1
UNIVERSITA’ DEGLI STUDI DI NAPOLI FEDERICO II
Consiglio per la ricerca in agricoltura e l’analisi dell’economia agraria,
Centro di Ricerca per l'Agrobiologia e la Pedologia
DOTTORATO DI RICERCA IN
INSECT SCIENCE AND BIOTECHNOLOGY XXVII CICLO
2012-2015
The activation of the heat shock response by Cyclin G/ cdk5 complex after cold stress and the Wolbachia influences on
cellular stress response in Drosophila melanogaster
Relatore Candidata
Ch.mo Prof. Pio Federico Roversi Manuela Camerota Correlatori
Ch.ma Prof.ssa Tatiana Cosima Baldari Ch.ma Prof.ssa Rossella Di Giaimo
Coordinatore
Ch.mo Prof. Francesco Pennacchio
2
Index
Index pp. 2-3
1. Riassunto pp.4-9
2. Summary pp. 10-14
3. Introduction pp. 15-41
3.1.1. The cellular stress response pp. 16-17 3.1.2. The unfolded protein response pp. 17-18
3.1.3. The autophagy pp. 19-22
3.1.4.
The mitochondrial unfolded protein response
pp. 22-24
3.1.5. The heat shock response pp. 25-29 3.1.6. The nuclear DNA damage response pp. 29-31 3.2. The cyclin and the kinase cyclin dependent
complex
pp. 32-34
3.3. Cross-talk between stress response pathways pp. 34-36 3.4. Wolbachia host manipulation on many
pathways
pp. 36-38
3.5. Health and environmental implication pp. 39-40
3.6. Model organism pp. 40-41
4. Aims pp. 42-43
5. Materials and methods pp. 44-61
5.1. Fly culture p. 45
5.2. Antibiotic treatment p. 45
5.3. DNA extraction p. 46
5.4. RNA interference pp. 46-48
5.5. Cold stress and recovery treatment pp. 48-49
3
5.6. RNA extraction pp. 49-51
5.7. DNase treatments p. 51
5.8. Reverse transcription and PCRs reactions pp. 52-54
5.9. Real time PCR p. 55
5.10. Statistical analyses pp. 55-56
5.11. Protein extraction pp. 56-57
5.12. Co-immunoprecipitation pp. 57-59
5.13. SDS-PAGE and Western blotting pp. 59-61
6. Results and discussion pp. 62-85
6.1. Cold stress influence on the Atg1, the Xbp1 and Hsp70Aa genes
pp. 64-65
6.2. Cyclin G and cyclin-dependent kinase 5 involvement in the activation of the stress response by cold shock
pp. 65-67
6.2.1. Time-course analysis of CycG, cdk5, Hsf
and Hsp70Aa genes expression pp. 68-71
6.2.2. Timing genes expression of the CycG, the cdk5, HSF and Hsp70Aa
pp. 71-74
6.3. Co-immunoprecipitation of the CycG and cdk5 proteins
pp. 74-79
6.4. Hsp70Aa transcriptional regulation by cdk5 after cold stress
pp. 79-81
6.5. Wolbachia influences on Atg1, Xbp1 and Hsp70Aa genes expression after cold stress
pp. 82-84
6.6. Cold stress influences on the Wolbachia wsp gene
pp. 84-85
7. Conclusions pp. 86-90
8. Acknowledgements pp. 91-92
9. References pp. 93-107
9. Supplementary materials pp.108-110
4
1. Riassunto
5
I cambiamenti climatici causati dall’attività umana continuano a minacciare la salute della biosfera, con pesante impatto sugli ecosistemi, colpendo tutti i livelli trofici, dalle piante agli insetti, destabilizzando le dinamiche di popolazioni che possono portare all’ estinzione della specie. La temperatura ha sempre influenzato la distribuzione e l’abbondanza delle specie. Per gli ectotermi, essa ne influenza la distribuzione, lo sviluppo, la crescita oltre che i loro processi fisiologici e metabolici.
Evidenze crescenti hanno dimostrato che stress fisici, fisiologici e patologici scatenano la risposta cellulare allo stress in tutti gli organismi. Essa comprende l’autofagia, la risposta allo stress del reticolo endoplasmatico e del mitocondrio, la risposta da danno al DNA e la risposta heat shock.
Tutti questi meccanismi sono regolati sia indipendentemente sia in modo coordinato. La risposta cellulare allo stress è considerata un “tutore”
della omeostasi cellulare. Molte sono le proteine
“ponte” in essa coinvolte, di cui molte sono già state
identificate ma ne restano ancora da indentificare.
6
Attualmente la risposta allo stress dell’ organismo ha attirato enorme attenzione dato che, in questa Era, diverse e a volte severe condizioni di stress mettono a dura prova l’omeostasi cellulare.
Questo è il contesto in cui nasce questo progetto di ricerca volto a scoprire nuovi geni coinvolti nella risposta allo stress, a comprendere come gli organismi reagiscano ai cambiamenti di diversi fattori ambientali come per esempio al freddo.
Inoltre in questo lavoro si cerca di capire se e quale ruolo abbiano le infezioni batteriche sulla risposta allo stress da freddo. Per tutti questi scopi è stato scelto come modello sperimentale la Drosophila melanogaster . All’inizio è stato scelto di studiare alcuni geni chiave di alcuni meccanismi cellulari coinvolti nella risposta cellulare allo stress, dopo stress da freddo. Essi sono: Atg1 per l’autofagia, Xbp1 per la risposta allo stress del reticolo endoplasmatico e Hsp70Aa per la risposta heat stress. Dai risultati ottenuti si è visto che tutti i geni sono influenzati dallo stress da freddo.
Successivamente è stato deciso di concentrare
7
l’attenzione sulla risposta heat stress e la sua produzione delle proteine Heat shock. Tra le proteine Heat shock, la famiglia Hsp70 ha un ruolo chiave nella coordinazione della risposta cellulare allo stress. In particolare sono state ricercate proteine “ponte” tra i complessi ciclina/cdk, che regolano sia la progressione del ciclo cellulare che la trascrizione di alcuni geni, e la risposta cellulare allo stress. Si è scelto di fare uno studio dell’espressione temporale del fattore di trascrizione delle proteine heat shock, HSF, della Ciclina G, della cdk5 in aggiunta a Hsp70Aa, dopo diverse ore di stress e di recupero. Hsp70Aa, la ciclina G e la cdk5 risultano molto influenzati dallo stress da freddo. Invece i livelli di HSF restano pressoché costanti.
Successivamente, per verificare l’interazione della
ciclina G con la cdk5 sono stati condotti esperimenti
di co-immunoprecipitazione. E’ stata osservata
l’interazione tra le due proteine da trenta minuti a
due ore di recupero dopo lo stress da freddo. Dopo
questo risultato si è deciso di studiare il
coinvolgimento della cdk5 nella regolazione
8
trascrizionale di Hsp70Aa, una isoforma della famiglia delle Hsp70. A questo scopo la cdk5 è stata silenziata mediante l’esperimento di RNA interference, condotto usando il sistema GAL4/UAS.
E’ stato osservato che la cdk5 regola la trascrizione di Hsp70Aa. Questo risultato è stato confermato stressando le D. melanogaster con il gene cdk5 silenziato. Queste hanno esibito una risposta attenuata allo stress da freddo mostrando livelli ridotti di Hsp70Aa rispetto alle linee di controllo, stressate allo stesso modo. Inoltre è stata studiata la possibile influenza dell’infezione da Wolbachia ( il piu’ diffuso endosimbionte trovato negli artropodi) sulla risposta cellulare allo stress oltre all’influenza, che è già nota in letteratura, sul metabolismo, il sistema immunitario e la riproduzione. A questo scopo sono state considerate due linee di D.
melanogaster affette o meno dall’infezione da
Wolbachia ed è stato studiato se i meccanismi di
autofagia, di risposta allo stress del reticolo
endoplasmatico e la risposta heat stress fossero
influenzati dall’infezione da Wolbachia. Lo studio è
9
stato condotto studiando i livelli di mRNA per i geni
chiave dei tre meccanismi cellulari presi in esame,
già precedentemente descritti. Tutti risultano essere
influenzati da Wolbachia. Inoltre essa influenza la
fase di recupero dallo stress da freddo. Per finire, è
stato studiato l’effetto dello stress da freddo
sull’espressione di un gene codificante una proteina
di superficie di Wolbachia: il gene wsp. Facendo una
RT-PCR è stato visto come lo stress da freddo abbia
un effetto negativo sull’espressione di questo gene
fino a 8 ore di recupero dallo stress da freddo
indicando che Wolbachia è molto sensibile a questo
stress anche quando l’organismo ospite è in fase di
recupero.
10
2. Summary
11 The environmental changes caused by the human activities
continue to threaten the health of the biosphere with heavy impact on natural ecosystems affecting all trophic levels from plant to insect and destabilizing the population dynamics that can lead to the extinction of the species. The temperature has influenced the distribution and the abundance of all species.
As regards ectotherms, the temperature affects their distribution, development and growth in addition to physiological and metabolic processes. Increasing evidences have shown that, in all organisms, environmental, physiological and pathological stresses evoke the cellular stress response (CSR) involving as example the autophagy, the unfolded protein response, the DNA damage response, the mitochondrial unfolded protein response and the heat shock response to maintain and restore or re-establish the cellular homeostasis. Evidences showed that these pathways are regulated independently as well as co-ordinately as network of interlinked pathways.
The CSR is considered the “guardian” of cellular homeostasis, it is a complex mechanism that involves many cellular pathways and cross-talker proteins. Afterward, the identification of the linker proteins that coordinate and regulate these interactions is very important. Nowadays many genes implicated in the CSR have been identified, but a lot of gaps need to be filled clarifying the determined
12 functions and the interaction between genes of CSR
pathways.
In this Era, the CSR captures big attention because, the organisms are continually threatened by different stresses conditions.
Within this context, this research project was thought in order to find new candidates genes involved in these cross-talk pathways, with the aim to understand how the organisms react to environmental factors e.g. cold stress and to deepen the influence of infection on the cellular stress response. We choose D. melanogaster as experimental model organism to study some keys genes involved in cellular stress response e.g. the Atg1 gene for the autophagy, the Xbp1 for the endoplasmic reticulum unfolded protein response, and the Hsp70Aa for the heat shock response after the cold stress. All the genes studied, were found to be involved in the stress response after cold stress. Hence, it was decided to focus the attention on the heat shock response and in particular on the heat shock proteins of the Hsp70 family since have a key role in the coordination of the CSR. The research continued searching a link between the cell cycle checkpoints, where cyclin/cdk complexes are involved, and the cellular stress response. With this aim it was done a time-course analysis of the expression of Hsp70Aa, HSF (the transcriptional factor of the heat shock proteins), Cyclin G and cdk5 upon different
13 protocols of stress induction and recovery. All the analysed
genes changed in gene expression more during the recovery phases than the stressing period except for HSF. Next step was to verify the interaction between the cyclin G and the cdk5. For this purpose co-immunoprecipitation experiments were set up. The interaction between these two proteins was confirmed. Then it was studied the possible involvement of the cdk5 in the activation of heat shock response after cold stress. Through RNAi experiment, using the GAL4/UAS system, it was demonstrated that cdk5 regulates the Hsp70Aa transcriptional activation.
Moreover it was investigated on the possible involvement of Wolbachia infection (the most widespread endosymbiotic microbe found in arthropods) on the cellular stress response.
It is already known that the infection by this bacterium affects the metabolism, the immunity system and reproduction. The gene expression of Atg1, Xbp1 and Hsp70Aa was studied on D. melanogaster strains infected or not by Wolbachia upon cold stress. Results showed that Wolbachia infection affects the expression levels of these genes and the recovery phase after cold stress treatments. At last it was studied the effect of the cold stress on the Wolbachia infection by monitoring the expression of the gene encoding for a Wolbachia surface protein (wsp). It was seen that the cold stress affects negatively the wsp gene expression
14 up to 8 hours of recovery after cold stress, indicating that
Wolbachia is very sensitive to cold stress and that its activity is hampered even after recovery of the host.
15
3. Introduction
16
3.1.1. The cellular stress response
Always the cells of all organisms are exposed to different array of physiological, environmental pathological and physical stresses. Hence, organisms evolved the cellular stress response to preserve cellular homeostasis. The cellular stress response (CSR) is a universal network of pathways that identify, check and respond to stresses. Through the evolution, all organisms had conserved the proteins involved in key aspects of the CSR (Morimoto and Santoro, 1998;
Jolly and Morimoto, 2000; Kültz, 2005). The CSR includes the unfolded protein response (Stevens and Argon, 1999), the autophagy (Cuervo, 2004), the heat shock response (reviewed in Morimoto, 2008), the mitochondrial unfolded response, and nuclear DNA damage response (Kourtis and Tavernarakis, 2011) (Fig.3.1.).
Fig. 3.1. General and organelle‐specific stress response pathways. Depending on the type of macromolecule and the site of damage, distinct stress response pathways, such as autophagy, heat shock response, UPRmt, UPRER, remodelled proteasome and the DNA damage response are initiated. Double arrows denote bi‐directional communication with the nucleus, which
17
involves generation of stress signals in the stressed organelle or the cytoplasm, transduction of the signals to the nucleus and up-regulation of stress‐relieving proteins, which in turn function to ameliorate damage. Although, a typical Golgi stress response pathway has not been described yet, several types of stress may influence gene expression in the nucleus and cell homeostasis by impinging on Golgi function. BER, base‐excision repair; BiP, Ig‐binding protein; CHOP, C/EBP homologous protein; CMA, chaperone‐mediated autophagy; DAF‐16, abnormal dauer formation 16; DVE‐1, defective proventriculus 1;
GRP94, glucose‐regulated protein 94; HSF1, heat shock factor 1; HSP, heat shock protein;
HR, homologous recombination; IGF‐1, insulin growth factor 1; LAMP‐2A, lysosome‐associated membrane protein 2A; NER, nucleotide‐excision repair; NHEJ, non‐homologous end joining; PERK, PKR‐like ER kinase; UPRER/mt, unfolded protein response endoplasmic reticulum/mitochondrion; XBP‐1, X‐box‐binding protein 1 (Kourtis and Tavernarakis, 2011).
3.1.2. The unfolded protein response
In the eukaryotic cell, the endoplasmic reticulum (ER) provides to new synthesis, folding of secretory and membrane proteins and to their post-transnationally modification before exit from the organelle. The ER activities change in response to physiologically cellular request or in response to cell differentiation or environmental changing (Lai et al., 2009; Ron and Walter, 2007). Moreover, these cellular requests can increases the misfolded proteins in the ER compartment that adding to other perturbation that can occur (as alteration in redox state or in calcium levels) evoking ER stress. Stressing conditions can be produced by some pharmacologically treatments also. When the UPRER is activated, the cells temporarily inhibit the new proteins synthesis promoting the transcription of the proteins involved in the unfolded proteins response (UPRER) (Fig. 3.2.).
18
Fig. 3.2. UPR signaling pathways in mammalian cells. The UPR is mediated by three ER- resident transmembrane proteins that sense ER stress and signal downstream pathways. The PERK kinase is activated by dimerization and phosphorylation. Once activated, it phosphorylates eIF2, resulting in translation attenuation. Phosphorylated eIF2 selectively enhances translation of the ATF4 transcription factor that induces expression of UPR target genes. Activation of IRE1 by dimerization and phosphorylation causes IRE1-mediated splicing of XBP1 mRNA. Translation of spliced XBP1 mRNA produces a transcription factor that upregulates target genes via the ERSE promoter. ATF6 activation involves regulated intramembrane proteolysis. The protein translocates from the ER to the Golgi where it is proteolytically processed to release a 50-kDa transcription factor that translocates to the nucleus and binds the ERSEs of UPR target genes. All three ER-resident transmembrane proteins are thought to sense ER stress through Grp78 binding/release via their respective lumenal domains, although structural studies have also suggested that IRE1 may interact with unfolded proteins directly. The GADD34 protein, a protein phosphatase upregulated by the PERK pathway, dephosphorylates eIF2α to restore global protein synthesis (Lai et al., 2007).
The X box binding protein-1 (Xbp1), the Activating Transcriptional Factor 4 (ATF4) and the Activating Transcription Factor 6 (ATF6) are the transcriptional factor regulating the transcription of the UPR genes. These are involved in the preservation of the ER folding capacity, in the prevention of the formation and the aggregation of misfolded proteins, and in the promoting the breakdown of misfolded proteins (Kourtis and Tavernarakis, 2011; Lai et al., 2007;
Ron and Walter, 2007; Rasheva and Dominigos, 2009). If the homeostasis is not be restored, the apoptosis occurs (Lai et al., 2007; Ron and Walter, 2007).
19
3.1.3. The autophagy
Autophagy (from the Greek for self-eating) is a ubiquitous cellular pathway in eukaryotic cells that work through the formation of double membranes vesicles called autophagosome, sequestering organelles, proteins and cytoplasm portion and in fusion with lysosome creates autolysosome where the sequestered component are degraded by hydrolase (Yorimutsu et al, 2006) (Fig. 3.3.).
Fig. 3.3. Pathways for the degradation of intracellular proteins in lysosomes. A schematic model of the different mechanisms that lead to degradation of intracellular proteins in lysosomes and the stimuli that maximally activate them are depicted. The arrow indicates activation of vid after switching from poor to rich nutritional conditions. The cytosol to vacuole (cvt) pathway that transports hydrolases is also shown (dotted) because during the nutrient deprivation transport of the same enzymes is performed by macroautophagy (Cuervo, 2004).
Physiologically this mechanism is implicated in the normal turnover and recycling of long live cellular components and damaged proteins, organelles. Many aspects of homeostasis and development are regulated by autophagy (Levine, 2005;
Lum et al., 2005; Rubinsztein et al., 2007; Shintani and
20 Klionsky, 2004). In the same way, cells activates this
pathway under food deprivation conditions organism (starvation) and for the nutrients acquisition. Autophagy also was essential for the animal development. In fact during Drosophila melanogaster metamorphosis, autophagy operates to the large-scale histolysis that breaks down larval tissues and makes for the formation of adult structures (Butterworth et al., 1988; Lee and Baehrecke, 2001; Lee et al., 2002). Likewise this mechanism is important for the development and morphogenesis of vertebrates (Cecconi and Levine, 2008; Melendez and Neufeld, 2008). Recently it was given importance to the implication of the autophagy in themselves cellular protection despite environmental stresses.
Multiple reports show that the autophagy-related genes (Atg) expression can be stimulated in response to different array of cellular stresses such as DNA damages and intracellular pathogens (Girardot et al., 2004; Thorpe et al., 2004; Xiong et al., 2007, Wu et al., 2009, Kourtis and Tavernarakis, 2011;
Yorimutsu et al, 2006, Kromer et al. 2010). Autophagy plays alone as in cooperation with other cellular stress response pathways (Wu et al. 2009). In Saccharomyces cerevisiae almost 20 Atg genes were discovered many of which are preserved in metazoan (Scott et al. 2007). The Atg1 gene is a serine threonine enzyme evolutionary conserved (Jung et al, 2010). Drosophila melanogaster has the Atg1 homologue
21 also. Atg1 interacts with many component of the autophagy
pathway so has a central role in the coordination of the autophagy response (Scott et al. 2007), (Fig. 3.4.).
Fig. 3.4. Dynamics of Atg1 complexes upon autophagy induction in different eukaryotes.
(A) In yeast, under nutrient-rich conditions, the active TOR complex 1(TORC1) hyperphosphorylates Atg13 (Kamada et al., 2010). This prevents the association of Atg1 with Atg13, which is bound to Atg17, Atg31 and Atg29, leading to inhibition of autophagy induction. Under starvation conditions when TORC1 is inactivated, Atg13 is no longer phosphorylated by TORC1, whereas Atg1 is autophosphorylated, leading to the association of Atg1 with the complex between Atg13, Atg17, Atg31 and Atg29, and subsequent autophagy induction (Cebollero and Reggiori, 2009; Chang and Neufeld, 2010; Kamada et al., 2010; Nakatogawa et al., 2009). (B) In contrast to yeast, mammalian ULK (ULK1 or ULK2, the homologs of yeast Atg1) forms a stable complex with mammalian Atg13, FIP200 (a putative counterpart of yeast Atg17) and Atg101 (an Atg13-binding protein), irrespective of TORC1 activation. Under nutrient-rich conditions, the active TORC1 associates with the ULK complex (ULK1 (or ULK2)–Atg13–FIP200-Atg101), phosphorylates ULK1 (or ULK2) and hyperphosphorylates Atg13, which inhibits the kinase activity of ULK1 (or ULK2) and thus blocks autophagy induction. Under starvation conditions when TORC1 is inactivated, TORC1 dissociates from the ULK complex, preventing phosphorylation of Atg13 and ULK1 (or ULK2) by TORC1 and leading to autophagy induction, whereas ULK1 (or ULK2) still phosphorylates Atg13 and itself, and hyperphosphorylates FIP200 (Chang and Neufeld, 2010; Mizushima, 2010; Yang and Klionsky, 2010). (C) Similar to the situation in mammals, in Drosophila Atg1 forms a complex with Atg13 irrespective of TORC1 activation (Chang and Neufeld, 2010). Under nutrient-rich conditions, the active TORC1 phosphorylates Atg13 and hyperphosphorylates Atg1, leading to the inhibition of autophagy induction. Under starvation conditions, when TORC1 is inactivated, Atg1 and Atg13 are no longer phosphorylated by TORC1, whereas Atg1 still phosphorylates itself and hyperphosphorylates Atg13, leading to autophagy induction. Figure modified from Chang and Neufeld (Chang and Neufeld, 2010) with permission(Yongqiang and Klionsky, 2011).
However, how the autophagy machinery senses and responds to stress is not thoroughly understood. Such regulation could occur at several levels, as autophagy can be regulated by
22 transcriptional, as well as post-transcriptional mechanisms.
Consistent with a function of gene regulation in this context.
A misregulation of this process is associated with a great numerous pathologies i.e. cancer (Høyer-Hansen & Marja Jäättelä, 2008; Mathew et al., 2007; Yue et al., 2003), neurodegeneration (Hara et al., 2006; Komatsu et al., 2006), muscular atrophy (Mammucari et al., 2007; Zhao et al., 2007). Moreover this mechanism is involved in cell death, pathogenic infection, neurodegenerative disease, cell growth and stress response and represent the most protective cellular mechanism through cell fight against degenerative and neoplastic disease and infections (Scott et al., 2007; Levine and Kroemer, 2008; Mizushima et al., 2008).
3.1.4. The mitochondrial unfolded protein response
Mitochondria are cellular organelles essential for numerous metabolic processes as ATP production, Calcium signaling, iron-sulfur cluster biogenesis, apoptosis, nucleotide and amino acid metabolism. Mitochondrial proteins are encoded by nuclear genes in addiction to mitochondrial genes. Proteins are imported into mitochondria by translocases in the inner and/or outer membranes with the
23 help of mitochondrial chaperones belonging to Hsp70 and
Hsp60 families (Neupert 1997; Broadley and Hartl, 2008).
The electron transport chain activity produces Reactive Oxygen Species (ROS) as changing in environmental temperatures and exposure to toxin increase the accumulation of misfolded or unfolded mitochondrial proteins with potentially deleterious effects on the mitochondrial genome's susceptibility that can acquires mutations. Thus cells elicit the mitochondrial unfolded protein response (UPRmt) as results to the accumulation of unfolded or misfolded proteins beyond the organelle's chaperone capacity (Pellegrino et al., 2013), inducing nuclear gene transcription of mitochondrial chaperones that preserve proteins mitochondrial homeostasis (Pellegrino et al., 2013; Haynes et al., 2010; Bukau et al., 2006; Young et al., 2004; Tatsuta and Langer, 2008; Baker et al., 2011). In mammals cells c-Jun is the transcriptional factor activated by c-Jun-N terminal kinase (JKN) that promote the transcription of mitochondrial chaperones (Horibe and Hoogenraad, 2007). Mammalian JNKs, such as p38 MAPKs, was activated by different array of stresses (Pelech, 1996;
Goberdhan and Wilson, 1998), likewise ultraviolet (UV) and X-irradiation (Dérijard et al., 1994), heat shock (Adler et al., 1995), oxidative and chemical stresses (Cavigelli et al., 1996;
Liu et al., 1996) (Fig. 3.5.).
24
Fig. 3.5. Mitochondrial UPR signaling in mammalian cells. Transcriptional induction of mitochondrial chaperone and protease genes in mammalian cells requires several transcription factors, with CHOP and C/EBP b having important roles. CHOP binding sites along with two other conserved regions (MURE1 and MURE2) are found in a number of genes that are induced in response to mitochondrial stress (Aldridge et al., 2007). The identity of the transcription factors that interact with MURE1 and MURE2 are currently unknown. CHOP is itself transcriptionally induced in response to mitochondrial stress, which represents an early event in the pathway (Horibe and Hoogenraad, 2007). CHOP induction requires the kinase JNK2 and the transcription factor Jun, which binds to the AP-1 site within the promoters of the CHOP and C/EBP b genes. Signaling inputs that indicate mitochondrial stress and lead to activation of JNK2 signaling are currently unknown, but the up-regulation of mitochondrial chaperone and proteases re-establishes protein folding homeostasis within the organelle (Haynes and Ron, 2010).
D. melanogaster has the same conserved pathway in which the mammals c-Jun transcription factor and JNK kinase homologues are respectively d-Jun and d-JNK (Goberdhan and Wilson, 1998) and D. melanogaster dJNK pathway cascade is involved in stress response also (Botella et al., 2001). More disease are linked with mitochondrial dysfunction e.g. Parkinson disease, Friedreich’s ataxia and cancer. Moreover mutation in the mitochondrial genome causes many disorders such as Leigh Syndrome and Leber’s hereditary optic neuropathy (Wallance, 2005).
25
3.1.5. The heat shock response
A key aspect of CSR is the heat shock response e.g. the production of heat shock proteins (review, Morimoto et al., 2000). In 1962 Ritossa observed that high temperature induce puffs (regions of high transcription activity) in polytene chromosome of Drosophila melanogaster larvae salivary glands. After it was seen that the heat shock proteins were interested to an increased transcription activation (Lindquist 1986). Next studies shown that the heat shock response is a pathway conserved from bacteria to animals and plants that preserve cellular homeostasis by oxidative stress, heat shock, heavy metals producing the heat shock proteins (Hsps) (Craig, 1985; Lindquist and Craig, 1988). The Hsps are classified on the basis of molecular mass and their sequence homology and function in Hsp100, Hsp90, Hsp70, Hsp60, Hsp40 and small Hsps. The Hsps, also known as molecular chaperones, are involved in folding, translocation of the proteins in different cellular compartments and demolition of proteins aggregate (Nover and Scharf 1984; Feder and Hofmann, 1999; Sørensen et al., 2003; Parsell et al., 1993).There are some Hsp constitutively present in cells (heat shock cognate) while other Hsp are expressed only after a plethora of stress signals such as heat shock, heavy metals, oxidative stress, inflammation (Hartl and Hayer-Hartl 2002).
The stressing agents affect the hydration and the redox state
26 of the cell causing the increase of misfolded proteins in
cellular compartment and altering biological processes (Jolly and Morimoto 2000). Moreover the Hsp are involved in physiological and non-stressed processes as cell cycle, cell proliferation and differentiation (Milarski and Morimoto, 1986; Jerome et al., 1993; Hang et al., 1995), (Fig.3.6.).
Fig. 3.6. Cell stress response. The expression of HS genes including chaperones and components of the clearance machinery is induced in response to three classes of physiological and environmental stress conditions including environmental stress, pathophysiological stress, and protein conformational disease, and by a fourth class of cell growth and development. Indicated below each major class are representative conditions known to involve the expression of heat-shock proteins and chaperones (Morimoto, 2008).
In arthropods, many Hsps are up-regulated in response to heat and cold stress in addition to heavy metals, ethanol and desiccation (Hoffmann et al., 2003; Hoffmann et Parsons 1991; Tammariello et al 1999). The Hsp70 family includes the most widely studied Hsps under cold stress conditions; in particular, the isoform Hsp70Aa has been shown to play an important role in the response to thermal stress in D.
melanogaster (Colinet et al., 2009).
27 Heat stress or other stress induce the Hsps gene transcription
by a group of transcriptional factors named Heat shock factors (Hsf) that bind the heat shock elements (HSEs) and promote the Hsp transcription. The HSE consists of a pentameric sequence nGAAn inverted repeat at last three times nTTCnnGAAnnTTCn upstream all the Hsps genes (Wu et al., 1994). Among these Hsfs, in vertebrate and plants were identified four Hsf: Hsf1, Hsf2-3-4. The role of each Hsf resulted incomplete. Despite vertebrate, the invertebrates have only one Hsf (Akerfelt et al., 2010).The vertebrate Hsf1 is functional analogue to the D.melanogaster and yeast Hsf (Nakai and Morimoto, 1993; Rabindran et al., 1991; Sarge et al., 1991). The molecular mechanism of Hsp transcriptional activation is a multistep process in which the Hsfs need to be phosphorylated, translocated from cytosol to nucleus, where the Hsf trimer formation has been done, and through its binding to heat shock element (HSE) starting the Hsp genes transcriptions. The enzyme involved in the Hsf1 phosphorilation is the protein kinase C (PKC) that phosphorylate proteins on serine threonine residues. The proposed mechanism of Hsp70 auto-regulation was showed in fig 3.7. Different types of stress causes an increases of Ca2+ endocellular level that bind and activate the PKC, and the phosphatise (PP), inhibiting. After the PKC phosphorylate Hsf1 activating that came in the nucleus, and
28 after trimerization binds the HSE element of Hsps genes
activating their transcription.
Fig. 3.7. Proposed auto-regulation of HSP70 through PKC and PP. Stressors cause an immediate increase in cytosolic free Ca2+ concentration [Ca2+]i (step 1), which activates PKC activity and inhibits PP activity (step 2). This leads to HSF1 phosphorylation (step 3) and binding to HSE (step 4), which induces an increase in HSP-70 production (step 5). This overexpression of HSP-70 is capable of inhibiting the increase in [Ca2]i (step 6) and subsequent steps (Ding et al., 1998).
It was also demonstrated that the overexpression of Hsp70 has a negative regulation on Hsf1 activation (Ding et al., 1998). For this reason it was not observed the Hsp70 overexpression after other stimulations. Despite PKC is the serine threonine enzyme involved in the Hsp transcription activation, the increased evidence shown that environmental stresses activate many pathways, so is not exclude that other enzyme are involved in Hsp regulation (de Pomerai et al., 2008).
The Hsp were overexpressed in more pathologies as Alzheimer’s disease, epilepsy, Parkinson disease, amyotrophic lateral sclerosis, in tumors and pathologies
29 related to autoimmune disease as multiple sclerosis (Turturici
et al., 2011). In D. melanogaster the Hsp70 overexpression causes the decrease growth, development and survival to adulthood (Krebs and Feder, 1997). Hence, it is important to understand this cellular response pathway for identification of prevention methods and for the treatment of these disease state.
3.1.6. The nuclear DNA damage response
It is known that the stress kinase pathways is activated after cellular and cytoplasm component damage while the nuclear damage response is activated after a DNA damage (Amanda et al., 2009). DNA damage can be evoked by different stresses e.g. UV irradiation, reactive oxygen species (ROS) (Lindahl, 1993; De Bont and van Larebeke, 2004;
Hoeijmakers, 2009). The genome stability was preserved by a machinery of repair that respond to various DNA damage (Fig. 3.8).
30
Fig. 3.8. Main DNA lesions and corresponding DNA-damage-repair pathways. DNA lesions that affect a single strand without significantly disrupting the helical structure are generally repaired by BER, whereas DNA damage significantlydistorting the DNA helix is repaired by NER. DR copes with small chemical changes affecting a single base, and MMR repairsmismatches in the pairing of DNA caused by replication errors. Finally, HR and NHEJ, although distinct pathways, are both involved in the repair of DNA double-strand breaks: HR allows ‘error free’ repair of the lesion whereas NHEJ is an ‘errorprone’
mechanism that repairs DNA but at the cost of introducing mutations into the genome. 8 The selection of HR or NHEJ is primarily based on the phase of the cell cycle and the expression, availability and activation of DNA-repair proteins. 104 Abbreviations: AGT, O6-alkylguanine-DNA alkyltransferase; ATM, ataxia telangiectasia mutated; BER, base excision repair; DR, direct repair; GG-NER, global genome NER; HR, homologous recombination; 06MeG, O6-methylguanine; MMR, mismatch repair; NER, nucleotide excision repair; NHEJ, non-homologous end joining; TC-NER, transcription-coupled NER (Vinay et al., 2012).
Studies on DNA damage focused on the cell response under damage induced by ionizing radiation or highly reactive chemicals. Recently it was demonstrated that osmotic stress and heat shock also causes DNA damage and the DNA repair mechanisms were activated (Kültz and Chakravarty, 2001;
Kültz et al., 1998; Seno and Dynlacht, 2004).The types of DNA damage can be grouped in: DNA single-strand breaks (ssb), DNA double-strand breaks (dsb), base modification and DNA nucleotide adduct formation, mismatches of DNA bases. The mechanisms to repair the damage to single base or nucleotide are respectively base excision repair (BER), nucleotide excision repair (NER). The Base excision repair
31 (BER) is a pathway occurring for the repair of a damaged
single base on a single DNA strand while the other strand acts as the template for the repair (Krokan et al., 2000). The nucleotide exition repair (NER) consists in the remotion of DNA lesion caused by UV irradiation or chemicals agents (Sancar et al., 2004) while, the ionizing radiations and chemical substance produce reactive oxygen species (ROS) forming double-strand breaks that are repaired through homologous recombination (HR) or nonhomologous end- joining (NHEJ) and nucleotide mismatch repair (MMR).These DNA repair mechanisms are more conserved between prokaryotic and eukaryotic organism (for details see Sancar et al., 2004). Many pathologies are related to DNA damage repair system failure, as example the Xeroderma Pigmentosum, the Cockayne syndrome, are related to NER
failure, moreover the association between inflammation and oxidative stress is well documented (Wiseman and Halliwell, 1996; Halliwell and Gutteridge, 1996). Recently it was find a link between the defects in repair of oxidative DNA damage and a predisposition to disease. However has not been easy to link the DNA damage and mutation to the pathophysiological changes (Cooke et al., 2003).
32
3.2. The Cyclin and the kinase cyclin dependent complex
Recent evidences underline many links between the stress-response and checkpoint pathways in normal cell growth, development as in the response to UV ray, oxidative stresses. Moreover both pathway can regulate the cellular stress response also regulating the transcription factor that control the genes involved in stress response (Amanda et al., 2009).
Cyclins are a family of proteins containing a domain of 100 amino acid called “cyclin box” extremely conserved in all organism (Pines and Hunter, 1989; Nugent et al., 1991).
Through the cyclin box some cyclins act as regulatory subunit of cyclin dependent–kinase (cdks) forming an active kinase complex that phosphorylates cellular substrate on serine and threonine residues influencing biological processes (Hunt, 1991; Pines, 1991). Just the cyclins A, B, D and E are involved in the cell cycle progression (Fig. 3.9.) while the cyclins C, K, H and T are involved in transcription regulation. The Cyclins I, S and F are involved in proteolysis, cell survival and short term memory (Faradji et al., 2011).
33
Fig. 3.9. Positive feedback loops between Cdk-cyclin complexes and Cdc25 family members drive cell cycle transitions.
The cyclin G1 and the cyclin G2 are new members of this family (Tamura et al., 1993). Both this cyclins are closely related to the Cyclin I and A (Horne et al., 1996). The cyclin G1 is involved in G2/M arrest of the cell cycle replying to DNA damage (Okamoto and Prives, 1999, Kimura et al., 2001). The cyclin G2 is a negative regulator of the G1/S transition (Bennin et al., 2002; Horne et al., 1997). Cyclin G1 is one of the target gene of the transcription factor p53 (Okamoto and Beach, 1994; Zauberman et al., 1995), the tumor suppressor implicated in the regulation of cell cycle, apoptosis, DNA repair, Cell differentiation (Barak et al., 1993; Wu et al., 1994). The cyclin G1 and G2 are the unique among the cyclin family that interact with the phosphatase PP2A (Bennin et al., 2002; Okamoto et al., 2002; Okamoto et al., 1996). It was also demonstrated the association of Cyclin G1 with cdk5 in vivo in mice (Kimura et al., 2001).
34 D. melanogaster has only one Cyclin G (Salving et al., 2008;
Gildea et al., 2000) expressed ubiquitously during the development. The silencing of Cyclin G by RNA interference showed a high lethality demonstrating that this gene is essential for this stage. The Cyclin domain of Drosophila Cyclin G is very similar to the vertebrate Cyclin G1 and G2, showing and identity of 42% and 46% respectively. Than it was demonstrated that Cyclin G interacts with Widerborst (WDB), the regulatory subunit of PP2A such as with different Cdks including Cdk2 and Cdk4 (Giot et al., 2003;
Stanyon et al., 2004).
3.3. Cross-talk between stress response pathways
Increasing evidence showed that different stresses response pathways evoked by stresses are regulate independently as well as co-ordinately, as a network of interlinked pathways (de Pomerai et al., 2008; Kourtis and Tavernarakis, 2011), (Fig. 3.10.).
35
Fig. 3.10. Schematic representation of key aspects of the cellular stress response (CSR) and its interaction with the cellular homeostasis response (CHR). The CSR serves to restore macromolecular integrity and redox potential that are disturbed as a result of stress. In contrast, the CHR serves to restore cellular homeostasis with regard to the particular environmental variable that has changed. Both types of cellular responses to environmental change are interconnected at numerous levels (Kültz et al., 2005).
Organisms respond to endogenous metabolic requests as to many exogenous stresses as heat, cold, chemical toxicants ionizing radiation, primarily at cellular level, the fundamental unit of biological organization, through cellular stress response (CSR) through the cellular stress response pathways to limit cellular damage maintaining or re-establishing the cellular homeostasis (Simmons et al., 2009).
The CSR is considered the “guardian” of cellular homeostasis, it is more complex and involves many proteins (Kültz et al., 2005) to restore the homeostasis. Afterward it is important identify the link proteins that coordinate and regulate this cross- talk (Amanda et al., 2009).
36 Nowadays many genes involved in the CSR have been
identified, but a lot of gaps remain to be clarify for their precise functions and interaction with other genes of CSR pathways (Kültz et al., 2003).
3.4. Wolbachia host manipulation on many pathways
Wolbachia are intracellular bacteria belonging to the order of Rickettsiales, comprising eight different supergroup (A-H) (Casiraghi et al., 2005) with mutualistic, commensal and parasitic relationship with the host. It is the most widespread endosymbiotic maternally transmitted α- proteobacteria found in arthropods infecting the 76% of all insect species (Werren et al., 2008). In nature, the Wolbachia infection is not perfect, than these bacteria have adopted same mechanisms to manipulate host reproduction as male killing, male feminization, parthenogenesis and cytoplasmic incompatibility ( Hoffman et al., 1998; Bourtzis et al., 1998;
Poinsot et al., 2003; Bossan et al., 2011).
It was demonstrated that Wolbachia infection influences the expression of genes involved in metabolism, immunity and reproduction in D. melanogaster (Zheng et al., 2011) (Fig 3.11.).
37
Fig. 3.11. Pie chart representation of gene ontology for genes differentially expressed in microarray analyses according to biological process (a, b), molecular function (c, d) and cellular component (e, f). Gene expression in Wolbachia-infected larval testes was compared to uninfected larval testes of Drosophila melanogaster and the criterion for differential expression was ≥1.5 fold changes with a q-value of <5% (Zheng et al., 2011)
Despite the great importance of the interaction between Wolbachia and cell symbiosis, the influence of Wolbachia on cellular stress response pathways has not yet been investigated. Moreover the infection is responsible of the reduction of sperm and eggs production (Snook et al., 2000;
Hoffman et al., 1990). Some Wolbachia strain cause lesser eggs deposition and short life (Fry et al., 2002).
Wolbachia is also found in nematodes many of which are pathogenic for humans. These nematodes have an obligate relationship with Wolbachia and its removal causes the
38 nematodes development inhibition and death of the host (Rao
et al., 2002; Chirgwin et al., 2003; Volkmann et al., 2003).
Recently, emerged the capability of Wolbachia infection to inhibit the Dengue virus in Aedes aegypti (Fig. 3.12.).
Fig 3.12. a) Effect of Wolbachia endosymbiotic bacteria on the ability of Drosophila to
resist infection. Recent studies have shown that the presence of Wolbachia strain wMel in Drosophila melanogaster confers resistance to infection by various RNA viruses (Drosophila C Virus, Flock House Virus, and Nora virus) (Teixeira et al., 2008), but not by intracellular bacterial pathogens (Salmonella typhimurium and Listeria monocytogenes) (Rottschaefer and Lazzaro, 2012) or parasitoid wasps (Leptopilina boulardi)(Martinez et al., 2012).b) Influence of Wolbachia endosymbionts on inhibition/reduction in transmission capacity as well as protection of mosquitoes against infection. Aedes aegypti mosquitoes transinfected with the Wolbachia strain wMelPop are protected from infection by pathogenic bacteria (Erwinia carotovora) (Kambris et al., 2009), viruses (dengue and Chikungunya) (Moreira et al., 2009), malaria parasites (Plasmodium gallinaceum) (Moreira et al., 2009), and parasitic filarial nematodes (Brugia pahangi) (Kambris et al., 2009) (Eleftherianos et al. 2013).
It is a promise in the field of the pest and of the disease vector control. (Hoffmann et al., 2011, Walker et al., 2011).
Hence, despite the great importance of the interaction between Wolbachia and cell symbiosis, the influence of Wolbachia on cellular stress response pathways has not yet been investigated.
a) b)
39
3.5. Health and environmental implications
Temperature is a physical variable that influences the distribution, the abundance of all specie (Cossins and Bowler, 1987). Always the environmental changes have influenced the evolution of life. In addition, the human activities continue to threaten the health of the biosphere with heavy impact on natural ecosystems.
From the ecological point of view, all trophic levels from plant to insect were affected by climatic change causing the destabilization of population dynamics that can lead to the extinction of the organism (van derPutten, 2004). As regards ectotherms, the temperature affects their distribution, the survival, the development and the growth, in addition to physiological and metabolic processes (Sinclair et al., 2003).
Therefore, it is important to better understand the mechanism of cells and organisms adaptation to environmental stress (Kültz et al., 2003), and to investigate on the mechanisms of stress response to cope to environmental health problems, to allow the basis for toxicological risk assessment, and to use bioindication processes monitoring the global environmental change (Kültz et al., 2005).
Moreover the study on cellular stress response, one of the most conserved pathway between all organisms, can lead implication on health problems elucidating the involvement of candidates’ genes and proteins involved in the CSR,
40 because many disease are caused by dysfunction of the
normal function of pathway.
3.6. Model organism
The Insecta are a class belong to the phylum of Arthropoda that is the greatest of all animal group in the word that constitute the 5/6 of all animal kingdom. The Drosophila melanogaster Meigen 1830, also know fruit fly, belonging to the family of Drosophilidae. In D. melanogaster was discovered for the first time the gene structure by the Nobel Prize Lewis in 1994; Weischaus and Nussllein- Volhard discovered many genes implicated in genetic development and embryogenesis. Moreover the D.
melanogaster has its genome sequenced. It is constituted of about 14000 genes on four chromosomes: three autosomal chromosomes and the XY sex chromosomes in which the Y determine the male sex.
Otherwise its nucleotides and proteins sequence shows an identity of 40%, while the functional domain arrive at 80- 90% of shared identity with mammals. All these reason make the D. melanogaster the model organism most commonly used in different research area considering the brief live cycle that pass from the eggs, the larva, the pupa, and the adult stages in 14 days at 25 °C; its low cost maintenance, and its
41 high productivity also. In fact a single mate can produce 400
hundred of eggs (Pandey and Nichols, 2011).To study the cellular stress response (CSR) the ideal model organism choosed is the fruit fly, for its small set stress response gene translated in a more simple CSR network (de Pomerai et al., 2008).
42
4. Aims
43 The research project carried out during my PhD thesis was
focused on the activation of cellular stress response (CSR) after cold stress in Drosophila melanogaster, by monitoring the expression levels of Heat-shock-protein-70Aa (Hsp70Aa), Autophagy related gene-1 (Atg1), X-binding protein-1 (Xbp1) genes, respectively involved in the heat shock response, in the autophagy and in the endoplasmatic reticulum unfolded protein response. In particular, we focused on the effect of Cyclin G (CycG) and cyclin- dependent kinase 5 (cdk5) in the transcriptional activation of Hsp70Aa after cold stress. Moreover to study the possible involvement of Wolbachia infection on the CSR in the infected insects and to investigate also on the effects of the cold stress on Wolbachia infection, we monitored Wolbachia surface protein (wsp) gene expression upon different protocols of cold stress and recovery periods.
44
5. Materials and methods
45
5.1. Fly culture
Drosophila melanogaster Oregon R-C, a Wolbachia infected wild-type line, was obtained from Bloomington Drosophila Stock center, Indiana University. Flies were reared in 42 ml bottle at 25 °C a 12/12 h light-dark cycle. Standard medium was prepared with sugar (1.6%), yeast (3.2% w/v) and agar (3.2%) as just indicated by Colinet et al., 2009, with cornmeal (1.6%) and 2.5 g/l of Methyl 4-hydroxybenzoate.
5.2. Antibiotic treatment
To obtain genetically identical Wolbachia free D.
melanogaster line (W-) from the Wolbachia D. melanogaster infected stock (W+), a pool of males and females flies were isolated on standard medium to which was added 0.25 mg/ml tetracycline antibiotic (Fry et al., 2004). The treatment was carried out for two generations.
The obtained D. melanogaster Wolbachia-free line was then maintained on standard medium to ensure the full recovery of the flies after the antibiotic treatment (Fry et al., 2004).
46
5.3. DNA extraction
To confirm that Wolbachia was cleared from treated D.
melanogaster, DNA was extracted as described by Bouneb et al., 2014.
Briefly, for theDNA extraction 4 days old virgin females treated with antibiotic and untreated, were individually homogenized with a pestle in a 1.5 mL tube containing 100 µL of 6%
InstaGene™ Matrix (Bio-Rad) and 10 µL of Proteinase K solution 20 mg/ml (5 PRIME). Samples were incubated at 56 °C for 30 min then vortexed at high speed for 10 s and boiled at 100
°C for 8 min. After the samples were centrifuged at 13000 rpm for 3 min. 5 µL of the supernatant was used to perform the wsp gene amplification, a gene coding for a protein surface of Wolbachia using wsp primers indicated by Braig et al., 1998.
5.4. RNA interference
RNA interference (RNAi) mediates gene silencing (Fire et al., 1998) through the formation of dsRNA-specific (dsRNAs) transformed to 21-23 bp dsRNAs called siRNAs through an enzyme named DICER (Bernstain et al., 2001). Finally the siRNAs mediates the degradation of complementary mRNA (Zamore et al., 2000) resulting in the knockdown of gene expression.
47 The GAL4/UAS system is commonly used for the analyses gain of function phenotypes. Combining this method with the RNA interference (RNAi) technique, became a powerful tool to study loss of function phenotypes (Duffy et al., 2002) to inactivate gene expression.
The Bloomington Stock center has a big Flies list that express GAL4 driver. The GAL4 drivers regulates gene transcription through the binding of Upstream Activating Sequences (UAS) elements (Duffy et al., 2002). In D. melanogaster was demonstrated that GAL4 regulates the expression of the gene reporter under UAS control (Fisher et al., 1988). The GAL4 and UAS sequences are present in two different lines and the silencing of the target gene became feasible after the cross of GAL4 driver line and UAS line that containing the target gene, in the progeny.
Fig. 5.1. RNAi mediated by GAL4/UAS system: GAL4/UAS was used to produces an hairpin RNA that was processed by DICER enzyme becoming siRNAs that evokes the degradation of a specific mRNA target.
48 Few studies used RNA interference (RNAi) to understand how genes respond to cold stress (Rinehart et al., 2007).
To study the possible involvement of the cdk5.gene in the activation of stress response by cold stress, the cdk5 was silenced trough RNAi techique using the GAL4/UAS system (Brand and Perrimon, 1993). Two UAS-cdk5 lines were obtained from Bloomington, Indiana University (ID 27517; ID 35287). Daughterless GAL4 line (coming from laboratory of prof. Giordano, department of Genetics, Federico II, Naples) was used as driver line resulting in general down-regulation of cdk5 gene. UAS females of both lines were crossed with GAL4 males. The F1 was tested to verify the knockdown of cdk5.
5.5. Cold stress and recovery treatment
Cold stress treatments were performed on three groups, each one of 20 individuals of synchronized 4 days old virgin flies of both sex. They were sexed without CO2 anesthesia because it can influence the stress recovery (Nilson et al., 2006).
To induce the chill coma, the cold stress treatments were performed at 0° C in CH-100 heating/cooling block (Biosan) using 0.5 ml tubes immersed in 10% of glycol solution precooled. Knowing the timing of cold stress in which there is not flies mortality (Colinet et al., 2009), it were considered: 30 min (S30), 2h (S2h), 4h (S4h), 6h (S6h), 9h (S9h) of stress at 0
49
°C. After the cold stress flies were divided in two group: a group was recovered at 25 °C with standard food (RF) for: 30 min (R30), 2h (R2h), 4h (R4h), 6h (R6h), 8h (R8h) while another group was recovered without food (RA) for the same time, in medium containing only 1% agar as water source. The recovery phases were evaluated in presence or in absence of food to exclude any effect of deprivation of food on genes expression.
For every time there was a corresponding control at 25 °C. After the treatments flies were transferred to 2 ml cryogen tubes and snap-frozen in liquid nitrogen ad stored at -80 ° C until RNA and protein extraction
.
5.6. RNA extraction
RNA extraction was performed using the PureLink® RNA Mini Kit (Life technologies™) following the manufactures protocol. Every sample was:
- Homogenized on ice in fresh lysis buffer with 1% of 2- mercaptoethanol with a pestle in a 1.5 ml tube.
- Centrifugated at 2,600 x g for 5 min at room temperature (RT).
- The supernatant was transferred to a fresh RNAse free tube.
1. 0.5 volume 96-100% ethanol was added to each volume of tissue homogenate.
2. Mixed through shaking to disperse any visible precipitate that may form after the addiction of ethanol.
50 3. Up to 700 µl were transferred to a Spin Cartridge with the Collection Tube.
4. Centrifuged at 12,000 x g for 2 min at RT. Discarded the flow-through, and reinserted the spin cartridge in the same Collection Tube.
5. Repeated the step 3-4 until the entire sample was processed.
6. 700 µl of Wash Buffer I was added to the Spin Cartridge.
Centrifuged at 12,000 x g for 15 sec at RT. The flow-through was discarded with the Collection Tube. The Spin Cartridge was placed in a new Collection Tube.
7. 500 µl of Wash Buffer II with ethanol (300 ml of 96% of ethanol were added when the Wash Buffer II was opened for the first time) was added to the Spin Cartridge.
8. Centrifuged at 12,000 x g for 2 min at RT. The flow-through was discarded and the Spin Cartridge was reinserted in the same Collection Tube.
9. The 7-8 steps were repeated once.
10. The Spin Cartridge was centrifuged with the Collection Tubes at 12,000 x g for 1 min at RT to dry the membrane with attached RNA. The Collection Tube was discarded. The Spin Cartridge was inserted into a Recovery tube.
11. 20 µl of RNase-Free Water was added to the center of Spin Cartridge and incubated for 2 min at RT.
51 13. The Spin Cartridge was centrifuged at 12,000 x g for 2 min at RT.
14. RNA extracted was stored or just processed with DNase treatment.
5.7. DNase treatment
Each sample was processed by TURBO DNA-free™ Kit (Life technologies) following the manufacture instructions.
1. 0.1 volume of 10X TURBO DNase Buffer and 1 µl TURBO DNase was added to the RNA and mixed gently.
2. Sample was incubated in a termoblock at 37 °C for 30 min.
3. 0.1 volume of DNase inactivation Reagent was added and mixed very well.
4. Sample was mixed occasionally during the 5 min of incubation at RT.
5. Sample was centrifuged at 12,000 for 2 min and RNA was transferred to a fresh tube avoiding to uptake the inactivation buffer on the bottom of the tube.
RNA purified was quantized by Qubit® 2.0 fluorometr with Qubit® RNA Assay kit. For each quantification it was prepared a Qubit™ Working Solution with 1 µl of Qubit™ Reagent in addition to 199 µl of Qubit™ Buffer. It were used 10 µl of each Standards provided by kit and 190 µl of the working solution to build the calibration line. 1 µl of every sample and 199 µl of
52 Qubit™ Working Solution were used for sample quantification, mixed for 3 s and after 2 min it was proceed to the RNA quantification.
5.8. Reverse transcription and PCRs reactions
300 ng of total RNA was used for the reverse transcription using SuperScript® VILO™ cDNA Synthesis Kit following the manufacturer’s protocol.
1. For every reaction, were combined the following components in a tube on ice. For multiple reaction were prepared a master mix without RNA.
5X VILO™ Reaction Mix
10X SuperScript® Enzyme Mix
RNA (up to 2.5 µg)
DEPC-treated water
2. The tube contents were mixed gently and incubated at 25
°C for 10 min.
3. Follow an incubation at 60 °C of 60 min.
4. The reaction terminate at 85 °C for 5 min.
5. cDNA was stored at -20 °C until use and diluted 10 fold for the PCR and quantitative PCR (qRT- PCR) .
The coding sequences of Cyclin G (cycG); cyclin- dependent kinase 5 (cdk5); Autophagy-related gene-1 (Atg1), Heat shock factor (Hsf) and X box binding protein-1 (Xbp1), were retrieved
53 from Flybase (http://flybase.org/). The CycG and the Hsf genes showed multiple transcripts so only the common sequences were considered for the primers design. The primers for the Heat- shock-protein-70Aa (Hsp70Aa) and Ribosomal protein S20 (Rps20) were the same of Colinet et al., 2009. All primers sequences are reported in table 1.
Primer name
Primers Sequences (5’ 3’) Tempera ture of melting [°C]
CycG_F GCCCGATCAACCGCTTCTCC 63.5
CycG_R GGGTGAAGTGGGCCAGTCC 63.1
cdk5_F GCCTCAACGGGGAGATCGACA 63.7
cdk5_R GGTTCTGTGGTTTCAGATCGCG 62.1
Hsf_F CGATGCCGATACCAATCGCTT 59.8
Hsf_R AGCTGGCCATGTTGTTGTGC 59.4
Hsp70Aa_F TCGATGGTACTGACCAAGATGAAGG 63.0
Hsp70Aa_R GAGTCGTTGAAGTAGGCTGGAACTG 64.6
Rps20_F CCGCATCACCCTGACATCC 61.0
Rps20_R TGGTGATGCGAAGGGTCTTG 59.4
Wsp_F TGGTCCAATAAGTGATGAAGAAAC 52.3
Wsp_R AAAAATTAAACGCTACTCCA 43.6
Xbp1_F GGATGACGATAACATGGCTG 57.3
Xbp1_R TCTCGTAGTCCATCTCCTCCAT 60.3
Atg1_F GGGTTTGCGCGATTCCTG 58.2
