CHAPTER 3: Role of GPR17 in neuron survival and
differentiation: the PC12 cell model
As already reported in CHAPTER 1, GPR17 seems to be normally present in neurons (Ciana et al., 2006; Lecca et al., 2008), although in a recent report, Chen et al (Chen et al., 2009) failed to find expression of GPR17 in neurons of adult mouse brain under basal physiological conditions.
Moreover, it has been demonstrated that in the first phase of brain injury, GPR17 expression dramatically increases in neurons, which, within 24 h from injury, undergo to death. It may well be that GPR17 participates to neuronal specification during development, is turned down during adulthood and is then re-activated under disease conditions, when endogenous reparative neurogenesis is switched on, as suggested by markedly increase neuronal expression of GPR17 in the ischemic rat and mouse brain (Ciana et al., 2006; Lecca et al., 2008). However, very little is known on the role of GPR17 in neurons, both under physiological and pathological conditions. In this context, the availability of a cellular model to study “in vitro” the mechanisms of neuronal differentiation and neuronal survival/death processes assumes great importance in shedding light on the role of GPR17 in physiological neuronal function and in brain damage progression. In this chapter, rat pheocromocytoma cells, a well established model to study cell differentiation or survival upon addition of growth factors, were adopted to examine whether GPR17 could play a role in the mechanisms of neuronal differentiation and in neuronal survival/death processes.
Experimental section
Introduction
Rat pheocromocytoma cells (PC12), a well characterized cell model, has been used for many years to study neuronal differentiation upon addition of growth factors, such as nerve growth factor (NGF, Greene et al., 1976). NGF activates intracellular signal transduction pathways that induce neurite outgrowth and differentiation of these cells into post-mitotic cells sharing many properties with sympathetic neurons (Qu et al., 1998; Kaplan et al., 2000; Kim et al., 2004).
In the absence of NGF and in the presence of serum, PC12 cells maintain their proliferation properties, while in the absence of serum and deprived of trophic factors they undergo apoptotic death. The addition of NGF blocks such death and moreover induces cell differentiation (D’Ambrosi et al., 2004).
In PC12 cells, NGF regulation of differentiation and survival has been shown to activate both extracellular signal regulated kinases (ERKs) and p38 mitogen activated protein kinases (MAPK) (Morooka et al., 1998; Chao 2003; Kim et al.,2004). PC12 cells have been also used to study the functional cross-talk between extracellular nucleotides and growth factors in the regulation of neurotrophin signalling. In detail, it has been demonstrated that both adenine and uracil nucleotides, released from synaptic vesicles at mM concentrations, enhance NGF-mediated neurite outgrowth, suggesting a role for P2YRs in neuronal development and regeneration. Through the activation of P2Y2Rs, ATP promotes ERK and p38 stimulation thereby enhancing sensitivity to NGF and accelerating neurite formation (Arthur et al., 2005); in addition, also uridine increases neurite outgrowth and branching in NGF-differentiated PC12 cells with a mechanism which involves the activation of P2YRs (Pooler et al., 2005).
In our PC12 cell model, RT-PCR analysis, carried out using primers specifically designed for the various cloned P2YRs, revealed bands corresponding to the expected amplification products for P2Y2, P2Y4, P2Y6, P2Y12, P2Y13 and P2Y14 receptors. No differences were observed between undifferentiated and NGF-differentiated PC12 cells, suggesting these P2YRs are constitutively expressed in this cell line and do not undergo modulation following NGF treatment. No amplification product was observed using
A weak amplification product of CysLT1R was observed in both undifferentiated and differentiated PC12 cells; on the contrary, endogenous mRNA expression of CysLT2R was not observed. These data are in part in contrast with Sheng et al. (Sheng et al., 2006), who reported endogenous mRNA expression for both CysLTRs in PC12 cells, with the CysLT2R being expressed at even higher levels with respect to the CysLT1R. This difference can be due to the ability of PC12 cells to spontaneously change their phenotype in culture, when cultured with differentiating factors (Greene et al., 1987). In undifferentiated PC12 cells, no amplification products were observed with the specific primers for GPR17 (610 bp) as compared to positive control (rat brain). The expression of this receptor appeared only after 10 days of cell differentiation induced in vitro by NGF, demonstrating that the expression of GPR17 mRNA is selectively induced during the process of PC12 cell differentiation to neuronal cells.
In the present study, we adopted PC12 cells, a well established model to study cell differentiation or survival upon addition of growth factors, to examine whether GPR17 could play a role in the mechanisms of neuronal differentiation and in neuronal survival/death processes. In detail, we investigated the effects of GPR17 activators, in sustaining the survival of PC12 cells and/or in modulating cell differentiation. Furthermore, intracellular pathways, involved in GPR17-mediated cell viability/differentiation, such as ERKs and p38, were investigated.
Methods
Cell culture. PC12 cells were maintained in RPMI 1640 medium supplemented with 10% horse serum, 5% fetal bovine serum, 2mM L-glutamine and penicillin/streptomycin in humidified atmosphere (5% CO2) at 37 °C. Cells were differentiated for 5 and 10 days in medium containing 100 ng/ml mouse NGF, in the absence or in the presence of GPR17 ligands. In parallel experiments, PC12 cells were treated for 10 days with 100 ng/ml epidermal growth factor (EGF) in the absence or in the presence of NGF or GPR17 ligands. PC12 cells that were not exposed to NGF are called undifferentiated.
Following incubation time, cell viability was determined using the MTS assay according to manufacturer's instruction. The dehydrogenase activity in active mitochondria reduces 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxy methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) to the soluble formazan product. The absorbance of formazan at 490 nM was measured in a colorimetric assay with an automated plate reader. In some experiments, the effects of GPR17 antagonists on agonist mediated effects were evaluated. In particular we used the adenosine based P2Y12–13R antagonist cangrelor (formerly AR-C69931 MX) and the CysLT1R antagonist 2-[2-[(3R)-3-[3-[(E)-2-(7-chloroquinolin-2-yl)ethenyl]phenyl]-3-sulfanylpropyl]phenyl]propan-2-ol (montelukast) that have been previously characterized and demonstrated to have an high affinity for GPR17 (Ciana et al., 2006; Lecca et al., 2008). The antagonists were added for 5 min prior to addition of UDP-glucose and LTD4 respectively in order to determine the inhibition of agonist-mediated cell viability. Within an experiment, each condition was assayed in triplicate and each experiment was performed at least three times. The results were calculated by subtracting the mean background from the values obtained from each test condition and were expressed as the percentage of the control (untreated cells).
RNA interference. After 10 days of differentiation, PC12 cells have been transfected with a siRNA specifically designed for the silencing of the rat receptor GPR17 (Qiagen): CCGTATAGAGAAGCACCTCAA (target sequence).
The siRNA has been transfected with Lipofectamine RNAiMAX reagent (Invitrogen) to a final concentration of 50 nM per well, following the manufacturer's protocol. In parallel to each silencing experiment an ineffective sequence of RNA has been used as negative control (Qiagen). Cell viability has been evaluated 48 h after siRNA transfection.
Measurements of neurite outgrowth. PC12 cells were plated at 60% confluency on poly-D-lysine-coated plates. After 24 h, cells were treated for different times (2–10 days) with 100 ng/ml NGF, or 100 ng/ml EGF, or 10 µM UDP-glucose, or 100 nM LTD4. In some experiments, cells were treated with the growth factors in the presence of UDP-glucose or LTD4. Pictures of living cells were taken at days 2, 5, and 10; for each condition, 3 different wells were analyzed, and for each well 5 frames were
D'Ambrosi et al., 2000). In particular, neurite-bearing cells were scored under the microscope, and only processes longer than 20 µm were considered neurites. A positive score requires the presence of at least one neurite/cell. Cells that could not be discerned because of their high state of aggregation (clumps) were excluded from the score. Data on neurite-bearing cells were expressed as percentage of total cell number set to 100%. In addition, neurite length was measured using Image J (public image processing program, National Institute of Health).
ERK 1/2 and p38 phosphorylation assays. Undifferentiated and NGF-differentiated (10 days) PC12 cells were cultured in 96-well microplates and treated with 1 µM UDP-glucose or 5 nM LTD4 for different times (5–120 min). The ERK 1/2 or p38 activation was assessed by Fast Activated Cell-based ELISA Kits following the manufacturer's instruction. Following stimulation, the cells were rapidly fixed to preserve activation of specific protein modification. Each well was then incubated with primary antibody that recognized phosphorylated ERK 1/2 or p38. Subsequent incubation with secondary HRP-conjugated antibody and developing solution allowed a colorimetric quantification of phosphorylated ERK levels. The relative number of cells in each well was then determined using Crystal Violet solution. The results were calculated by subtracting the mean background from the values obtained from each test condition and were expressed as the percentage of the control (untreated cells).
Data analysis. Each experiment of MTS assay, morphology assay, ERK 1/2 and p38 phosphorylation was repeated on the last three times and the data are expressed as mean ± SEM of three independent experiments performed in duplicates. Experimental groups were compared with the controls which consisted in the same number of cell, but treated with any drugs. Student's t-test was used to evaluate whether differences between the experimental groups and the control were statistically significant.
Results and Discussion
Effect of GPR17 ligands on PC12 cell viability. In order to evaluate the role of GPR17 in neuronal survival, we investigated the effects of GPR17 receptor activators (purinergic and cysLT derivatives) on the viability of undifferentiated and NGF differentiated PC12 cells. In undifferentiated cells, neither the uridine derivative UDP-glucose (100 nM–10 µM) nor the cysLT derivative LTD4 (1 nM–50 nM) induced any significant effect on cell viability. After 5 days of NGF-induced PC12 cell differentiation, neither UDP-glucose nor LTD4 were able to increase cell viability with respect to control cells (Fig. 1, panel B). These results demonstrate that, at an early stage of cell differentiation, when the receptor expression is low (no detectable mRNA), GPR17 ligands do not show any functional effect. The same experiments were also performed following 10 days of cell differentiation. At this stage, both UDP-glucose and LTD4 significantly increased cell viability with respect to untreated differentiated PC12 cells. This effect was concentration-dependent for both ligands, with a maximum at 1 µM for UDP-glucose and at 5 nM for LTD4 (Fig. 1, panel C).
Since PC12 cells express CysLT1R and various P2YRs, including the uridine sugar nucleotide sensitive P2Y14R, we performed additional experiments to evaluate the specificity of GPR17 ligands. To determine whether UDP-glucose and LTD4 effects could be selectively ascribed to GPR17 activation, we decided to treat cells with different concentrations of GPR17 antagonists (i.e., cangrelor and montelukast) in the presence of the agonist concentration at which we observed the maximum enhancement on cell viability (1 µM for UDP-glucose and 5 nM for LTD4).
Fig. 1. Effect of GPR17 ligands on cell viability of NGF-differentiated PC12 cells. PC12 cells were treated in the absence (undifferentiated, panel A) and in the presence (differentiated) of 100 ng/ml NGF for 5 (panel B) or 10 (panel C) days. Then, cells were treated with UDP-glucose (100 nM-10 µM) or with LTD4 (1 nM-50 nM) for 24 hours and cell viability
was measured using MTS assay. Data are expressed as percentage respect to untreated cells (control) set to 100% and they are the mean ± SEM of three independent experiments performed in duplicates. Statistical analysis was performed using Student’s t- test (*p<0.05; **p<0.01 vs control).
As depicted in Fig. 2, cangrelor, an antagonist of the purinergic binding site on GPR17, was able to counteract cell viability increased by 1 µM UDP-glucose, in a concentration-dependent manner, with half-maximal inhibition (IC50) value in the nM range, comparable with that obtained by [35S]GTPγS binding assay (performed in 1321N1 cells transfected with rat GPR17 (Ciana et al., 2006). These results suggest that UDP-glucose-induced effects are likely mediated by GPR17.
Fig. 2. Effect of GPR17 antagonist, cangrelor, on cell viability of NGF-differentiated PC12 cells. PC12 cells were treated in the presence (differentiated) of 100 ng/ml NGF for 10 days. Then, cells were treated for 24 hours with 1µM UDP-glucose in the presence of cangrelor (0.0044-0.22 nM) and cell viability was measured using MTS assay. Data are expressed as percentage respect to untreated cells (control) set to 100% and they are the mean ± SEM of three independent experiments performed in duplicates.
Cangrelor alone did not induce any significant effect on cell viability (data not shown); on the contrary, montelukast, an antagonist of the leukotriene binding site on GPR17, induced itself a significant reduction of PC12 cell viability, suggesting a toxic effect. In order to evaluate whether montelukast-induced toxicity was a non specific off target effect or was related to a possible action on GPR17, the effect of 2 µM montelukast on PC12 cell viability was evaluated in both undifferentiated and differentiated PC12 cells after GPR17 silencing with specific small interfering RNAs (see also below). Results demonstrate that, in undifferentiated PC12 cells, in which no significant GPR17 mRNA levels were detected, montelukast also induced a significant impairment of cell viability with respect to control untreated cells (Fig. 3). A comparable result was obtained in NGF-PC12 differentiated cells, after GPR17 silencing. Globally, these data demonstrate that, in our experimental setting, montelukast effects are not due to interaction with GPR17, but to an off target non specific toxic effect. Due to this unexpected result, the antagonistic properties of this compound towards LTD4-mediated increase of cell viability could not be evaluated.
Fig. 3. Effect of montelukast on PC12 cell viability. Undifferentiated (N), NGF-differentiated (D, -siRNA) and NGF-NGF-differentiated/GPR17-silenced (D, +siRNA) PC12 cells were treated with 2 µM montelukast for 24 hours and cell viability was measured using MTS assay. Data are expressed as percentage respect the untreated cells (control) set to 100% and they are the mean ± SEM of three independent experiments performed in duplicates. * p< 0.05, Student’s t- test.
In addition, to unequivocally prove a role for GPR17 in PC12 cells survival, the same experiments were performed in PC12 differentiated cells following silencing of the receptor upon incubation of cells with small interfering RNAs. The silencing efficiency of GPR17was evaluated by RT-PCR experiments, showing a significant decrease of the receptor transcript in the siRNA transfected cells compared to the control cells transfected with negative RNAs (Fig. 4A, experiment performer in collaboration with Davide Lecca, University of Milan).
Results (Fig. 4B) demonstrate that, after GPR17 silencing, in differentiated PC12 cells, the receptor agonists UDP-glucose and LTD4 did not induce any effects on cell viability with respect to control untreated differentiated cells. These results confirm that the effects of these ligands are indeed due to the selective activation of the GPR17 receptor.
Fig. 4. Effect of GPR17 ligands on cell viability of NGF-differentiated PC12 cells following GPR17 silencing. Panel A: RT-PCR experiments showed a weak expression of GPR17 after transfection with a specific siRNA, compared to cells transfected with a negative RNA (neg). A positive control (total brain) and negative controls (-RT) have been included. Panel B: Control and GPR17-silenced PC12 cells were differentiated with 100 ng/ml NGF for 10 days. Then, cells were treated with UDP glucose (100 nM-10 µM) or with LTD4 (1 nM-50
nM) for 24 hours and cell viability was measured using MTS assay. Data are expressed as percentage respect the untreated cells (control) set to 100% and they are the mean ± SEM of three independent experiments performed in duplicates. Statistical analysis were performed using Student’s t-test (*p<0.05; **p<0.01 vs control; #p<0.05; ##p<0.01 vs agonist-treated cells).
Effect of GPR17 agonists on PC12 neurite outgrowth. In order to evaluate the role of GPR17 in neuronal differentiation, we performed a morphology study by assessing the effects of GPR17 receptor activators (purinergic and cysLT derivatives) on neurite outgrowth.
Undifferentiated PC12 cells did not sprout neurites (fewer than 1%). NGF-differentiated cells produced neurites with a peak after 10 days of treatment in vitro. In undifferentiated PC12 cells the addition of the GPR17 ligands, UDP-glucose or LTD4, promoted extensive neurite outgrowth and the percentage of neurite-bearing cells reached a pick after ten days of treatment. NGF-differentiated cells exhibited a significant enhancement of neurite-bearing cells when concomitantly exposed to UDP-glucose or LTD4 for five days, suggesting a synergic effect between the growth factor and GPR17 ligands in mediating PC12 cell differentiation. On the contrary, no synergic effect was observed following ten days of treatment, when the effect of each single ligand is maximal (Fig. 5, panels A and B).
We then examined the neurite elongation effect induced by EGF, utilized either alone or in combinations with either NGF, or UDP-glucose or LTD4. Results demonstrated that EGF alone did not stimulate neurite outgrowth, as previously shown (Mark et al., 1995); on the contrary, when EGF was utilized in the presence of either NGF, UDP-glucose or LTD4, PC12 cells displayed a significant increase in the number of neurite-bearing cells (Fig. 6), suggesting the predominance, under these treatment conditions, of the differentiation pathway with respect to proliferation.
Fig. 5. Effect of GPR17 agonists on neurite outgrowth. Panel A: PC12 cells were treated for 2-10 days with medium alone (A) or 100 ng/ml NGF (B), or 10 µM UDP-glucose (C), or 100 nM LTD4 (D), or 100 ng/ml NGF in the presence of UDP-glucose (E) or LTD4 (F).
Representative micrographs after 10 days of treatment of each PC12 cultures are shown. Panel B:. neurite-bearing cells were scored after 2, 5 and 10 days . Counts were expressed as percentage of total cell number (set to 100%) and represent the mean ± S.E.M. of three
Fig. 6. PC12 cells were treated for 10 days with 100 ng/ml EGF in the absence or in the presence of 100 ng/ml NGF, or 10 µM UDP-glucose, or 100 nM LTD4, as indicated.
Neurite-bearing cells were scored after 10 days as above reported.
Phosphorylation of ERK 1/2 by GPR17 ligands in NGF-differentiated PC12 cells. In order to dissect the possible molecular mechanisms involved in GPR17-mediated pro-survival effects, phosphorylation of ERK 1/2 protein kinases was investigated. In undifferentiated PC12 cells the GPR17 activators UDP-glucose (1 µM– 10 µM) and LTD4 (5 nM– 50 nM) did not induce any significant stimulation of ERK activation with respect to control untreated cells (Fig. 7, panel A). When cells underwent differentiation for 10 days, UDP-glucose and LTD4, tested at the concentration at which they maximally enhanced cell viability (1 µM for UDP-glucose and 5 nM for LTD4), caused a significant increase in ERK 1/2 phosphorylation (Fig. 7, panel B). This effect occurred in a time dependent manner with a maximum after 15 min of cell exposure to agonists. As evident in Fig. 7 panel B, ERK activation induced by the two agonists occurred with a different kinetics: LTD4 induced a transient ERK activation that returned to basal value within 120 min. On the contrary, ERK phosphorylation induced by UDP-glucose was maintained over basal values for 120 min and the activation kinetics appeared to be biphasic with two peaks, one at 15 and the other one at 120 min. In addition, incubation of cells with the purinergic antagonist cangrelor, completely counteracted UDP-glucose effects at all tested incubation times (Fig. 7, panel B). These results suggest that UDP-glucose-induced activation of ERK phosphorylation is likely mediated by GPR17.
Fig. 7. Effect of GPR17 ligands on ERK 1/2 phosphorylation in PC12-differentiated cells. PC12 cells were treated in the absence (undifferentiated, panel A) or in the presence (differentiated, panel B) of 100 ng/ml NGF for 10 days. Panel A: undifferentiated cells were treated with UDP-glucose (1-10 µM) or LTD4 (5-50 nM) for 15 or 120 minutes. Panel B:
Differentiated PC12 cells were treated with the agonist UDP-glucose (1 µM) in the absence or in the presence of 0.11 nM cangrelor or with LTD4 (5 nM) for different times ranging from 5 to
120 minutes. Aliquots of the cells were treated for 120 min with 0.11 nM cangrelor or 2 µM montelukast alone. Following incubation, ERK 1/2 phosphorylation was evaluated using an ELISA kit as described in method section. Data are expressed as percentage of phosphorylated ERK 1/2 with respect to untreated cells (control) set to 100% and they are the mean ± SEM of three independent experiments performed in duplicates. Statistical analysis was performed using Student’s t- test (* p< 0.05, ** p< 0.01 vs control; ##p<0.01, ### p< 0.001 vs agonist alone).
Phosphorylation of p38 by GPR17 ligands in NGF-differentiated PC12 cells. Finally, we investigated the effects of GPR17 ligands on the p38 kinase pathway that has been described as a differentiation signal in PC12 cells (Morooka et al., 1998). In undifferentiated cells, both UDP-glucose (1–10 µM) and LTD4 (5–50 nM) did not induce any significant effect on p38 phosphorylation (Fig. 8, panel A).
When the cells underwent differentiation for 10 days, UDP-glucose (1 µM) and LTD4 (5 nM) caused a significant increase in p38 phosphorylation (Fig. 8, panel B). This effect occurred in a time dependent manner, with a maximum after 30 min cell exposure to agonists. UDP-glucose induced a transient p38 activation that returned to basal value within 120 min, and the activation kinetics appeared to be biphasic with two peaks at 5 and 30 min. On the contrary, p38 phosphorylation induced by LTD4 was maintained over basal values for 120 min. In addition, incubation of cells with the purinergic antagonist cangrelor completely counteracted UDP-glucose effects at all tested incubation times (Fig. 8, panel B), suggesting that UDP-glucose-induced activation of p38 phosphorylation is likely mediated by GPR17. In summary, these results demonstrate that both ERK and p38 kinases act as intracellular phosphorylative pathways in GPR17-mediated effects.
Fig. 8. Effect of GPR17 ligands on p38 phosphorylation in PC12-differentiated cells. PC12 cells were treated in the absence (undifferentiated, panel A) or in the presence (differentiated, panel B) of 100 ng/ml NGF for 10 days. Panel A: undifferentiated cells were treated with UDP-glucose (1-10 µM) or LTD4 (5-50 nM) for 30 or 120 minutes. Panel B:
differentiated PC12 cells were treated with the agonist UDP-glucose (1 µM) in the absence or in the presence of 0.11 nM cangrelor or with LTD4 (5 nM), for different times ranging from 5 to
120 minutes. Following incubation, p38 phosphorylation was evaluated using an ELISA kit as described in method section. Data are expressed as percentage of phosphorylated p38 with respect to untreated cells (control) set to 100% and they are the mean ± SEM of three independent experiments performed in duplicates. Statistical analysis was performed using Student’s t- test (* p< 0.05, ** p< 0.01, ***p< 0.001 vs control; #p<0.05, ### p< 0.001 vs
Here, we provide the first evidence in a native system that GPR17 can be indeed activated by uracil nucleotides and cysLTs. In PC12 cells undergoing neuronal differentiation, by activating specific intracellular signalling pathways, these agonists play a pivotal role in cell survival. In detail, we show that UDP-glucose, a GPR17 ligand for the uracil receptor binding site, increases cell survival with a highly specific effect. In fact: (i) UDP-glucose enhances cell survival only at stages of PC12 cell differentiation at which GPR17 mRNA were clearly detected (10 days of NGF differentiation in vitro). No effects were induced by the agonist at earlier differentiation stages when receptor expression is absent or very low; (ii) UDP-glucose effects could be completely antagonized by the P2Y receptor antagonist cangrelor, that also antagonized all GPR17-induced effects in the previously employed recombinant systems (Ciana et al., 2006; Lecca et al., 2008; Temporini et al., 2009) (iii) even more relevant, UDP-glucose- induced effects could be prevented by specifically knocking down GPR17 via small interfering RNAs. This approach led to a very marked reduction of GPR17 mRNA and to a complete obliteration of the effects of GPR17 activators on cell survival. Similar results were obtained with the leukotriene derivative LTD4, an agonist for the GPR17 leukotriene binding site. Unfortunately, we could not test the antagonistic potential of montelukast towards LTD4, since, in PC12 cells, this compound had an off target non specific effect “per se” on both cell survival and MAPK activation. The effects of montelukast on PC12 cell viability was not due to a direct interaction with GPR17, since the antagonist showed similar effects both in undifferentiated cells and in differentiated cells after GPR17 silencing. Montelukast is a potent CysLTR antagonist possessing some anti-inflammatory effects, which are due to both CysLTR antagonism and other yet-unclear mechanisms (Currie et al., 2003; Capra et al., 2006). Montelukast-induced apoptosis has been demonstrate in several other cellular populations, such as eosinophils, T lymphocytes and Jurkat cells (Spinozzi et al., 2004). In antigen-activated T lymphocytes, this phenomenon may involve inhibition of survival related genes, such as Bcl-2, with the consequent induction of apoptosis. This effect has been suggested to be related to the block of CysLT1Rs. We can't exclude that this may be true also in our hands, since CysLT1Rs are expressed both in undifferentiated and differentiated PC12 cells. Globally, our data demonstrate that both
NGF (Mark et al., 1995), even if with a lower effect. In addition, we showed the existence of a synergic effect between NGF and GPR17 agonists in mediating PC12 cell differentiation; this effect was observed only after a 5 day cell treatment, when the effect of each ligand alone was not maximal. These data are highly consistent with previous literature data. In addition to growth factors, trophic functions for extracellular purine molecules have been extensively described for both neuronal and non-neuronal cells (Neary et al., 1996; Burnstock et al., 1997). Extracellular ATP promotes the survival of PC12 cells deprived of growth factors, in a way comparable to NGF. ATP released by these cells induces the up-regulation of several P2YRs, neurotransmitter release, intracellular calcium modulation and activation of second messengers, such as MAPKs (D’Ambrosi et al., 2004). It has been established that extracellular P2YR agonists exert a direct dual effect on PC12 cells as neurotrophic agents. They can influence both survival and neuritogenesis; however, while ATP and other agonists are sufficient to substain cell viability, they are only subsidiary in promoting neuritogenesis. In the presence of sub-optimal NGF concentrations, P2YR strongly increase neurite outgrowth; in the absence of NGF, they do promote and substain durable and robust neurite regeneration, but they are not able to initiate neuritogenesis (D’Ambrosi et al., 2000; 2001; 2004). For this reason, they should be considered “propagators” rather than “initiators” of neuritogenesis. On the contrary, as demonstrated in the present work, besides affecting cell viability, GPR17 ligands promote neurite outgrowth, acting both as “propagators” and “initiators” of neuritogenesis.
Neuronal differentiation by NGF is characterized by the induction of immediate early genes that encode transcription factors that, in turn, promote the transcriptional activation of a set of NGF-responsive genes (Pellegrino et al., 2006). NGF triggers neuronal differentiation in the PC12 cell model through the activation of both ERKs and p38, two MAPKs which play a crucial role in several physiological functions, including cell proliferation, differentiation, transformation and survival (Karlsson et al., 2006). It's now clear that, in these cells, the duration and magnitude of MAP kinases signalling crucially dictates the biological outcome of growth factors by addressing cells toward differentiation or survival/proliferation pathways (Karlsson et al., 2006; Qiu et al., 2004; Stork et al., 2005). For example, NGF stimulation leads to sustained MAPK activation, resulting in cell cycle arrest and promoting neuronal differentiation, as observed by
suggested that a sustained activation of either of the two signalling pathways (the ERKs or the p38 pathway) combined with transient activation of the other or both, is critical for neuronal differentiation in PC12 cells (Morooka et al., 1998).
In line with these literature data, here we also provide evidence that GPR17 activators caused a significant increase in both ERK 1/2 and p38 phosphorylation, with a maximum effect after 15 and 30 min of cell exposure to agonists, respectively. Surprisingly, very different kinetics of activation of ERKs and p38 by UDP-glucose or LTD4, were found: the uracil nucleotide derivative induced a sustained ERK activation (maintained over basal values for almost 120 min) and a transient activation of p38 (that returned to basal value within 120 min); on the contrary, LTD4 induced a transient activation of ERKs and a sustained activation of p38. Such a differential effect on these intracellular pathways suggest that, depending on the type of agonist bound, GPR17 can couple to different transduction systems that, in turn, affect these intracellular effectors in a different way. From a functional point of view, and according to the model proposed by Morooka et al. (Morooka et al., 1998), we speculate that each of the two families of GPR17 ligands is able to preferentially activate the signal transduction pathways required for either neuronal survival or cell differentiation. The fact that GPR17 ligands were able to induce the sustained activation of at least one of these intracellular pathways justifies the differentiation effects of these ligands.
Interestingly, PC12 cell differentiation can be also obtained by the combination of two factors that ensure the sustained activation of at least one of the two signalling pathways. For example, it has been demonstrated that agents elevating cAMP (Mark et al., 1995) or inducing sustained p38 activation confer differentiation properties to EGF, which normally induced proliferation (Morooka et al., 1998). On this basis, we also evaluated the effects of EGF on PC12 cell differentiation in the presence of GPR17 ligands. The simultaneous incubation of cells with EGF and NGF, UDP-glucose or LTD4 induced a significant increase in the number of neurite-bearing cells with respect to cells treated with EGF alone. These results suggest that GPR17 ligands are able to confer NGF-like properties to EGF, and the predominance, under these treatment conditions, of the differentiation pathway with respect to proliferation.
Taken together, our results:
represent the first direct demonstration, in a native system, that GPR17 can be indeed activated by uracil nucleotides and cysLTs, in line with what previously demonstrated in recombinant expression systems (Ciana et al., 2006; Lecca et al., 2008; Pugliese et al., 2009);
establish GPR17 as a pro-survival neurotrophic receptor for neuronal-like cells and suggest a possible interplay between endogenous uracil derivatives, cysLTs and NGF in the signalling pathways involved in the survival of these cells.
highlight a role for GPR17 in the neuronal differentiation of PC12 cells, and suggest that activation of this receptor may qualitatively influence the effects induced by classical growth factors;
further confirm the involvement of GPR17 in central nervous system development, cell lineage specification, survival, remodelling and repair. Selective GPR17 agonists could thus represent a new class of pharmacological agents to aid neuronal regeneration after injury or disease.
![Accés als recursos informàtics [text]. Curs 2020-21](data:image/gif;base64,R0lGODlhAQABAIAAAP///wAAACH5BAEAAAAALAAAAAABAAEAAAICRAEAOw==)