated cDNA screening Forward2 bcrT CCATCAGTTGCCTCTCACTGT Translocated cDNA screening Reverse1 abl1 CAGCTGGAGGACGAGGAAAGA Translocated cDNA screening Reverse2 abl1 CCACGAACAGATTGGGGTCA Translocated cDNA screening dPCR Forward TCCATCAGTTGCCTCTCAC Digital pcr
dPCR Reverse ACAGCGCCACGAACAGATTG Digital pcr dPCR Probe TTCAGAAGCGGCGCGCT Digital pcr
3. Results
3.1 Identification and Characterization of Zebrafish bcr and abl1 Genes
The Gene and HomoloGene databases at NCBI indicate a single zebrafish ortholog of the human BCR and ABL1 genes. Danio rerio bcr (Gene ID: 568320) is also present in the ZFIN database with the following ID: ZDB-GENE-040724-43. It is located on chromosome 21 and has 23 exons like its human counterpart. Danio rerio abl1 (Gene ID: 100000720) is also present in the ZFIN database with the following ID: ZDB-GENE-10812-9. It is located on chromosome 5 and has 12 exons like its human counterpart. The analysis of the genomic region surrounding bcr and abl1 was carried out using the synteny database, which indicated a low level of conserved synteny between the regions surrounding human BCR and ABL1 genes and those surrounding Danio rerio bcr and abl1 genes (Figure 6). Protein sequence comparisons revealed that zebrafish Bcr and Abl1 proteins share around 78% and 73% identities, respectively, with their human counterparts (Figure 7).
Figure 6. Analysis of gene synteny around the BCR and the ABL1 loci between H.sapiens (Chr.22/Chr.9), M.musculus (Chr.10/Chr.2), and D.rerio (Chr.21/Chr.5) generated using the Genomicus software.
Figure 7. Multiple sequences alignment of human BCR (left) and ABL1 (right) proteins with their counterpart in zebrafish obtained using the ClustalW2 software.
The kinase domain on Abl1 is highly conserved (97%) and all the amino acids that are involved in bonds with TKIs are preserved. Due to this high level of conservation, it is quite likely that the human protein can work in zebrafish and this animal model can be used for drugs screening.
Figure 8. Multiple sequences alignment of tyrosine kinase domain of ABL1 protein of human and zebrafish obtained using the ClustalW2 software. The amino acids involved in bonds with tyrosine kinase inhibitors are highlighted in yellow (TKIs).
3.2 Generation of BCR/ABL1 Transgenic Line
To investigate the oncogenic properties of p210 protein, the human fusion oncogene was injected as cDNA in zebrafish embryos at one-cell stage, under control of the UAS promoter. The construct was designed to integrate the complete coding sequence into the host genome using the Tol2 transposition system, thus permitting the generation of transgenic fish. The F0 founders with the highest germ line transmission rate were identified on the basis of caudal fin genotype (Figure 9) and sequencing. A stable F1 generation was obtained by intercrossing the founder fish with wild type fish (AB line).After three months, the F1 fish positive at the PCR screening were mated with hsp70: GAL4 fish for all the experiments. 50 F1 fish were screened and about 20 fish eterozygote for the transgene were identified.
Figure 9. Electrophoretic agarose gel of the PCR products on DNA extracted from tail of fish subjected to screening. Fish numbers 3 and 4 are clearly PCR positive.
3.3 Expression Confirmation through Direct Visualization of CFP
After the activation of the transgenic promoter hsp70, the fluorescence first appears 3 hours after the activation by heat-shock and increases until reaching a maximum of fluorescence at 12 hours post activation. I observed the presence of clear positive signals using a confocal microscope. The CFP signal was present in most of the tissues, including the spinal cord, lens, notochord, brain, heart, muscles, and skin. The CFP expression was strongest in lens and central nervous system.
Figure 10. Confocal images of the head of a 24 hpf transgenic animal which expresses the cyan fluorescente protein (CFP).
Figure 11. Images of the tail of a 24 hpf transgenic embryo which expresses the cyan fluorescente protein (CFP).
3.4 Expression Confirmation through Digital PCR with Human Primers
To verify further if my transgenic fish expressed the human mRNA, I used the same Digital PCR for the routinary screening of patient samples on cDNA extracted from pool of wild type and transgenic samples. As I expected, the software was able to detect positive signals (represented by blue dots in Figure 12) only in transgenic samples.
Figure 12. Digital PCR quantification of human BCR-ABL1 transcript in wild type (WT) and transgenic (TG) samples. The reported snapshots display the graphical results of fluorescence emission obtained with the AnalysiSuite Cloud Software. Yellow dots correspond to negative micro-reactions. Blue dots correspond to positive micro-reactions.
3.5 Rapid Accumulation of Hematopoietic Cells
Transgenic embryos activated at 20 somites developmental stage were observed till 96 hpf and found to be normal, with the development of various organs apparently similar to that of wild type embryos. A more precise observation of embryos at 24 hpf using bright light permitted the identification of regions of blood vessels with the presence of retention of hematopoietic cells. This alteration of blood flow appeared to be a transient modification. In fact, in the later stages the blood cells circulation in transgenic embryos was similar to that in wild type embryos.
Figure 13. Blood cells circulation in embryos after heat-shock. At 24 hpf there are differences between wild type (normal flow) and transgenic (stasis of the flow). The experiments were performed in triplicate and the numbers are representative of one experiment.
3.6 Molecular Characterization of Transgenic Line
To study whether human p210 protein interferes with zebrafish hematopoiesis, I analyzed some genes involved in the process. To this purpose, I observed the expression pattern of
myeloid-specific peroxidase (mpx) and lymphocytes cytosolic protein (L-plastin), two genes
involved in leukemiogenesis.
L-plastin is a leucocyte-specific protein that cross-links actin filaments into tight bundles.
Whole mount in situ hybridization on 28 hpf embryos for these genes revealed an upregulation in transgenic embryos, with the presence of a higher number of violet dots, which correspond to leukocytes.
Figure 14. WISH on 28 hpf embryos for mpx. The regions with an accumulation of violet dots, corresponding to leucocytes, have been highlighted. The experiments were performed in duplicate and the numbers are representative of one experiment. In each panel, red ovals indicate the positive signals of mpx in peripheral blood island and in the anterior part of the embryos. On the left is the statistical analysis of mpx signals counted in peripheral blood islands. Statistical analysis was performed via unpaired, two-tailed T Test **** P< 0.0001.
Figure 15. WISH on 28 hpf embryos for plastin. The regions with an accumulation of violet dots corresponding to leucocytes have been highlighted. The experiments were performed in duplicate and the numbers are representative of one experiment. In each panel, red ovals indicate the positive signals of plastin in peripheral blood island and in the anterior part of the embryos. On the left is the statistical analysis of plastin signals counted in peripheral blood islands. Statistical analysis was performed via unpaired, two-tailed T Test **** P< 0.0001.
I investeged other genes involved in the hematopoietic process at different levels. I was interested not only in genes involved in the differentiation of white blood cells, but also in genes more specific of the red cells. T-cell acute lymphocytic leukemia 1 (Tal1/Scl) and v-myb
avian myeloblastosis viral oncogene homolog (c-myb) are genes expressed at hematopoietc
stem cell level. Scl is required in primitive hematopoiesis, c-myb is predominantly present in immature hematopoietic cells and decreases during cell differentiations.
Pu.1 (spi1) and gata1 genes are more specif for differentiated cells. Pu.1 is a master regulator
of myeloid cell development, gata1 is a master regulator in erythrocyte development.
Figure 16. WISH on 24 hpf embryos for scl and pu.1 genes. Transgenic embryos (TG) present a stronger staining in CHT region compared to wild type (WT).
The analysis of embryos stained with scl and pu.1 showed a clear difference between wild type and transgenic embryos. In transgenic embryos these two genes were overexpressed in the CHT region.
Figure 17. WISH on 24 hpf embryos for gata1 and c-myb genes. Transgenic embryos (TG) present less staining in the tail, in the CHT region the reduction of staining is less pronounced if compared with wild type embryos (WT).
A reduced expression of gata1 and c-myb genes was observed in the blood vessels. In the CHT region, the difference in expression was less pronounced.
All the genes analysed with WISH were analyzed also by means of Real-time PCR. LIM only
protein 2 (lmo2) gene was analyzed only with Real-time PCR. lmo2 is expressed in
hematopoietic progenitors and acts in parallel with scl as an important hematopoietic regulator.
Figure 18. RT-PCR for transcript quantification of six known genes involved in the hematopoiesis process. Gene expression was normalized using α elongation factor1 as a reference gene and expressed as relative quantification (RQ).Statistical analysis was performed via unpaired T-test ** P<0.01. Wild type (WT) samples are represented in blue, transgenic (TG) samples are represented in red.
Except for c-myb, all the genes analyzed showed a higher expression in transgenic embryos. The increase of expression of pu.1 varied considerably between different transgenic samples; in one sample, the level of expression was nine times that of the wild type samples (Figure 18).
3.7 Activation of Proliferative Pathways
Zebrafish were stained with an antibody recognizing the phosphorylated form of histone H3 (PH3), a marker for mitotic nuclei. The immunofluorescence with antibody against this proliferation marker highlighted in transgenic embryos a strong positive signal in the CHT region, suggesting the presence of an abnormal proliferation of hematopoietic cells. To understand this result better, I performed immunofluorescence on embryos previously subjected to WISH for scl gene (figure 19). I observed a co-localization of the positive signals only in the CHT region. The immunofluorescence also revealed positive labeling in the cardinal vein.
Figure 19. Embryos subjected first to WISH for scl gene and later to PH3 immunofluorescence. The red boxes highlight the region in the embryos presenting the main differences in immunofluorescence. In the WISH images, the difference is less evident and limited to the CHT region.
3.8 Absence of Abnormal Apoptosis
Given the clear evidence of a proliferation increase, I searched for a possible alteration of the apoptosis. I analyzed both 24 hpf and 48 hpf embryonic stages. Comparing wild type and transgenic fish, I found no evidence of an abnormal apoptotic process. This means that the increased proliferation analyzed at 24 hpf was not balanced by apoptosis. Because the fusion
protein BCR-ABL1 is a constitutively active tyrosine kinase that constantly activates various signaling pathways regulating cell proliferation, the observed results represent a first evidence of the potentiality of my transgenic model.
Figure 20. Acridine orange staining with no clear differences between wild type (WT) and transgenic (TG) embryos at 48 hpf. The experiments were performed in triplicate and the numbers are representative of one experiment.
3.9 Histological Alterations as Long-term Drawbacks
To study the tissue phenotype of the major hematopoietic organs in adult zebrafish, I performed histological analyses of 15-month-old transgenic and wild type fish. For this experiment, 5 wild type and 5 transgenic fish were sacrificed. The direct observation of histological slices of the kidney, the base of the hematopoiesis in adult fish, highlighted a macroscopic alteration of this organ in the transgenic fish, characterized by the presence of white regions. The hematopoietic tissue as well the collecting ducts appeared well-defined in the wild type fish. On the contrary, in the transgenic animals I observed few big and undefined cells, mirroring aggregates of blasts, and a massive infiltration of blasts or immature cells close to the collecting ducts (Figure 21). Probably these abnormalities were caused by inflammatory processes or the iperproliferation of immature cells.
Figure 21. Heamatoxylin-eosin staining of the kidney of wild type (WT) and transgenic (TG) fish. Differences in the histological and morphological structures are indicated.
In zebrafish, the spleen filters the blood removing defective blood cells; the organ contains mainly erithrocytes and thrombocytes (red pulp). The ellipsoids contain macrophages and reticular cells. In transgenic animals, abnormalities and disorganization in ellipsoid structures were observed. Similarly to what had been observed in the kidney, a major alteration consisting of the presence of white regions was identified in the spleen (Figure 22). The presence in hematopoietic organs of a region with hyperproliferation of immature cells and inflammatory phenomena suggests possible defects during the hematopoiesis of transgenic fish that resemble human CML.
Figure 22. Heamatoxylin-eosin staining of the spleen of wild type (WT) and transgenic (TG) fish.Differences in the histological and morphological structures are indicated.
The direct observation of blood smears from wild type and transgenic fish permitted the secure identification of all blood cell types (Figure 23). Erythrocytes were predominant and easily recognized by virtue of their eosinophilic and ellipsoidal nuclei. Small lymphocytes and thrombocytes had a similar appearance by light microscopy, but lymphocytes appeared slightly larger than thrombocytes; cytoplasm was also much more evident in lymphocytes. Cytoplasmic granules were prominent in granulocytes, and nuclear chromatin was dispersed throughout the nucleus. Eosinophil-like cells presented specific granules with a rod- or disc-shaped crystalline structure (Davidson et al. 2004). Through the manual count of different fields of the blood smears of a large numer of animals (15 wild type and 15 transgenic fish), huge differences were identified. As summarized in Figure 24, transgenic fish presented a higher white blood cell count and an increased presence of blast cells. This peripheral blood count resembles the condition of patients in the chronic phase of the disease.
Figure 23. May-Grunwald-Giemsa staining of peripheral blood smear from a transgenic fish with the identification of all blood types.
Figure 24. Identification and manual count of different blood cell types, based on their morphology. Statistical analysis was performed through unpaired, two-tailed T Test **** P< 0.0001. Wild type (WT) samples are represented in blue, transgenic (TG) samples are represented in red.
3.10 Alterations in Blood Cell Populations
To understand better the changes in hematopoietic cell populations, peripheral blood extracted from 8 fish (5 wild type and 3 transgenic) was subjected to cytometry analysis.
Based on forward and side scattering, the different populations were separated and identified manually. A significant difference between transgenic and wild type samples was detected. In particular, two of the three transgenic samples analyzed looked very different from the wild type animals: the population colored in blue in the wild type was completely absent in the transgenic fish and even the cloud-like profile in grey was missing (Figure 25). In future it will be interesting to sort the different populations identified through the cytometer in order to understand more fully these results.
Figure 25. Cytometry separation of blood cells populations based on forward (FSC) and side (SSC) scattering.
3.11 Generation of Translocated Fish
The CRISPR/CAS9 system was used to generate genome enginnered zebrafish with bcr/abl1 translocation. Using the CHOP-CHOP online tool, two single guide RNA were designed to
target the intron between exons 13 and 14 of bcr gene and the intron between exons 1 and 2 of
abl1 gene, thus mimicking one of the rearrangements that leads to CML in human.
Compared to the mortality rate of non-injected embryos at 24h (33%), an acceptable mortality rate of 56% was observed in injected embryos. Embryos at 5 dpf were collected one by one to test the efficiency of the two sgRNA. DNA was extracted and amplified using specific primers for both bcr and abl1 genes; amplified DNA was analyzed to verify whether the fish carried mutations or not. HMA analysis was used for the detection of genomic alterations. Mutations were confirmed with Sanger’s method. Out of 62 embryos analyzed and injected with sgRNA mix, an efficiency of mutations of 11% for bcr and of 14% for abl1 was observed.
Figure 27. Analysis of the sequence of a wild type (WT) and a candidate mutated fish (MUT) for the bcr gene, around the sites recognized by the specific sgRNA. The PAM is highlighted in red. Polymorphisms or mutations are highlighted in blue.
Figure 28. Analysis of the sequence of a wild type (WT) and a candidate mutated fish (MUT) for the abl1 gene, around the sites recognized by the specific sgRNA. The PAM is highlighted in red. Polymorphisms or mutations are highlighted in blue.
After this crucial step, a second microinjection was performed and the embryos were allowed to grow till the third month post fertilization.
3.12 Screening on cDNA
Screening of adult fish was performed after caudal fin biopses. I expected these fish to be a mosaic, so I opted for a more sensitive technique to search for evidence of the presence of cells carrying the genetic rearrangement I was interested in. To avoid repeated sequences of the intronic regions, I decided to work only on cDNA. The tail fin was excised from each fish, the RNA was extracted, and the cDNA was analyzed through digital PCR (dPCR). dPCR is a technology based on the partitioning of the sample, in quantities on the scale of nanoliters or even picoliters, through the creation of reaction chambers within specially designed chips. Therefore, the sample is randomly distributed into discrete partitions, in such a way as some contain no nucleic acid template and others contain one or more template copies. In the chambers where the microreactions have a positive outcome, an emission of fluorescent signals occurs, which are recognized by the software and represented as blue dots.
Figure 29. Digital PCR results for the two F0 fish resulted positive. The images display the graphical results of fluorescence emission obtained with AnalysiSuite Cloud Software. Yellow dots correspond to negative micro-reactions. Blue dots correspond to positive micro-micro-reactions.
Two positive F0 fish were identified. They were crossed with wild type fish and the offspring was analyzed during adulthood. A total number of 60 F1 fish was screened and 4 heterozygote fish were identified. Since all the F1 fish identified were females, I crossed two of them with wild type fish and, after three months, I started screening the offsprings. Thus far, I have screened 8 fish of the first mating, finding 2 positive fish, and 4 fish of the second matings, finding 2 positive fish.
3.13 Electrophoresis of PCR Mixtures
The digital PCR has many advantages, but has the disadvantage that it is impossible to recover the samples after the amplification. To obtain a clear sequence of the genetic rearrangement, I used the same primers used for the digital PCR for a nomal PCR. In order to
obtain enough target samples amplification, I performed a first PCR of 39 cycles of 100 ng of cDNA from the tail of F1 positive fish. I then performed another PCR with the same primers starting from 1µl of the previous PCR. I used the 300 bp synthetic gene designed on the hypotetic fusion of exon 14 of bcr and exon 2 of abl1 as a positive control for the PCR. As expected, the PCR on the synthetic gene resulted in an amplification product of 147 bp. As shown in Figure 30, the electrophoresis on agarose gel of the products of the PCR performed on the cDNA of fish resulted positive after the screening with digital PCR highlighted bands on the same height as that of the positive control.
Figure 30. Electrophoretic agarose gel of the products of PCR on cDNA. Number 3 is the product of the PCR on the syntetic gene. Numbers 5 and 6 are the products of the PCR on cDNA of F1 fish resulted positive at the digital PCR. Numbers 2 and 4 are the products of the PCR on cDNA of two wild type fish. Numbers 1 is the blank.
3.14 Digestion as Internal Control
The synthetic gene of 300 bp used as a positive control differs from the hypothetical fusion gene for a modified base (an A instead of a T) that brings to the formation of a site recognized and cut by the EcoRI enzyme. I exploited this characteristic to highlight any possible contamination of the samples with the positive control. As shown in Figure 31, the observation of the electrophoretic agarose gel makes it easy to distinguish between the digestion result of the product of the PCR on the synthetic gene and the digestion results of the products of the PCR on fish samples. The product of the PCR on my positive control is fully digested, while the products of the PCR on fish samples run as undigested.
Figure 31. Electrophoretic agarose gel of the digestion of the PCR product. Numbers 3 and 4 are the digestion of the PCR on cDNA of F1 fish. The PCR on control sample (number 2) appears digested. Number 1 is the undigested.
3.15 Results of Sequence Analysis
The PCR products about a F1 positive fish and the control synthetic gene were sequenced with the forward primer designed on exon 14 of bcr. Clear sequences were obtained, with the exception of the 5’ trimmer zone for the fish sample.
Figure 32. Analysis of the sequences obtained with the polypeakparser software. The chromatogram above refers to the F1 fish. The chromatogram below refers to the control gene.
I analyzed the sequencing files with the Basic Local Alignment Search Tool (BLAST). The results are shown in Figure 33. For the sequence with forward primer the PCR product about the F1 fish the software recognized a 90% of identity between a significant cover of the sequence (43%) and the sequence of zebrafish genome corrisponding to the abl1 gene. The region of the sequence corresponding to exon 14 of bcr was not recognized because it lies in the trimmer zone. So I performed sequence with reverse primer on the same PCR product. The software recognized a 91% of identity between a significant cover of the sequence (22%)
and the sequence of zebrafish genome corrisponding to the bcr gene. All together these data suggest that the chromosomal rearrangement has taken place.
Figure 33. Schematic representation of the BLAST with the zebrafish genome of the sequences of PCR product about F1 fish with forward primer (above) and reverse primer (below).
3.16 Histological Analysis of Genome Engineered Animals
I conducted a histological analysis of two 8-month-old fish out of the F1 generation. The analysis highlighted differences in several organs. The staining of the liver in translocated F1 fish looked very different from the staining in wild type fish; probably, the white regions in liver cells of translocated fish were due to a higher presence of fatty acids. Like the mammalian liver, the teleost organ plays an important role in the metabolic homeostasis of the body, such as the processing of lipids. Overall, the macroscopic organization of the liver was conserved (Figure 34).
Figure 34. Heamatoxylin-eosin staining of the liver of wild type (WT) and translocated (T) fish.
By contrast, the organization of the kidney was completely altered. Even at low magnification, the kidney of traslocated fish seemed disorganized, proximal tubes and collecting ducts appeared enlarged, and the hematopoietic tissue was difficult to identify (Figure 35).
