Microbiome and diet: Relevance of Mediterranean Diet adherence on gut microbiome composition and activity in Spanish adult population.

D

IPARTIMENTO DI

F

ARMACIA

Corso di Laurea Magistrale in

Scienze della Nutrizione Umana

TESI DI LAUREA

Microbiome and Diet on Human Health:

Relevance of Mediterranean Diet adherence on gut microbiome

composition and activity in Spanish adult population.

Relatori

:

Dott.ssa M. Carmen Collado Amores

Dott.ssa Izaskun García Mantrana

Dott.ssa Lara Testai

ANNO 2016-2017

Candidata:

1

INDEX

INDEX ……….……pag 1

1.THE MICROBIOME……….…….pag 3

1.1.Definition and taxonomy……...pag 3

1.1.1.Firmicutes phylum………...……...pag 5

1.1.2.Bacteroidetes phylum ……….…….…….…...pag 7

1.1.3.Actinobacteria phylum ………....……….………..…..pag 8

1.1.4.Proteobacteria phylum ………...pag 9

1.1.5.Archaea Dominium…. ………...pag 10

1.2.Functions………...………….…….………....…...pag 11

1.2.1.Microbiota and SCFA production………...pag 13

1.3.Microbiota development ...pag 19

1.4.Influences on adult microbiota: focus on diet...pag 25

1.4.1.Mediterranean Diet versus Western Diet ……...pag 27

1.4.2.Carbohydrates, proteins and fats…………...pag 30

1.4.3.Prebiotics, probiotics and synbiotics……….………...…..…..…...pag 32

1.5.Microbiota and pathologies……….……….pag 37

1.5.1.Focus on microbiota and obesity…………...pag 38

1.6.The advances in microbiome analysis methods……….………….…pag 41

2. MICROBIOME AND DIET ON HUMAN HEALTH: Relevance of Mediterranean Diet adherence on gut microbiome composition and activity in Spanish adult population

…

2

2.2.Materials and methods...pag 46

2.2.1.Participants………...pag 46

2.2.2.Diet records………...………..…………...pag 47

2.2.3.Faecal sample collection………...…..pag 48

2.2.4.Bacterial DNA extraction, purification and quantification………....…………..pag 49

2.2.5.Quantitative Polymerase Chain Reaction (Q-PCR)...pag 50

2.2.6.High Pressure Liquid Chromatography (HPLC)…...pag 52

2.2.7.Statistical data analysis………...……...pag 53

2.3.Results...pag 55

2.3.1.Bacterial quantification by Q-PCR...pag 55

2.3.2.SCFA production by HPLC detection………...………...….pag 59

2.4.Discussion………...pag 66

2.4.1.Limitations………...pag 72

2.5.Conclusions……….…...pag 73

3.ANNEXES……….…….pag 74 4.BIBLIOGRAPHY AND SITOGRAPHY………...pag 75 AKNOWLEDMENTS……….….……...….pag 84

3

1.THE MICROBIOME

1.1.Definition and taxonomy

The human microbiota is the microbial complex ecosystem that populates the entire human organism; it includes bacteria but also other microbes such as fungi, archaea, viruses, and protozoans (Jandhyala et al. 2015).

The microbiome is instead the collective genome of this microbiota containing at least 100 times as many genes as the human genome (Gill et al. 2006).

It has been estimated that 1014 microorganisms reside in various parts of the body such as skin, genitourinary and respiratory tracts as well as along the all gastrointestinal tract so in the mouth, esophagus, stomach and gut. Particularly the bacterial number in the mouth is 1010, on the skin 1012 and in the gut 1014 for a total weight of 1.5 kg (Harris et al. 2012).

Actually, in the colon, is estimated that the concentration is even upper than 1014 microorganisms belonging to Bacteria Dominium, even if Methanogenic Archaea, Eukaryota (yeasts and protists) and virus (phages and animal viruses) too are minority present.

4

The following picture (figure 1.1) shows the distribution in the gastrointestinal tract of the prevalent bacterial genera.

Fig 1.1 Microbiota distribution along the gastrointestinal tract (Jandhyala et al. 2015).

About 75% of the microbiota is represented by three prevalent phyla, that are Firmicutes, Bacteroidetes and Actinobacteria. Especially the intestinal microbiota is made up for more than 60% by Firmicutes and about 15% by Bacteroidetes, followed by Actinobacteria and lastly Proteobacteria (Lopez-Legarrea et al. 2014).

Bacteroides, Bifidobacterium, Eubacterium and Peptostreptococcus are the four

5

1010 to 1011 CFU/g, while Streptococcus, Lactobacillus and, even less,

Enterococcus, Clostridium and Bacillus represent the subdominant flora with a

concentration of 106 to 108 CFU/g. Overall the main bacterial species hosted by every individual are 1000-1150 (Collado et al. 2012; Ott et al. 2004).

In the following paragraphs, among the major Bacteria phyla, Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria, some of the most investigated genera and species, due to their relationship with health and nutrition status of individuals, will be taxonomy classified respecting the traditional biological nomenclature that is phylum-class-order-family-genus-species. Also the Archaea Dominium will be briefly described.

1.1.1.Firmicutes phylum

Firmicutes phylum, also known as clostridial Firmicutes, Firmacutes or Bacillaeota, is a Bacteria phylum of Gram-positive heat-resistant spore forming bacteria with a low G-C in their DNA even if there are some species that don’t form spores or having a content of G-C above 60% that it is peculiar for Actinobacteria phylum.

The four representative Firmicutes classes are Bacilli, Clostridia, Erysipelotrichia and Negativicutes (Galperin et al. 2013).

6



Bacilli class

Bacilli, also known as Firmibacteria or Bacillus/Lactobacillus/Streptococcus group, is a Firmicutes phylum-class of Gram-positive bacteria that have the ability to form spores. They can grow in anaerobic conditions as well as aerobically and some of these are facultative anaerobes.

The main Bacilli genera are Bacillus, Enterococcus, Lactobacillus, Listeria,

Staphylococcus and Streptococcus.

In particular, Lactobacillus spp. are Gram-positive, no-spore forming bacteria genus that includes 16 species, the most part of which are considered beneficial in favour of the human microbiota health even if six species, that are L. rhamnosus,

L. gasseri, L. paracasei, L. casei, L. johnsonii and L. delbrueckii, have recognized

to get involved in gastrointestinal tract infections (Martinez et al. 2014).



Clostridia class

Clostridia is a Firmicutes phylum-class of mostly Gram-positive, strict anaerobic and spore-forming bacteria, normally findable in the soil as well as in the human and animal gastrointestinal tract.

The exotoxins produced by Clostridia are responsible for a lot of pathological conditions, in particular Clostridium group includes some common known pathogenic species as C. botulinum, C. difficile, C. perfrigens and C. tetani.

7

Clostridia class also includes Ruminococcus genus that will be mentioned talking about enterotypes.

1.1.2.Bacteroidetes phylum

Bacteroidetes phylum, also known as Cytophaga-Flexibacter-Bacteroides phylum, is a vast and diversified phylum including Gram-negative no-spore forming, aerobic or anaerobic, bacteria.

The three most commonly Bacteroidetes genera, found in gut microbiome, are

Prevotella, Bacteroides and Porphyromonas genus.

A prevalence of Prevotella or Bacteroides genus in the human gut microbiota defines two different enterotypes (it will be better explained in the chapter 1.4). These genera are more studied in respect of the other one due to their link with diet and even to the possibility to affect food metabolism; in fact the first genus is usually linked with plant-enriched diets while the second one with a high-fat and animal protein diet.



Prevotella genus

Prevotella genus, also known as Xylanibacter, is a genus of Gram-negative

8

are P. albensis, P. bivia, P. brevis, P. bryantii, P. intermedia, P. melaninogenica and P. nigrescens.



Bacteroides genus

Bacteroides genus, also known as Ristella or Capsularis, is a genus of

Gram-negative, anaerobic, bile-resistant and no spore-forming bacteria belonging to Bacteroidetes phylum and including a lot of species that represent about 25% among the all anaerobic species in the gut.

The principal Bacteroides genus -species are caccae, thetaiotaomicron, coprocola,

vulgatus, coprosuis, plebeius, eggerthii, uniformis, finegoldii, salyersai, fragilis, pyogenes, helcogenes, finegoldii, intestinalis, goldsteinii, massiliensis, dorei, nordii, johnsonii and ovatus while the Paracteroides species are P. distasonis and P. merdae.

1.1.3.Actinobacteria phylum

Actinobacteria phylum, also known as High GC Gram-positive bacteria or Actinomycetes, is one of the largest phyla among Bacteria and represent Gram-positive bacteria with a high G + C content in their DNA (Ventura M. et al. 2007).

9

gastrointestinal commensals such as Bifidobacterium spp.



Bifidobacterium genus

Bifidobacterium genus, also known as Tissieria or Bifidabacterium, is a genus of

Gram-positive, anaerobic, no-motile and no-spore forming saccharoclastic bacteria, belonging to Actinobacteria phylum.

Some common species of this genus are actinocoloniiforme, globosum, adolescentis, indicum, animalis, infantis, bifidum, kashiwanohense, breve, longum, catenulatim, pseudocatenulatum, coryneforme, pseudolongum, dentium,

or eriksonii, scardovii.

Bifidobacterium species, especially the B. bifidum and B. breve, are known to be

host health-promoters, this is the reason why are often added in probiotic products as active components.

1.1.4.Proteobacteria phylum

Proteobacteria phylum, also known as Alphaproteobacteraeota, is a phylum of Gram-negative, facultatively or obligately anaerobic bacteria that move using flagella but some of them can be non-motile too.

10

This phylum includes several pathogen-genera such as Escherichia and

Salmonella, both belonging to the Enterobacteriaceae family, Vibrio and Helicobacter.

In particular Escherichia coli is one of most represented bacteria in the gastrointestinal tract among the Enterobacteriaceae-family species.

1.1.5.Archaea Dominium

Other microorganisms that make up the human microbiota don’t belong to the Bacteria Dominium but to the Archaea Dominium, also known as Metabacteria or Archaeabacteria.

The major representative of this Dominium is Methanobrevibacter smithii, belonging to the Euryarchaeota phylum (Million et al. 2005).

11

1.2.Functions

The human microbiota is nowadays more and more studied because of its profound impact on human health by playing a role in metabolic, nutritional, physiological and immunological processes in the human body (Gerritsen et al. 2011).

The activities of this Microbiota are several and can be resumed and divided in metabolic, protective, structural and histological functions as schematically shown in figure 1.2.

12

The metabolic function exercised on the host by microbiota includes more activities among which

 Fermentation of undigested food residues and some sugars;

 Synthesis of vitamins (belonging to B group and K vitamin) and amino-acids;

 Metabolism of primary bile acids;

 Absorption of salts, water and ions such as Calcium, Magnesium and Iron;

 Production of substances with antibiotic function as bacteriocin, lactacin, acidolin, ect., especially by Lactobacillus acidophilus.

 Production of short chain fatty acids (SCFAs); due to its important role and link with diet and microbiota composition, this activity will be better described in the next paragraph 1.2.1.

Another microbiota function is the structural and histological one that consists in a trophic activity and more exactly determines

 Stimulation of the epithelial cell growth;

 Regulation of differentiation;

 Development of intestinal villi and crypts;

13

 Thickening of the mucus layer.

Finally, the last function consists in the protection against pathogens and more in general xenobiotics through

 Secretion of antimicrobial substances;

 Formation of a real physical barrier in addition to the mucus layer;

 Competition against pathogens for nutrients and specific receptors;

 Activation of innate and adaptive immunity through the inflammatory cytokine regulation;

 Stimulation of the Immune system bringing to a development of the lymphatic system and to an increase in B and T-cells.

1.2.1.Microbiota and SCFA production

One of the most important function played by the human microbiota is the production of short chain fatty acids, or SCFAs, that are organic acids formed in the large bowel by some intestinal bacteria species that ferment the unabsorbed or undigested food compounds.

14

SCFAs are named short for the number of carbon-atoms in their aliphatic chain that ranges until six atoms; these acids can be also defined as volatile fatty acids or VFAs due to their volatile properties.

SCFAs represent an energy source for the host colonic cells and for the gut microbiota itself, about 10% of the total energy provided with the alimentation, determining distinct physiological effects on the intestinal environment and overall on the host health. Some of these beneficial effects include for example an inhibition against pathogens, an increase of mucin production, a major nutrient-absorption and even a protection against colorectal cancer (Ríos-Covián et al.

2016) but more evidence to explain the mechanisms are needed.

The most abundant short chain fatty acids in the colon (whose structure is shown in the figure 1.3), representing the 90–95% of the total SCFAs, are acetic acid (C2), propionic acid (C3), and butyric acid (C4) in the concentration of 60, 20 and 20 respectively (Besten et al. 2013).

These three main SCFAs play an important role through carrying out many functions in the bowel, and not only, (Rivière et al. 2016) such as

 Providing energy for the epithelial colonic cells (especially the butyrate represents the major source);

 Lowering the colonic pH with consequent decrease in bile salt solubility and ammonia absorption, increase in mineral absorption and inhibition in the growth of pathogens;

 Anti-inflammatory effects.

15

 Increases colonic blood flow and oxygen uptake;

 Can be converted in butyrate by cross-feeding species;

 Is a substrate for cholesterol and fatty acid biosynthesis in the liver;

 Represents an energy source for muscle and brain tissues.

Propionate can

 Prevent proliferation and induce apoptosis of colorectal cancer cells;

 Interact with the immune system;

 Promote satiety;

 Lower blood cholesterol levels;

 Decrease liver lipogenesis;

 Improve insulin sensitivity.

Butyrate can

 Induce proliferation of normal colon epithelial cells while it can prevent proliferation and induce apoptosis of colorectal cancer cells;

 Affect gene expression of colonic epithelial cells;

 Protect against colon cancer and colitis;

 Stimulate the formation of mucin, antimicrobial peptides, and tight-junction proteins with a consequent improvement in the gut barrier function;

 Interact with the immune system;

 Stimulate the absorption of water and sodium;

16

 Promote satiety.

The major sources of these mentioned acids are carbohydrates, but there are other SCFAs, known as branched-chain short fatty acids or BSCFAs, produced by proteins and representing about 5% of the total intestinal amount, that are isobutyrate, isovalerate, and 2-methylbutyrate.

Figure 1.3. SCFA Chemical structures

Two other important fatty acids are formic acid (C1), which is the littlest one, and lactic acid, widely produced in the gut by lactic acid bacteria (LAB), Bifidobacteria and Proteobacteria but it isn’t so present in the bowel because some

17

species, such as Eubacterium hallii, can convert it in other SCFAs (Ríos-Coviánet al. 2016).

Among the three main short chain fatty acids, acetate is the most abundant in the gut, 60–75% of the total amount (Louis et al. 2013), and it is also the most produced, about three times as much compared to propionic and butyric acid (Sun

et al. 2017). The major producers of acetic acid belong to Bacteroidetes phylum

(Besten et al. 2013).

Propionic acid can be produced by three routes: the succinate pathway that involves succinate as substrate through the action of Firmicutes, especially belonging to the Negativicutes class, and Bacteroidetes; the acrylate pathway in which a few members of two Firmicutes-families, Veillonellaceae and

Lachnospiracea, can produce propionate from lactate; finally the propanodiol

pathway where deoxy-sugars can be converted by some proteobacteria or members of the Lachnospiraceae family (Ríos-Coviánet al. 2016).

Butyrate can be produced above all by bacteria belonging to the Clostridia class through two different pathways: the butyrate kinase pathway from butyryl-CoA, in which especially Faecalibacterium prausnitzii, Eubacterium rectale and

Roseburia spp. are involved; the acetate CoA-transferase pathway where the

major producer species, belonging to Clostridium genus, are C. acetobutylicum,

C. perfringens, C. tetani, C. botulinum and C. difficile (Louis et al. 2013).

The SCFA-production is influenced by dietary intake and by the changes induced through the diet in the gut microbiota because food compounds are the main substrates used by gut bacteria. It’s known that a diet based on plants, that is rich

18

in indigestible carbohydrates, favour the production of acetate and butyrate while isobutyrate and isovalerate can be obtained from the breakdown of branched amino-acids valine, leucine and isoleucine, amino-acids largely found in animal-based diets (David et al. 2014; Ríos-Coviánet al. 2016).

On the other side, about SCFAs and the general host health, there are studies that have tried to find a correlation between short chain fatty acids and pathologies. For example, regarding obesity, Clarke and colleagues (2012) name a study in which obese participants have been found with a 20% higher amount of SCFAs in respect of lean ones, suggesting that a factor that negatively influences on obesity condition could be this surplus of energy provided from short chain fatty acids. Furthermore Rahat-Rozenbloom and colleagues (2014) suggest that higher production of SCFAs in obese people may be due to differences in colonic microbiota more than differences in intestinal absorption or dietary intakes.

The relation between microbiome, diet and human health is unclear and SCFA production by bacteria could be the link because short chain fatty acids, thanks to their already mentioned metabolic activities, impact on the health of the host.

19

1.3.Microbiota development

Each individual hosts a different microbiota that starts its colonisation at the birth and develops and modulates in species for about three-five years of life after which it becomes more stable; even if it unclearly seems that, already by the introduction of solid foods in the infant diet, the microbiota initiates its adult maturation (Arrieta et al. 2014).

Before delivery time, the baby’s gastrointestinal tract is still sterile so birth represents the crucial moment of contact that allows the passage of faecal, vaginal and skin microorganisms by maternal microbiota to the infant. Even though emerging evidence suggests that the in utero environment is not sterile as once presumed (Chu et al. 2016).

There are some previous key-factors that not only give shape to the newborn’s microbiota, whose colonisation starts with Staphylococcus, Streptococcus,

Escherichia coli and Enterobacteria (Indrio et al. 2017), but they also condition

the childhood and adulthood gut microbial composition impacting the overall health of the body.

First of all the delivery mode influences the baby’s microbiota as well as confirmed by several studies.

For example Dominguez-Bello and colleagues (2010), analysing the bacterial composition of 9 mothers and their babies (four vaginal deliveries and five

20

caesarean sections) at 4 day birth, showed how newborn’s microbiota from vaginal delivery was similar to their own maternal vaginal bacterial composition dominated by Lactobacillus, Prevotella, or Sneathia spp. while newborn’s microbiota from caesarean delivery was more similar to the maternal bacterial skin composition dominated by Staphylococcus, Corynebacterium,

and Propionibacterium spp.

This study also evidenced that, among mothers’ vaginal communities more differences were found, while every maternal vaginal microbiota and the respective newborn’s microbiota were more similar to each other. On the other hand, skin bacterial communities of the caesarean delivery mothers were not more similar to their own babies than to the other ones. So it suggested a vertical bacterial transmission between the mother and her own infant in vaginal deliveries that is, on the opposite side, absent in caesarean sections.

Penders and colleagues (2006) suggested that some of the most relevant determinants on infant’s gut microbial composition at one month of age were the delivery mode, the type of feeding, the hospitalization and the antibiotic usage by the infant. The study showed that the babies born at home through a vaginal delivery and exclusively breastfed hosted the most beneficial gut microbiota with the highest numbers of Bifidobacterium and the lowest of Clostridium difficile and

Escherichia coli. While the antibiotic use by infant reduced both Bifidobacterium

and Bacteroides fragilis.

Regarding to the infant diet, the review of Arrieta and colleagues (2014) reports that breastfed babies have a more uniform microbial population dominated by

21 Bifidobacterium and Lactobacillus genera in contrast with the formula-fed ones,

dominated by Bacteroides, Clostridium, Streptococcus, Enterobacteria, and Veillonella spp.

Moreover this review about antibiotics affirms that an early life usage of these ones, probably inducing a microbial dysbiosis, can render the infant susceptible to several adulthood diseases, such as asthma, obesity, dyslipidemia, ect., and also affirms that there is evidence of the role played by antibiotics in developing childhood intestinal bowel disease (IBD).

In addition to all these factors that directly affect the infant microbiota, there are other remarkable determinants, depending on the mother, having an impact on the baby’s microbiota development: the maternal changes of weight during pregnancy, the body composition and the life style that includes diet and the assumption of pharmacologic agents especially antibiotics (the figure 1.4 summarized some of these named factors and their possible related consequences).

22

Figure 1.4 Maternal factors influencing the infant Microbiota and their possible consequences on child’s health (modification of Mulligan et al. 2017).

The review of Mulligan and colleagues (2017) well resumes few evidence that have found significant correlations between the maternal body weight and diet and the development of the baby’s bacterial community.

Even though the studies are few, it is nowadays known that the gut microbiota of pregnant women is different depending on their body mass composition (BMI) and weight gain during pregnancy. For example, in the study of Collado and colleagues (2010), obese women microbial composition were significantly different from the ones having a normal-bodyweight and also between pregnant women that have gained excessive gestational weight in respect to those

23

experiencing a normal weight-gain. So, at 6 months, faecal Bacteroides and

Staphylocuccus, genera that can predispose children to develop obesity, resulted

higher in babies born by an overweight mother while Akkermansia municiphila,

Staphylocuccus and Clostridium difficile, bacteria involved in intestinal

pro-inflammatory processes, resulted lower in which ones born by a mother of a normal weight, and also a normal weight-gain, during pregnancy.

Regardless of maternal BMI, Chu and colleagues (2016) found that a maternal high-fat diet in pregnancy entailed a significant depletion of Bacteroides in the infants that persisted through 6 weeks of age, while no results were found related to added sugars and fiber.

Also there are some evidences both in mice and other non-human primate models; for example Myles and colleagues (2013) have shown an impaired bacterial community, enriched in Clostridiales, and also worse outcomes in infection, autoimmunity and allergic sensitization, in baby-mice born by rats fed with a Western-Diet; moreover, regardless of maternal weight and BMI, they have found how infants born by mice fed with a high-fat diet during pregnancy and lactation presented a significant intestinal dysbiosis, that completely disappeared passing to a control diet.

So other studies on human models in support of the correlation between the maternal diet and infant microbiota development are needed as well as for understanding how maternal antibiotic assumption can affect the newborn bacterial community.

24

Arboleva and colleagues (2016) found that a maternal perinatal use of antibiotics brought changes in microbial gut composition of preterm infants, in particular the levels of Actinobacteria and Firmicutes phila were lower while Proteobacteria phylum were higher in newborn whose mothers assumed intrapartum antibiotics.

There are even a few studies conducted on mice models. The results obtained by Munyaka and colleagues (2015), that were a decreasing in faecal microbial richness and a change in its composition, supported the hypothesis that antepartum antibiotics modulate the baby-mice intestinal bacterial colonisation and increased susceptibility to develop colonic inflammation. Also Tormo-Badia and colleagues (2014), studying on pregnant non-obese diabetic mice, confirmed that antibiotics lower the bacterial diversity and affect the intestinal microbial composition. Anyway these hypothesis have to be confirmed by human-model studies.

25

1.4.Influences on adult microbiota: focus on diet

A recent work of Arumugam and colleagues (2011) suggests that human adult gastrointestinal microbiota can be classified, regardless of nationality, gender, age or body mass index, into three main clusters, known as enterotypes, each one dominated by a specific genus that belongs to Bacteroidetes and Firmicutes phylum. These groups are respectively enriched in Bacteroides (enterotype 1),

Prevotella (enterotype 2), Ruminococcus (enterotype 3) and the last one results to

be the most common.

In general microbiota distribution and composition are affected by a lot of factors both intrinsic and extrinsic (Simrén et al. 2013).

Intrinsic factors are for example

 Gastro acid secretion;

 Gastrointestinal motility;

 Production of antimicrobial peptides;

 Immunity (production of anti-commensal sIgA);

 Partial oxygen tension.

While extrinsic factors are

26

pro/prebiotics;

 Exposure to antibiotics;

 Usage of drugs like proton-pomp inhibitors (PPI), nonsteroidal anti-inflammatory drugs (NSAID), laxatives and opioids.

All these mentioned elements affect the human microbiota composition during the entire life but, although we are at the beginning of studying and understanding microbiota, we know that, among lifestyle factors, diet plays the major role in determining its composition and functional activity (De Filippis et al. 2015). The dietary intake of proteins, fats, carbohydrates, polyphenols and pre/probiotics alter the gut bacteria leading to biological effects in the host metabolism and immunology that can predispose to develop diseases such as cardiovascular diseases, obesity, type 2 diabetes, metabolic syndrome and autoimmune pathologies (Singh et al. 2017).

Since it’s actually unknown which food constituents specifically promote growth and functionality of the intestinal microorganisms, there are some studies that focus their attention on a comparison between two main dietary patterns, the Mediterranean Diet and the Western Diet, in addition to the specific food-macronutrients (carbohydrates and fiber, fats and proteins).

The bacterial genera and species that can be affected by diet are a lots but the following table (1.1) resumes the most common studied and involved in physiological changes and related diseases.

27

Table 1.1 Common bacterial genera and species affected by diet (Singh et al. 2017).

Bacteria specie Physiological effects Related diseases

Bifidobacterium

spp.

SCFA production; anti-inflammatory and

anti-cancer activities Reduced abundance in obesity Lactobacillus spp. CD4 + T cells activation Attenuation of IBD

Bacteroides spp. Increased abundance in IBD Alistipes spp. Pro-inflammatory TH1 immunity

promotion

Reported in tissue from acute appendicitis and perirectal and brain abscesses

Bilophila spp. Generation of TH17 cells promotion

Observed in colitis, perforated and gangrenous appendicitis, liver and soft tissue abscesses, cholecystitis, empyema, osteomyelitis, and hidradenitis suppurativa

Clostridium spp. SCFA production Several spp. are pathogenic causing tetanus, botulism, gas gangrene, or pseudomembranous colitis

Roseburia spp. SCFA and beneficial phenolic acids

production Reduced abundance in IBD

Eubacterium spp. Reduced abundance in IBD

Enterococcus spp. SCFA production; anti-inflammatory effects

Several spp. are pathogenic causing urinary tract infections, endocarditis or bacteremia

Faecalibacterium

prausnitzii Anti-inflammatory effects Reduced abundance in IBD and obesity Akkermansia

muciniphila TLR activation Reduced abundance in IBD, obesity and psoriatic arthritis Escherichia coli Increased abundance in IBD, gastroenteritis, urinary tract

infections and meningitis Helicobacter pylori Gastritis; ulcers; MALT cancers Streptococcus spp. SCFA production; anti-inflammatory and

anti-cancer activities

Some spp. are pathogenic causing meningitis, pneumonia, and endocarditis

1.4.1.Mediterranean Diet versus Western Diet

The Mediterranean Diet is the diet that characterises the countries overlooking the Mediterranean Sea, especially Greek, Italy, Spain and Morocco. It has been declared an UNESCO Intangible Cultural Heritage of Humanity in 2013 because “it compasses more than just food. It promotes social interaction, since communal meals are the cornerstone of social customs and festive events. It has given rise to

28

a considerable body of knowledge, songs, maxims, tales and legends. The system is rooted in respect for the territory and biodiversity, and ensures the conservation and development of traditional activities and crafts linked to fishing and farming in the Mediterranean communities […]” (UNESCO 2010).

The Mediterranean Diet includes a daily consumption of olive oil, cereals, fresh or dried fruit and vegetables, the use of spices and moderate consumption of fish, dairy and meat, accompanied by infusions and wine in moderation, as shown in the pyramid below (figure 1.5), so it is rich in Mono/polyunsaturated fatty acids (MUFA/PUFA), polyphenol compounds and fiber.

29

The Mediterranean Diet is recognized to be one of the healthiest dietary models whose adherence can reduce the incidence of many diseases such as cancers, metabolic and cardiovascular syndromes, neurodegenerative diseases, type 2 diabetes and allergy (Del Chierico et al. 2014).

At the opposite side, it is located the Western Diet, the modern dietary pattern typical of the Western civilisation, characterized by a high consumption of fats (especially saturated and cholesterol), animal-proteins, refined sugars and salt.

In the past years a lot of studies focused their attention only on the analysis of individual dietary components or specific foods, like olive oil and red wine, but nowadays to study the whole dietary pattern seems to be more reasonable.

Gutiérrez-Díaz and colleagues (2016), according with their purpose, showed a direct association between a higher adherence to a Mediterranean Diet and the concentration of Bacteroidetes-Prevotella genus in contrast to a smaller quantity of Firmicutes phylum. In fact Bacteroidetes phylum and related Prevotella genus resulted more abundant, while Firmicutes phylum were less represented, in subjects leading a Mediterranean Diet-lifestyle.

The review of Lopez-Legarrea and colleagues (2014) suggested that a Mediterranean pattern determines an increase of Prevotella, Enterococcus,

Bifidobacterium, Lactobacillus and Bacteroides bacterial genera, above all thanks

to its content in polyphenols, compared to a reduction in the Clostridium bacterial group.

30

Increasing evidence suggests that people whose diet can be defined as Mediterranean, low in animal fats and proteins but rich in healthy fats, fiber, vegetable proteins and polyphenols, host a more beneficial and functional microbiota that can help to prevent pathological conditions especially obesity. On the other hand, consuming a Westernized diet, rich in saturated fatty acids, refined sugars and low in fiber, is pro-inflammatory and promotes the growth of intestinal microbial pathogens (Statovci et al. 2017).

1.4.2.Carbohydrates, proteins and fats

A lot of studies have analysed the specific dietary macronutrients and their own effects on human microbiota.

The review of Lopez-Legarrea and colleagues (2014) very effectively puts together interesting evidence between changes in some dietary components and the alteration of the intestinal bacterial composition. A reduction in carbohydrates intake, macronutrients known to be beneficial for producing SCFAs and phenolic compounds, brings about a depletion of Bifidobacteria, Clostridium and

Bacteroidetes species, with a consequent decreased production both in SCFAs

(above all Butyrate) and phenolic acids. A higher protein intake, known that the proteolytic fermentation determinates a production of beneficial compounds, even if can also induce an harmful putrefaction, brings to an increase in Bacteroidetes,

31 Lactobacillus and Bifidobacterium species with improvements in obesity,

inflammatory and metabolic conditions.

However, regarding proteins, it’s necessary to distinguish between animal and vegetable ones, because enough studies have shown an influence on microbiota composition, played by these two types of proteins. Singh and colleagues in their review (2017) summarises that the consumption of animal-proteins raises the concentrations of Bacteroides and other genera such as Alistipes, Bilophila,

Ruminococcus while reducing Bifidobacterium; in contrast, plant-proteins rise Bifidobacterium and Latobacillus genera while reducing Bacteroides and Clostridium perfrigens, suggesting that, if animal proteins are involved in

negative outcomes for human health, vegetable proteins play a beneficial role on gut microorganisms and related functions.

About fats, the review of Graf and colleagues (2015) reports a positive correlation between saturated fat intake and Bacteroides compared to an inverse correlation between the total amount of dietary fats and Prevotella.

Finally all these studies on macronutrients suggest that the compounds typical of a Western Diet, also individually, can negatively affect the gut microbiota composition and consequently the human health.

32

1.4.3.Prebiotics, probiotics and synbiotics

Prebiotics and probiotics are constituents of the Mediterranean Diet that modulate and impact on intestinal microbial composition so it is important to define them and to describe their main functions and effects on gut microbiota.

More in detail, prebiotics are non-digestible food ingredients that, selectively fermented, produce changes in the gut microbiota composition and/or activity conferring benefits on the health of the host (FAO 2008).

Probiotics are live strains of strictly selected microorganisms which, when administered in adequate amounts, confer a health benefit on the host (FAO/WHO 2002).

Synbiotics are synergistic combinations of probiotics and prebiotics (Cencic and Chingwaru 2010) so they are products in which a prebiotic component selectively favours a probiotic microorganism (Pandey et al. 2015).

Prebiotics are non-digestible carbohydrates, naturally present in vegetables, fruit, cereals, nuts, pulses, milk and honey, that can be directly obtained by aqueous extraction and by chemical or enzymatic treatments.

It’s important to distinguish into two types of indigestible carbohydrates: dietary fiber and prebiotics. Dietary fibres reach the colon where they are used as substrate by microorganisms for producing energy, metabolites and micronutrients for the host; this group includes plant structural polysaccharides such as pectin,

33

hemicellulose, cellulose and gums. Prebiotics, properly called, in addition to the fiber functions, stimulate the growth of some specific gut beneficial bacteria such as Bidifobacterium and Lactobacillus spp. (Corzo et al. 2015); in other words all prebiotics are fibers but not all fibers are prebiotics. Some of the most well-known prebiotics are inulin, fructo-oligosaccharides (FOS), galacto-oligosaccharides (GOS), lactulose, human milk oligosaccharides (HMO), lactosucrose (LS), isomalto-oligosaccharides (IMOS) and xylo-oligosaccharides (XOS).

Fibres can bring a lot of benefits on the human health among which protection against cardiovascular diseases by reducing LDL levels, improvement of glycemic control in Type II Diabetes, better intestinal motility, increase in the sense of satiety and weight loss, so prevention against obesity, and reduction of colorectal cancer risk. Furthermore the prebiotic effects are the improvement of gut barrier functions and host immunity, reduction of potentially pathogenic bacteria, such as Clostridia, and SCFA production.

A lot of studies have confirmed changes in gut microbiota composition due to an increased, even though low, consumption of fiber. Specifically fibre, thanks to its colonic bacterial fermentation with the consequent production of SCFAs (above all acetate, propionate and butyrate) increases the intestinal concentration of

Bidifobacterium and Lactobacillus spp. while reduces Clostridia, determining

benefits on the equilibrium of the human gut microbiota (Slavin 2013).

Probiotics, as already defined at the beginning of this chapter, are alive microorganisms so, for this reason, dead bacteria can’t be considered as such,

34

even if they can bring benefits to the host health when administrated (FAO/WHO 2002).

Probiotics can be found in foods produced through fermentation processes such as yogurt, kefir, aged cheese, sauerkraut, sourdough bread, miso, tempeh, beer and wine as well as in pharmaceutical products.

The most common probiotic species include Lactobacillus acidophilus, L. casei,

L. plantaum, L. reuteri, L. rhamnosus, L. paracasei, Bifidobacterium bifidum, B. breve, B. infantis, B. lactis, B. longum, B. adolescentis, Saccharomyces bourlardii, Propionibacterium freudenreichii and also Escherichia coli strain

Nissle (Gupta et al. 2009) and in order to obtain benefits, a dose of 5 billion colony-forming units a day (5x109 CFU/day), at least 5 days, has been recommended (Morais et al. 2006).

The most popular combination for synbiotics instead is a mixture of

Bifidobacterium or Lactobacillus genus with fructo-oligosaccharides (Markowiak

and Śliżewska 2017).

The main recognized functions, especially for Bidifobacterium and Lactobacillus spp. are

 Change in the intraluminal pH by forming lactic acid, hydrogen peroxide and acetic acid that makes the bowel more acid, inhibiting the potential proliferation of pathogens;

35

 Competition against other microorganisms for nutrients that are essential to their growth;

 Competition for the adherence to specific receptors in the intestinal mucosa in order to remain in the bowel and block the pathogenic effect of a receptor-microorganism binding;

 Immunomodulatory effects, for example an increase in gamma-interferon in subjects affected by allergies or atopic dermatitis;

 Expression of mucin gene so more mucus production, necessary for the protection and maintenance of the intestinal mucosa;

 Prevention and treatment of diarrhea.

Some beneficial effects of synbiotics on human health (Markowiak and Śliżewska 2017) are

 Increase in Lactobacillus and Bifidobacterium genera with a consequent maintenance of balance in the intestinal microbiota;

 Improvement of immuno-modulatory abilities;

 Improvement of the hepatic function in cirrhotic patients;

 Prevention of bacterial translocation and reduction in the incidence of nosocomial infections in post-surgical procedures and similar interventions.

36

The specific mechanisms of action for probiotics remain unclear besides the fact that there are also some criticisms to take into consideration about these supplementations.

In fact it’s important to remark that probiotic supplements can confer health benefits “when administered in adequate amounts” but the concentrations of the selected strains are not accurate, it’s not possible to exactly quantify the number of bacteria ingested and that will arrive undamaged in the bowel and also it’s not possible to know the right response of every individual since each person has a different intestinal bacterial habitat. For this reason, currently generic recommendations on supplementation in specific pathologies haven’t been formulated yet.

37

1.5.Microbiota and pathologies

It is important to consider that microbiota microorganisms are not only beneficial for the human organism but they also include pathological species that can negatively affect the host general status of health.

As well as already mentioned in the preceding chapter, diet represents the first factor that impacts on microbiota composition influencing the complex equilibrium that exists between these beneficial and pathological microorganisms.

In particular the condition characterized by qualitative and quantitative changes in the intestinal flora, so in its metabolic activity and local distribution, that produces harmful effects (Hawrelack et al. 2004) is known as Dysbiosis (Gr. Dys-“bad” and

biosis “way of living”), opposite to Eubiosis (Gr. Eu- “good” and biosis “way of

living”), the condition in which gut microbiota is dominated by beneficial bacterial species, mainly belonging to Firmicutes and Bacteroidetes phyla (Iebba

et al. 2016).

Dysbiosis can lead to the status of inflammation involved in the pathogenesis of some intestinal and extra-intestinal disorders (figure 1.5). Intestinal disorders are for example inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) and coeliac disease (CD) while extra-intestinal disorders include allergy, asthma, metabolic syndrome (so diabetes), cardiovascular disease and obesity (Carding et

38

Figure 1.5 Gut microbiota equilibrium and consequences of dysbiosis (Valdés et al. 2015).

Among extra-intestinal diseases related to microbiota dysbiosis in nutritional-science field, obesity is maybe the most studied, so for this reason the next section will report some evidence about it.

1.5.1.Focus on microbiota and obesity

Obesity is a multifactorial chronic disease, defined as abnormal or excessive fat-accumulation that may impair health (WHO). A simple, as well as simplistic, way

39

to classify obesity is the body mass index BMI, calculated with the person's weight in kilograms divided by the square of his height in meters. According to WHO, A BMI above or equal to 30 kg/m2 defines a condition of obesity in adults (for newborns, children and teenagers until 19 years old there are specific male and female WHO-charts for BMI-classifying) while BMIs between 25 and 29.9 are considered overweight, between 18.5 and 24.9 normal weight and less than 18.5 underweight.

The individual genetic predisposition added to the modern obesogenic lifestyle have brought about a real pandemic disease as experts report. In particular, referring to a lifestyle, it’s clear to understand that it’s not a single cause in determining obesity but rather a set of involved factors, among which human microbiota could play a crucial role.

As already explained in the previous chapter, changes in microbial diversity and composition are associated with several diseases, among which obesity, because the gut microbiota can regulate the inflammatory response, the insulin-resistance, the energy harvesting and fat-accumulation in the body (Torre-Fuentes et al. 2017). The complex mechanisms of this interaction are actually unknown so more studies are needed.

Among individuals, the body mass index is one of the non-parametric variables that can be significant related to a different gut microbiota composition. A lot of studies found that the intestinal bacterial population of obese adults, in respect to lean ones, is enriched in Firmicutes phylum and reduced in Bacteroidetes phylum (Chakraborti 2015; Clarke et al. 2013; Million et al. 2013).

40

About bacterial genera some other studies found a positive association between obesity and Firmicutes - Lactobacillus spp., especially for L. Reuteri specie in the work by Million and colleagues (2013) that also found higher concentrations of

Bifidobacterium animalis and Methanobrevibacter smithii in people with a lower

BMI as well as more Escherichia coli even if this last data is in contrast with previous evidence talking about a positive correlation between obesity and E. coli.

The study of Ignacio and colleagues (2017) conducted on children showed a higher number of Bacteroides fragilis group and Lactobacillus spp. in obese/overweight children in respect of lean ones, while Bifidobacterium spp. were inversely correlated with BMI and also Escherichia coli and

Methanobrevibacter smithii were found more represented in lean children

according to Million and colleagues.

Evidence also suggests that a higher ratio Firmicutes/Bacteroidetes in obese subjects leads to more efficiency in extracting energy from food (Morales et al. 2010).

The relationship between microorganisms and obesity isn’t clear so more studies of human models are needed to prove and clarify some mechanisms found out in mice models, for example by Clarke and colleagues (2013), showing changes in BMI, body-fat accumulation and also in leptin, glucose and insulin levels, FIAF (Fasting Induced Adipocyte Factor) and inflammatory parameters in rats hosting a gut microbiota in respect to which ones with a sterile bowel.

41

1.6.The advances in microbiome analysis methods

Nowadays for analysing the human microbiome there’s a wide choice of methodologies that ranging from the usage of the traditional bacterial cultures to the more advanced Next Generation DNA Sequencing technologies NGS (Walker 2016).

The first microorganisms were defined “little animals” in 1681 by Antonie van Leeuwenhoek who discovered them by the microscopic observation. From that year gradual changes and discoveries in science technologies have brought about a description of much more gastrointestinal bacteria.

Nevertheless in the 1960’s only about 10-25% of the gut microbiota has been isolated; it was thanks to a consequent improvement in anaerobic cultivation techniques and to the arrival of the molecular revolution in the early 70’s, that other genera, that were Bacteroides, Clostridium, Eubacterium, Veillonella,

Ruminococcus, Bifidobacterium, Lactobacillus, Peptostreptococcus and

Peptococcus, have been recognised to dominate the gastrointestinal tract

(Rajilić-Stojanović et al. 2014).

In fact in 1965, thanks to Robert Holley and colleagues, the first whole sequence of nucleic acid, alanine tRNA from Saccharomyces cerevisiae, was obtained and a few years later, in 1973, Frederick Sanger and his colleagues developed a DNA sequencing technique, named Sanger sequencing. This method allowed

42

recognition of specific DNA sequences thanks to a final fluorescent analysis (Heather and Chain 2016).

In 1983 Kari Mullis generated the Polymerase Chain Reaction (PCR), a technique constitute of three phases that allowed to quickly amplify a million copies of DNA even starting from small quantities of this molecule.

Finally in the 80’s the second generation sequencing technologies, also known as new generation sequencing (NGS) were developed, bringing about the possibility of sequencing hundreds of millions of short sequences in a single run. Among NGS, three main methods are Pyrosequensing or Roche-454, Illumina and SOLiD.

For the human microbiome analysis, in the first step it is necessary to process the biological sample, for example faeces, urine, saliva or maternal milk from which the DNA of microorganisms has to be specifically extracted. In the second step it is essential to develop the genomic library (a collection of the microorganism-DNA fragments) through the PCR replication, after sequence it and finally analyse the signals obtained by the sequencing technique.

For the nucleic acid replication Quantitative PCR (Q-PCR) is often chosen, also known as PCR real time, which is a technique of nucleic acid amplification and detection for both qualitative and quantitative analysis. This technique consists of three main parts

(DNA-43

polymerase, dNTPs, forward and reverse primers, fluorescent molecule e.g. SYBR Green) and samples are put in a well-plate (the most common used is the plate with 96 wells);

 Optical detection system: the optics system measures the amount of fluorescence produced during the Q-PCR reactions using a different combination of light sources (light-emitting diodes or LEDs, halogen lamp and laser), filters and detectors (photodiode, charge-coupled device or CCD and photomultiplier tube). The intensity of the fluorescent signal allows to determine presence and quantity of the sample-target;

 Instrument software: the runs of a real-time PCR system are monitored by a computer software that allows to analyse and better interpret results. The main functions of an instrument software are protocol setup, plate setup, data collection and data analysis.

For microbiome sequencing it is possible to choose a metagenomics approach or another one based on marked amplicons. With the first method the whole microbiota collected genome is sequenced; usually this microbial genome is primarily causally fragmented while, subsequently, every fragment is amplified and sequenced (shotgun sequencing). With the second method, not the whole genome, but only some significant markers are sequenced. The main marker used for Bacteria and Archaea, discovered in the 70’s, is the S16 rRNA gene that, thanks to its hypervariable regions, allows a trustworthy level of taxonomic classification until the identification of genus and specie (Rosselli et al. 2016).

44

2.

MICROBIOME AND DIET ON HUMAN

HEALTH: Relevance of Mediterranean Diet

adherence on gut microbiome composition and activity

in Spanish adult population

2.1.Introduction

The microbiome is known to have a profound impact on human health by playing a role in metabolic, nutritional, physiological and immunological processes in the human body (Gerritsen et al. 2011).

Although we are at the beginning of studying and understanding microbiota, we know that, among lifestyle factors, diet plays the major role in determining its composition and functional activity (De Filippis et al. 2015) even if it’s actually unknown which food constituents specifically promote growth and functionality of beneficial or damaging microorganisms in the intestine.

In particular food intake influences the production of different metabolites. In the large intestine undigested food components, fermented by microbiota, produce short chain fatty acids (SCFAs), organic acids used as energy sources by the host cells and the intestinal microbiota itself and having distinct physiological effects on gut environment and overall host health (Ríos-Coviánet al. 2016).

45

Since the moment that diet impacts on human health, also through the modulation of gut microbiota composition, it is important to consider that modern eating habits and trends of consumption are playing in favour of many diseases typical of our age, such as obesity, cardiovascular diseases, type 2 diabetes, osteoporosis, allergies and cancers.

On the other hand is known that Mediterranean Diet is one of the healthiest dietary pattern and a better adherence to this model can reduce the incidence of aforementioned modern diseases (Del Chierico et al. 2014).

For this reason, as a biotechnology laboratory specialized in microbiome research and nutrition, the aim of our study was to evaluate the gut microbiota composition and activity as producer of short chain fatty acids, to find a relationship with physiological parameters (sex and body mass index) and with the adherence to a Mediterranean dietary model in a sample of Spanish healthy adults.

46

2.2.Materials and methods

2.2.1.Participants

A total of 25 healthy Spanish volunteers (14 women and 11 men) aged 25 to 52 years have participated in the study (Table 2.1).

The participants had no pathologies or other specific health risk factor, except for someone presenting a pre-obesity body mass index (BMI), and antibiotics or other medication and supplement consumption, including probiotics and prebiotics, have not been reported for the previous two months.

Referring to WHO BMI standards, 17 of these subjects presented a normal body weight composition while 8 of which were overweight (pre-obesity). The BMI was calculated with the universal formula: person’s weight in kilograms divided by the square of the person’s height in metres (kg/m²). BMIs between 18.5 and 24.9 kg/m² were considered as normal indexes, BMIs between 25 and 29.9 kg/m² were considered as over.

Table.2.1 Age (years) and BMI (kg/m²) mean and range of study participants

VARIABLE MEAN± SD RANGE (min–max) AGE 39.48 ± 7.41 25 - 52

47

Written informed consent was obtained from the participants and the study protocol was approved by the Ethics Committee of the “Atencion Primaria-Generalitat Valenciana (CEIC-APCV)”. Before sample collection, oral and written instructions were given to the volunteers for standardized collection of samples. All of the samples were kept frozen -20ºC until delivery to the laboratory.

2.2.2.Diet records

Information about these 25 participant diets were collected using a questionnaire of Mediterranean diet adherence in order to establish if Mediterranean habits could be associated with the microbial gut composition and related activity.

The quantitative score of adherence to the Mediterranean Diet (annex 1) approved

by “the PREDIMED Study”, a primary prevention trial which tested the long-term effects of the Mediterranean Diet on incident cardiovascular disease, was selected to evaluate and easily classify the eating habits of sample subjects.

The questionnaire is composed of fourteen items specifically investigating Mediterranean Diet adherence of the interviewee for a final score from 0 to 14 points.

48

score ≥ 9 was considered as good one.

The table below (table 2.2) summarizes the diet study participant characterisation.

Table 2.2 Mediterranean Diet Scores (MDS) mean and range

In particular the item of MD-questionnaire “How many servings of pulses (150g) do you consume per week?” was chosen because pulses well represent a food category rich in vegetable proteins and fibres; so participants were divided into two groups: low (< 3 servings per week) and high consumption (≥3 servings per week).

2.2.3.Faecal sample collection

Faecal samples of 25 healthy Spanish subjects were collected at the same time of nutritional and dietetic information.

These samples were stored frozen in containers at – 80°C.

VARIABLE MEAN± SD RANGE(min-max) MDS 8.92 ± 1.62 5 - 14

MDS < 9 7.5 ± 0.96 5 - 8 MDS ≥ 9 10.23 ± 0.80 9 – 14

49

2.2.4.Bacterial DNA Extraction, purification and quantification

Previously the bacterial DNA was extracted by 25 human faecal samples, purified and fluorometric quantified.

Total DNA was isolated from the faecal pellets by using the MasterPure™ Complete DNA & RNA Purification Kit (Epicentre) according to the manufacturer's instructions with some modifications including bead-beater step and enzyme incubation to increase DNA concentration.

The kit contained Tissue and Cell Lysis Solution, TE Buffer (10 mM Tris-HCl [pH 7.5], 1 mM EDTA), RNase A (5 µg/µl), MPC Protein Precipitation Reagent and Proteinase K (50 µg/µl); mutanolysin 10 U/ml and lysozyme 20 mg/ml were added to the Lysis Solution in order to specifically extract the bacterial DNA.

After the MasterPure DNA Purification protocol, samples were left overnight at - 20°C with a previous addition of isopropanol.

The following day, samples were cleaned with 70% and 96% ethanol, 65°C milliQ Water was added in the tubes and NucleoSpin® Gel and PCR Clean-up by Macherey-Negel was used for removing contaminants and cleaning-up the samples.

The kit contained Binding Buffer NTI, Wash Buffer NT3 (it was concentrated so 70% ethanol was put-in), Elution Buffer NE (5 mM Tris/HCl, pH 8.5), NucleoSpin® Gel and PCR Clean-up Columns (yellow rings), Collection Tubes (2 mL).

50

Finally 200 µL DNA samples were quantified by using The Qubit™ 3.0 Fluorometer (260 nm UV absorbance).

The quantity of DNA samples (ng/µL) were obtained and a 1/5 dilution was applied to the “out of range” determinations.

2.2.5.Quantitative Polymerase Chain Reaction (Q-PCR)

Total Bacteria, Blautia coccoides group, Enterobacteriaceae family,

Bifidobacterium genus, Bacteroides-Prevotella group, Lactobacillus spp. and Bacteroides fragilis group were quantified (Log n° copies/µg) by using specific

primers by Quantitative PCRs.

The LightCycler® 480 ROCHE was used for quantitative PCRs.

The samples were 1/5 diluted (5 µL of DNA plus 20 µL of milliQ water) and the ROCHE Q-PCR Protocol was applied.

The protocol provided the usage of a 96-well plate where 1 µL of DNA sample was mixed with 9 µL reaction Mix (5 µL SYBR® Green mix, 3.5 µL milliQ water, 0.25 µL forward and 0.25 µL reverse 10 µM primers). All work tools were sterile (the entire analysis was carried out in a cabin, previously sterilized with 10 minutes of UV light).

51

and specific primers and Q-PCR melting temperature were selected (table 2.4).

Table.2.3 Q-PCR Conditions

Table.2.4 Specific Bacterial Primers and Melting Temperatures

BACTERIA Forward Primer Reverse Primer Mt Size (bp)

Total Bacteria CGTGCCAGCAGCCGCGG TGGACTACCAGGGTATCTAATCCTG 60 293

Blautia. C. group AAATGACGGTACCTGACTAA CTTTGAGTTTCATTCTTGCGAA 53 440

Enterobact family CATTGACGTTACCCGCAGAAGAAGC CTCTACGAGACTCAAGCTTGC 63 195

Bifidobact genus GATTCTGGCTCAGGATGAACGC CTGATAGGACGCGACCCCAT 60 232

Bact.des-prev. group GAGAGGAAGGTCCCCCAC CGCKACTTGGCTGGTTCAG 58

Lactobacillus spp AGCAGTAGGGAATCTTCCA CACCGCTACACATGGAG 58 341

Bacteroides F.group ATAGCCTTTCGAAAGRAAGAT CCAGTATCAACTGCAATTTTA 50 495

Phase name Target Hold Cycle

Number Pre-incubation 95 C° 10 mins 1 Amplification 95 C° 10 secs 40 50-63 C° 20 secs 72 C° 20 secs Melting Curve 95 C° 5 secs 1 65 C° 1 min 97 C° continuous

52

The obtained Ct values (cycle threshold values) were transformed in bacterial cell numbers by a standard curve. The resulting logarithmic number of bacterial DNA copies was converted into exponential, so it was divided by the Qubit DNA total amount in order to normalize and to finally obtain a Log n° copies/µg DNA concentration.

2.2.6.High Pressure liquid chromatography (HPLC)

Microbial metabolic activity was measured (mM) through the faecal short chain fatty acids profile (lactic, formic, acetic, propionic, isobutyric, butyric, isovaleric organic acids) by High Pressure Liquid Chromatography (HPLC).

SCFA profile was determined by using a© Phenomenex HPLC column; the other system components were Jasco LC-NET II/ADC hardware interface, PU-2080 plus intelligent HPLC Pump, LG-2080-04 quaternary gradient unit and UV-2075 detector (UV absorbance at 210 nm).

100 mg of faeces were aliquoted by the human faecal thawed samples, they were resuspended in 1 ml of phosphoric acid 0.1%, vortexed and centrifuged at 13000 rpm for 5 minutes at 4°C. Supernatants were filtered through a Millex 0.45 μm filter unit (Millipore, USA).

20 μL of each sample were loaded in the column trough a crystal syringe.

53

was maintained at 30 °C and the column pressure operated in isocratic conditions.

Standards curves for formic, lactic, acetic, propionic, isobutyric, butyric, isovaleric and valeric acid were used to quantify the shorty chain fatty acids; the SCFAs concentrations were expressed in mM.

2.2.7.Statistical data analysis

The GraphPad Prism 7 Software was used to statistically analyse Q-PCR, HPLC and participant recollected data.

Total Bacteria, Blautia coccoides group, Enterobacteriaceae family,

Bifidobacterium genus, Bacteroides-Prevotella group, Lactobacillus spp.

expressed in logarithmic function were severally compared with BMI (kg/m²), Mediterranean Diet Score and each SCFA concentration by calculating the linear regression (Pearson); bacteria were also compared through a non-parametric T-test with male/female sex, over/normal BMI, low/good Mediterranean Diet adherence and low/high pulses consumption.

Linear regression test was chosen too in order to analyse the relationships between SCFA concentrations, BMI and diet influence as well and T-test was used to find correlation between SCFAs and gender, BMI, Mediterranean Diet adherence and pulses consumption.

54

Statistical significance was considered as P-value < 0.05 with 95% CI.

Quantified values presenting a > 3 or < -3 SD Z score were considered outliers (Agresti & Finlay 2009), so they were not included in the analysis. The selected Z score formula was (X – π)/SD where π corresponded to the population mean and SD to the standard deviation.

55

2.3.Results

2.3.1.Bacterial quantification by Q-PCR

Bacteria from samples were quantified by using Quantitative-PCRs (the average amounts per group of bacteria are shown in the table 2.5).

Data obtained from Bacteroides fragilis group Q-PCR resulted not replicable, so their concentrations were not considered.

By analysing the linear regression with Pearson between BMI and each bacterial group expressed in Log n° copies/µg (table 2.6), a positive trend correlation was observed between BMI and total bacteria p = 0.0422 (graph 2.1).

The table 2.6 also shows p-values (not significant) and R2 that are found analysing the Mediterranean Diet Scores in respect of each bacterial group amounts.

Table.2.5 Q-PCR bacterial mean quantifications (Log n° copies/µg) and standard deviations. Target bacteria Mean ± SD Total Bacteria 9.44 ± 0.32 Blautia Coc group 7.06 ± 0.50 Enterob.ce-ae family 3.30 ± 1.35 Bifidobact genus 7.11 ± 0.42 Bacteroides Prev group 7.32 ± 1.09 Lactobaci-llus spp 4.35 ± 0.88