ROLE OF CUGBP2 AND HUR MEDIATED POST-TRANSCRIPTIONAL REGULATION IN ANTI-CANCER DRUGS RESISTANCE OF PANCREATIC ADENOCARCINOMA

(1)

LITHUANIAN UNIVERSITY OF HEALTH SCIENCES MEDICAL ACADEMY

Aldona Jasukaitien

ė

ROLE OF CUGBP2 AND HUR MEDIATED

POST-TRANSCRIPTIONAL REGULATION

IN ANTI-CANCER DRUGS RESISTANCE

OF PANCREATIC ADENOCARCINOMA

Doctoral Dissertation Biomedical Sciences, Biology (01B) Kaunas 2016 1

(2)

Dissertation has been prepared at the Laboratory of Surgical Gastroentero-logy of Institute for Digestive System Research of Medical Academy of the Lithuanian University of Health Sciences during the period of 2012–2016.

Scientific Supervisor:

Prof. Dr. Žilvinas Dambrauskas (Lithuanian University of Health Scien-ces, Biomedicine, Biology – 01B)

Dissertation will be defended at the Biological Sciences Research Council of Medical Academy of the Lithuanian University of Health Sciences

Chairperson:

Dr. Juozas Kupčinskas (Lithuanian University of Health Sciences, Biomedicine, Biology – 01B)

Members:

Prof. Dr. Antanas Mickevičius (Lithuanian University of Health Sciences, Biomedicine, Medicine – 06B)

Assoc. Dr. Julius Liobikas (Lithuanian University of Health Sciences, Biomedicine, Biology – 01B)

Prof. Dr. Sonata Jarmalaitė (Vilnius University, Biomedicine, Biolo-gy – 01B)

Dr. Nathalia Giese (Heidelberg University, Biomedicine, Biology – 01B)

Dissertation will be defended at the open session of the Biological Sciences Research Council on 30 September 2016 at 1:00 p.m. in Didžioji auditorija of Hospital of the Lithuanian University of Health Sciences at Kaunas Clinics.

Address: Eivenių 2, LT-50009 Kaunas, Lithuania. 2

(3)

LIETUVOS SVEIKATOS MOKSLŲ UNIVERSITETAS MEDICINOS AKADEMIJA

Aldona Jasukaitien

ė

CUGBP2 IR HUR

BALTYMŲ

NULEMTOS POTRANSKRIPCINĖS

REGULIACIJOS ĮTAKA KASOS

ADENOKARCINOMOS ATSPARUMUI

PRIEŠVĖŽINIAMS VAISTAMS

Daktaro disertacija Biomedicinos mokslai, biologija (01B) Kaunas 2016 3

(4)

Disertacija rengta 2012–2016 metais Lietuvos sveikatos mokslų universite-te, Medicinos akademijos, Virškinimo sistemos tyrimų instituto, Chirurginės gastroenterologijos laboratorijoje.

Mokslinis vadovas

prof. dr. Žilvinas Dambrauskas (Lietuvos sveikatos mokslų universite-tas, Medicinos akademija, biomedicinos mokslai, biologija – 01B)

Disertacija ginama Lietuvos sveikatos mokslų universiteto Medicinos akademijos Biologijos mokslo krypties taryboje:

Pirmininkas

dr. Juozas Kupčinskas (Lietuvos sveikatos mokslų universitetas, biome-dicinos mokslai, biologija – 01B)

Nariai:

prof. dr. Antanas Mickevičius (Lietuvos sveikatos mokslų universitetas, biomedicinos mokslai, medicina – 06B)

doc. dr. Julius Liobikas (Lietuvos sveikatos mokslų universitetas, biomedicinos mokslai, biologija – 01B)

prof. dr. Sonata Jarmalaitė (Vilniaus universitetas, biomedicinos moks-lai, biologija – 01B)

dr. Nathalia Giese (Heidelbergo universitetas, biomedicinos mokslai, biologija – 01B)

Disertacija bus ginama viešame Biologijos mokslo krypties tarybos posė-dyje 2016 m. rugsėjo 30 d. 13 val. Lietuvos sveikatos mokslų universiteto ligoninės Kauno klinikų Didžiojoje auditorijoje.

Adresas: Eivenių g. 2, LT-50009 Kaunas, Lietuva. 4

(5)

4.8. siCUGBP2 and GEM treatment combination decreased the MiaPaCa-2 cells viability ... 59 STUDY LIMITATIONS ... 60 CONCLUSIONS ... 61 REFERENCES ... 62 PUBLICATIONS ... 69 SANTRAUKA ... 101 SUPPLEMENTS ... 115 1 supplement... 115 2 supplement... 116 CURRICULUM VITAE ... 117 ACKNOWLEDGEMENTS ... 118 6

(7)

ABBREVIATIONS

ARE Adenine and uracil (AU) rich elements

BMI Body mass index

BRCA1 BRCA1 is a human tumor suppressor gene; its protein, also called by the synonym breast cancer type 1

BRCA2 BRCA2 is a human tumor suppressor gene; its protein, also called by the synonym breast cancer type 2

CDKN2A Cyclin-dependent kinase inhibitor 2A CDK4 Cyclin-dependent kinase 4

cGMP Cyclic guanosine monophosphate

COX Prostaglandin - endoperoxide synthase (cyclooxygenase)

CRM1 Exportin 1

CUGBP2 RNA-binding protein implicated in the regulation of several post-transcriptional events

DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid EGF Epidermal growth factor

FAMMM Familial atypical multiple mole melanoma FBS Fetal bovile serum

GDP Guanosine-5'-diphosphate

GEM Gemcitabine (2′,2′-difluorodeoxycytidine) GTP Guanosine-5'-triphosphate

HNS HuR nucleocytoplasmic shuttling sequence

HO Heme oxygenase

HuR RNA-binding protein that binds to the 3'-UTR region of mRNAs and increases their stability

IC50 Half maximal inhibitory concentration IGF-I Insulin-like growth factor I

KRAS Kirsten rat sarcoma viral oncogene homolog LSMU Lithuanian University of Health Sciences LPS Lipopolysaccharide

MAPK Mitogen-activated protein kinase MLH1 Mutl homolog 1

MTT 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide

MW Molecular weight

(8)

mRNA Messenger RNA is a single-stranded RNA molecule that is complementary to one of the DNA strands of a gen

MSH2 Muts homolog 2

MSH6 Muts homolog 6

PDAC Pancreatic ductal adenocarcinoma PGE2 Prostaglandin E2

PGHS Prostaglandin endoperoxide synthase PI3K Phosphoinositide 3-kinase

PJS Peutz-Jeghers Syndrome

PMS2 PMS1 homolog 2, mismatch repair system component PVDF Poly-vinylidene fluoride

qRT-PCR Quantitative real time polymerase chain reaction RNA Ribonucleic acid

RBPs RNA-binding proteins

RPMI Roswell Park Memorial Institute medium RRMs RNA recognition motifs

siRNA Small interfering RNA

SMAD Intracellular protein that transduce extracellular signals from TGF-β ligands to the nucleus where they activate downstream gene transcription

STK11/LKB1 The gene, which encodes a member of the serine/threonine kinase family, regulates cell polarity and functions as a tumour suppressor.

TGFBR Transforming Growth Factor, Beta Receptor TGF-β Transforming growth factor beta

VEGF Vascular endothelial growth factor

3′UTR Untranslated region, founded on the 3' side

(9)

INTRODUCTION

Pancreatic ductal adenocarcinoma (PDAC) is aggressively invasive, treatment-resistant malignancy and usually detectable too late. The lethality of pancreatic cancer is determined by rapid invasion of the surrounding tissue, early metastatic disease and poor response to standard chemotherapy and radiotherapy [1]. Pancreatic cancer is the eighth or ninth most frequent cause of cancer death worldwide, and is the fourth or fifth most common cause of cancer death in developed countries [2]. As patients with pancreatic cancer have a median survival of 6 month from diagnosis, recent efforts have focused on detecting disease at an earlier stage as a way to improve survival. Currently, surgical resection and chemotherapy regimens, including gemcitabine (GEM) (2′,2′-difluorodeoxycytidine, dFdC), provide the best clinical benefits. In fact, for more than ten years GEM is one of the most frequetly used anti-neoplastic drugs for the treatment of this often fatal disease.

Post-transcriptional regulation is a very important mechanism to control gene expression in changing environments and increasingly recognised to be a powerful, general determinant of the quantitative changes in proteomes, and, therefore, a driving force for cell phenotypes [3]. Gene expression is intricately regulated at the post-transcriptional level by RNA-binding pro-teins (RBPs) via their interactions with pre-messenger RNA (pre-mRNA) and mRNA during development [4]. RBPs regulate biological processes through post-transcriptional control of target mRNA’s. RBPs typically have thousands of mRNA targets which encode proteins with critical biological functions. These proteins regulate mRNA stability and protein translation. Through these mechanisms, RBPs can efficiently and reversibly alter the proteome of a cell. The impact of RBPs on the expression of cancer-asso-ciated genes is well recognised [5].

HuR (ELAVL1 – embryonic lethal abnormal vision-like protein 1) is a member of the Hu family of RNA-binding proteins. The expression of HuR and other RBPs are perturbed in several pathological conditions, such as breast cancer, lung cancer, mesothelioma, ovarian cancer and colon cancer. HuR activity and function is associated with its subcellular distribution, transcriptional regulation, translational and post-translational modifications. Clinical data suggest that HuR overexpression is significantly related to specific clinicopathological features, advanced stage, positive lymph nodes, and poor survival in cancer patients [6]. But in a recent study, elevated

(10)

abundance of cytoplasmic HuR in pancreatic ductal adenocarcinoma (PDAC) was associated with a 7-fold lower risk of patient mortality [7].

The CELF2/Bruno-like family of RNA-binding proteins has been impli-cated in several post-transcriptional regulatory processes including pre-mRNA alternative splicing, pre-mRNA stability and translation [8]. CUGBP2 is one of the members of the CELF2 proteins family and is a paralogous protein of CUGBP1which is also known as an alternative splicing regulator.

Cyclooxygenase-2 (COX-2) is highly expressed in many cancers asso-ciated with increased angiogenesis. Although COX-2 plays a major role in mediating inflammation, its inhibitors are also effective anti-cancer drugs which function by blocking angiogenesis and tumor proliferation [9]. HuR binds to an AU-rich sequence in the COX-2 3′UTR, stabilises the COX-2 mRNA and increases COX-2 biosynthesis [10].

Previous studies in cancer cells also demonstrated that under infla-mmatory stimuli the overexpression of COX-2 protein increases PGE2 level, blocking the activation of CUGBP2, which modulates apoptosis, tumor invasiveness and cancer angiogenesis [11, 12].

HO-1 is believed to be the key enzyme in protecting the cells against stress. Its overexpression in different types of human cancers supports the notion that HO-1 provides a growth advantage and contributes to cellular resistance against chemotherapy and radiotherapy [13]. Study by Berberat et al. [13] showed that in human pancreatic cancer there was a 6-fold and 3.5-fold up-regulation of HO-1 mRNA and protein levels, respectively, when compared to normal pancreatic tissue. Treatment of the pancreatic cancer cell lines with GEM or radiation further induced HO-1 expression. In contrast, a targeted knockdown of HO-1 expression led to pronounced growth inhibition of the pancreatic cancer cells and made tumor cells signi-ficantly more sensitive to radiotherapy and chemotherapy.

According to these findings, we propose the hypothesis that expression and activity of HO-1 and COX-2 could be downregulated by regulation of the CUGBP2 and HuR expression in pancreatic cancer cells. Furthermore, this regulation may result in the improved response to gemcitabine treatment and reduced viability of pancreatic cancer cells.

(11)

1. AIM AND OBJECTIVES

The aim of this study is to assess the effects of post-transcriptional regulation in the human pancreatic cancer cell lines through the expression of cytoprotective molecules and in vitro response to gemcitabine (GEM) treatment.

1.1. Objectives of the study

1. To investigate the expression of CUGBP2, HuR, COX-2 and HO-1 in pancreatic ductal adenocarcinoma tissues (PDAC).

2. To investigate the survival of PDAC patients with different CUGBP2 and HuR expression.

3. To assess the effects of GEM treatment in the pancreatic cancer cell lines through the expression of CUGBP2, HuR, COX-2 and HO-1. 4. To assess the effects of HuR silencing in the pancreatic cancer cell lines

through the expression of cyclooxygenase-2 (COX-2) and heme oxygenase-1 (HO-1) and in vitro response to Gemcitabine (GEM) treatment.

5. To assess the effects of CUGBP2 upregulation in the pancreatic cancer cell lines through the expression of cyclooxygenase-2 (COX-2) and heme oxygenase-1 (HO-1) and in vitro response to Gemcitabine (GEM) treatment.

1.2. The novelty and relevance of the work

The role of HuR and CUGBP2 in regulating the cytoprotective effects of COX-2 and HO-1 in pancreatic ductal adenocarcinoma is not clear. Some studies have demonstrated that HuR or CUGBP2 expression in PDAC specimens after chemotherapy treatments can be both cytoplasmic and nuclear, but no one analysed expression in mRNA level in wholle tissue. In our study, we investigate both localisation and expression of mRNA binding protein HuR and CUGBP2.

There are a couple of similar studies with other cancer types, but this is the first study demonstrating that CUGBP2 and HuR mediated post-transcriptional regulation plays an important role in the regulation of heme oxygenase-1 (HO-1) expression in pancreatic cancer after chemotherapy.

(12)

Moreover, we are the first ones to demonstrate that RNA binding proteins CUGBP2 and HuR can bind HO-1 mRNA. In our study, this was confirmed by using the RNA-proteins immunoprecipitation analysis. Previously, one study reported HuR dependent HO-1 upregulation in human fibroblasts, but it was only a speculation without any hard evidence.

The data of the study suggest that CUGBP2 and HuR are the key molecules responsible for the exceptional chemoresistance of pancreatic cancer cells. CUGBP2 increasing and HuR silencing appears to be a potential new therapeutic target in adjuvant treatment of human pancreatic cancer. This hypothesis should be subjected to further testing using animal models of pancreatic cancer.

1.3. Structure of the dissertation

The dissertation is written in the English language. It is composed of the following parts: introduction, review of literature, materials and methods, results and discussion, conclusions, dissertation publications and references list. The dissertation includes 118 pages, 3 tables, 10 figures, 103 references and 2 supplements.

(13)

2. REVIEW OF LITERATURE

2.1. Pancreatic cancer

Pancreatic ductal adenocarcinoma (PDAC) is aggressively invasive, treatment-resistant malignancy and usually detectable too late. The lethality of pancreatic cancer is undermined by rapid invasion of the surrounding tissue, early metastatic disease and poor response to standard chemotherapy and radiotherapy [1]. As patients with pancreatic cancer have a median survival of 6 month from diagnosis, recent efforts have focused on detecting disease at an earlier stage as a way to improve survival. Currently, surgical resection and chemotherapy regimens, including gemcitabine (GEM) (2′,2′-difluorodeoxycytidine, dFdC ) provide the best clinical benefits. In fact, for more than ten years GEM is one of the most widely used anti-neoplastic drugs for the treatment of this often fatal disease [14]. Despite of tenacious effort to develop new agents, none of the currently available chemotherapeutic agents have an objective response rate higher than 10% [15]. The unchanged outcomes of pancreatic cancer treatment over the decades mandate further research to develop novel therapeutic agents.

2.1.1. Epidemiology of pancreatic cancer

Pancreatic cancer is the eighth or ninth leading cause of cancer death worldwide, and is the fourth or fifth most common cause of cancer death in developed countries [2]. PDAC is the fourth leading cause of cancer deaths in the United States [16] and fifth in Europe [17]. Pancreatic cancer is a deadly disease with more than 277 668 new cases and 266 029 deaths worldwide in 2008 [2]. Although accounting for only 3% of new cases, pancreatic cancer is responsible for 6% of all the cancer deaths each year. Most patients with symptomatic pancreatic cancer have advanced and/or metastatic disease at presentation, and as a result, the overall 5-year survival rate is only 5.6% [2]. Even patients with resected, margin-negative pancreatic cancers have only a 22% chance to survive in 5 years [16]. Unfortunately, mortality rates of pancreatic cancer have not significantly changed for several decades.

(14)

2.1.2. Risk factors for pancreatic cancer

Pancreatic cancer is a lethal disease for which only a small number of risk factors have been identified. In addition to older age, male gender, and black race, risk factors include smoking, obesity, long-standing diabetes and pancreatitis, and heavy alcohol use, allergies, such as hay fever, are related to the lowered risk [18]. The risk is higher for men (13.5 per 100,000) than for women (10.8 per 100,000). The difference between men and women probably reflects smoking habits. The risk is considerably higher for blacks than for non-Hispanic whites in the USA (15.8 vs. 12.0 per 100,000) and somewhat lower for Asians (9.5 per 100,000) and Hispanics (10.7 per 100,000) [18].

The strongest risk factor for pancreatic cancer is ageing. Environmental factors are also responsible for the majority of cases. Age is the key risk factor for pancreatic cancer, with the median age at diagnosis of pancreatic cancer is 72 years. Less than 10% of patients develop pancreatic cancer before the age of 50, and this younger group is likely to include a higher proportion of patients with underlying predisposing genetic disorders [19].

Cigarette smoking represents an independent risk for pancreatic cancer, resulting in an approximate doubling of the risk. The increased risk of cancer abates following the cessation of smoking, diminishing over a 9-year period. Because of the high prevalence of smoking in the world, it is estimated that approximately 25% of the burden of pancreatic cancer is due to smoking [20].

Light and moderate consumption of alcohol has not been found to be related to increased risk of pancreatic cancer, while heavy consumption is likely to increase risk. A recent meta-analysis convincingly showed that moderate alcohol use is not associated with increased risk of pancreatic cancer, but that there is a 22% increased risk for those with heavy alcohol consumption (i. e. 3 or more drinks per day) [21]. The specific role of alco-hol drinking in pancreatic carcinogenesis is complicated by the high percen-tage of smokers among drinkers, and recent findings have showed that smoking accelerates alcoholic chronic pancreatitis. These results suggest the possibility of a complex interrelationship between alcohol abuse and smoking in the initiation and promotion of pancreatic cancer [22].

Chronic pancreatitis represents the increased risk for the development of pancreatic cancer. Studies in the timing of pancreatitis relative to that of cancer have found that the risk is highest in the year before cancer is diagnosed, suggesting that the cancer may be initially diagnosed as

(15)

pancreatitis. At the same time performed studies showed that the risk to have cancer after having had pancreatitis increases [23].

There are meta-analyses indicating a positive association between the body mass index and pancreatic cancer. This study indicates the development of pancreatic cancer at a younger age for patients who are overweight or obese compared to those with BMI values in the normal range [24].

While the association between the presence of diabetes and risk of pancreatic cancer is a consistent finding in epidemiologic studies, the results differ markedly according to the length of time between diagnosis of diabe-tes and diagnosis of pancreatic cancer, with the highest association for diabetes diagnosed close to the time of cancer diagnosis, and only modera-tely increased risk with longer duration of diabetes. Two recent meta-analyses, one including 35 cohort studies [25] and the other including 19 cohort and 17 case-control studies [26], revealed an increased risk of almost 2 overall (RR = 1.94, 95% CI 1.66–2.27; RR = 1.82 (95% CI 1.66–1.99, respectively). Both analyses of the studies showed the risk increase, nearly 50%, for those with diabetes diagnosed ≥10 years earlier.

2.1.3. Genetic factors of pancreatic cancer

Several known genetic mutations or genetic syndromes increasing the risk of pancreatic cancer is discussed. Investigating more common genetic variants may reveal more potentially important genetic associations. Pancreatic cancer occurs in the setting of well defined cancer syndromes, so-called cancer susceptibility syndromes, where an identifiable germline mutation may lead to the development of pancreatic adenocarcinoma [18]. It is now supposed that two broad categories of hereditary risk for pancreatic cancer can be defined. Familial pancreatic cancer is defined as an inherited predisposition based on family clustering in families in which there are multiple first and second degree relatives with ductal pancreatic adenocar-cinoma in the absence of a known genetic susceptibility syndrome. A family history of pancreatic cancer is seen in between 5–10% of individuals with pancreatic cancer [27]. Having multiple family members with pancreatic cancer increases the risk for non-affected family members to develop the disease. This is especially seen when multiple first-degree relatives have pancreatic cancer. When two or more first-degree relatives are affected, one study showed the odds ratio to be 4.26 (95% CI = 0.48–37.79) [28]. Scientists at Johns Hopkins University using their National Familial

(16)

Pancreas Tumor Registry found that when at least one pair of first degree relatives was affected by pancreatic cancer, the risk to develop of this type cancer for more than one of other relatives increases 18 times. In those pancreatic cancer kindreds with three or more affected family members there was a 57-fold (95% CI = 12.4–175) increased risk of pancreatic cancer. It has become clear that in these familial pancreatic cancer families the risk of developing pancreatic cancer is closely tied to the number of first-degree relatives in the family with the disease [29].

Perhaps one of the most well known cancer predisposition syndromes are Hereditary Breast and Ovarian Cancer Syndrome. Women who carry gene mutations of the tumor suppressor genes, BRCA1 or BRCA2, have very high lifetime risks for breast and ovarian cancers [18]. Germline mutation in the BRCA2 gene is present in 6%–16% of patients with pancreatic cancer. Using direct sequencing of constitutional DNA, Murphy et al. [30] analysed samples from patients with pancreatic cancer who were enrolled in their Familial Pancreatic Tumor Registry for mutations in four tumor suppressor candidate genes, including BRCA2. Samples were taken from families in which three or more family members were affected by pancreatic cancer, and at least two were first-degree relatives. During the sequencing of BRCA2 gene five mutations which are supposed to be deleterious (17.2%) were identified. Three patients harbored the 6174delT frameshift mutation. These findings confirm the increased risk of pancreatic cancer in individuals with BRCA2 mutations. The authors also concluded that germline BRCA2 mutations are the most common inherited genetic alteration in familial pancreatic cancer. In a study by Lynch et al. [31], pancreatic cancer was seen in nine of 15 families where the BRCA1 mutation was either confirmed or inferred.

One of the inherited pancreatic cancer syndromes is Peutz-Jeghers Syndrome (PJS). Peutz-Jeghers syndrome is an autosomal dominant disease characterised by hamartomatous polyps of the gastrointestinal tract and mucocutaneous melanin deposits, and caused by germline mutations of STK11/LKB1 tumor suppressor gene (serine threonine kinase 11). These mutations can be found in the majority (66–94%) of patients with Peutz-Jeghers syndrome. Patients with this matation are at risk of esophageal, gastric, small intestine, lung, breast, uterine, ovarian and pancreatic cancer [32].

The familial atypical multiple mole melanoma syndrome (FAMMM) is an autosomal dominant syndrome caused by a germline mutation in

(17)

CDKN2A (or p16) gene on chromosome 9p21, or in a minority of cases, in the CDK4 gene on chromosome 12. In the Dutch FAMMM registry, pancreatic cancer was found to be the second most common cancer in mutation carriers after melanoma. The individuals with this syndrome have a 20–34% relative risk of developing pancreatic cancer and a 16% lifetime risk of pancreatic cancer [33].

Lynch syndrome is an autosomal dominant condition caused by defects in mismatch repair genes (MLH1, MSH2, MSH6 or PMS2). Recently, it has been shown that, in addition to colorectal and endometrial cancers, these individuals have a ninefold increased risk of developing pancreatic cancer compared with the general population. Data on 6342 individuals from 147 families with mismatch repair gene defects have been analysed and 21% of families reported at least one case of pancreatic cancer [34]. This study showed that the estimated relative risk of pancreatic cancer was higher for younger individuals (aged between 20 and 49 years), and concluded that individuals with Lynch syndrome and a family history of pancreatic cancer should be included in screening programmes.

KRAS is a member of the Ras family of genes, which encodes memb-rane-bound GTP-binding proteins. When activated by signaling partners, such as the epidermal growth factor receptor (EGFR), Ras proteins release GDP in exchange for GTP, which converts the Ras protein to the ‘on’ state and activates downstream signaling events, such as the Raf, MAP2K, MAPK and the PI3K–Akt cascades. These events are usually short-lived by virtue of the intrinsic GTPase activity of Ras proteins, which switches these proteins’ effects ‘off’. Mutations of KRAS, mostly at codon 12 but also sometimes at codons 13 and 61, are exceptionally frequent in patients with pancreatic cancer. Mutations in KRAS result in impaired GTPase function, which causes KRAS to be locked in the GTP-bound ‘on’ state. This malfunction triggers a variety of cellular processes, including transcription, translation, cell-cycle progression, enhanced cell survival and motility. Oncogenic KRAS is involved in the initiation or early phase of pancreatic tumorigenesis [35].

2.1.4. Pancreatic cancer pathogenesis

Angiogenesis is essential for solid tumor growth, and is principally mediated by the vascular endothelial growth factor (VEGF) family of proteins and receptors. Stimuli that upregulate VEGF expression include hypoxia, other growth factors and oncogenic proteins (for example, TGF-β,

(18)

EGF and RAS). VEGF is overexpressed in >90% of pancreatic cancers and is, therefore, an appealing target for therapy [35].

The COX enzymes have a principal role in the conversion of arachidonic acid into prostaglandins. COX-1 is constitutively expressed and has a homeostatic role. COX-2 is inducible by growth factors, cytokines and tumor promoters, and its expression is upregulated of pancreatic cancers. The mechanisms of COX-mediated and prostaglandin-mediated pancreatic-cancer development are complex; they involve multiple mitogenic signaling pathways and molecules that mediate resistance to apoptosis, cell migration, invasion, angiogenesis, immunosuppression, the production of free radicals and peroxidation of procarcinogens to carcinogens [36]. Inhibition of COX-2 by NSAIDs suppressed proliferation of pancreatic cancer cells and angiogenesis, both in vitro and in vivo [36].

TGF-β is a cytokine secreted by epithelial, endothelial, hematopoietic and mesenchymal cells. TGF-β forms (I- and II-type TGF-β receptors) compose heteromeric complexes which trigger the phosphorylation of cytoplasmic SMAD2 and SMAD3. In turn, these SMAD proteins form a complex with SMAD4, which translocates into the nucleus to activate gene transcription. TGF-β can also signal via SMAD-independent pathways that involve Ras, PI3K and MAPK. TGF-β mediates a wide range of physiolo-gical processes, such as embryonic development, tissue repair, angiogenesis and immunosuppression. TGF-β has also a complex role in tumorigenesis, as it is tumor-suppressive in epithelial cells, but promotes invasion and metastasis during the late stages of cancer progression. Mutations of the TGFBR1, TGFBR2 and SMAD4 genes are found in about 1%, 4% and 50% of pancreatic cancers respectively. Inactivation of SMAD4 abolishes TGF-β-mediated suppressive functions, while it maintains some tumor-promoting TGF-β responses, such as epithelial-mesenchymal transition, which makes cells migratory and invasive [37]. TGF-β-based therapeutic strategies are currently in development, including inhibitors of TGFBR1 and TGFBR2 [38] .

The insulin-like growth factor I (IGF-I) receptor, a transmembrane receptor tyrosine kinase, is overexpressed in 64% of pancreatic cancers. The IGF-I receptor has antiapoptotic and growth-promoting effects and acts via multiple signaling cascades, including the PI3-Akt, MAPK and STAT pathways. Inhibition of the IGF-I receptor by the tyrosine kinase inhibitor NVP-AEW541, a dominant-negative mutant and RNA interference have all been shown to reduce the growth of pancreatic cancer cells in vitro and

(19)

in vivo, and increase chemotherapy-induced or radiation-induced apoptosis [35].

2.1.5. Pancreatic cancer treatment with gemcitabine

Currently, surgical resection and chemotherapy regimens, including gemcitabine (GEM) (2′,2′-difluorodeoxycytidine, dFdC ), provide the best clinical benefits for pancreatic cancer. In fact, for more than ten years GEM has been one of the most used anti-neoplastic drugs for the treatment of this often fatal disease [14].

Gemcitabine is the standard chemotherapy treatment for pancreatic cancer, but its efficacy is limited; only 15% of patients with advanced pancreatic cancer and up to 30% generally can be expected to respond to treatment. Gemcitabine is hydrophilic and, therefore, passive diffusion through hydrophobic cellular membranes is slow [39].

To improve clinical efficacy, systemically administered gemcitabine is often combined with the second cytotoxic agent, such as platinum analogs, fluoropyrimidine, or the targeted cytotoxic agent. Numerous clinical trials have aimed at proving the superiority of gemcitabine-based combination therapy over single-agent gemcitabine treatment [40].

The treatment failure, using GEM or other chemotherapy agents, indicates suboptimal blockage of cancer survival signals which may be maintained by the crosstalk of signal transduction pathways or drug resi-stance [41].

One of the possible molecular mechanisms, determining the increased resistance to the chemotherapeutic agents, is post-transcriptional regulation by mRNA binding proteins.

Gemcitabine displays distinctive features of cellular pharmacology, metabolism and mechanism of action. Following influx through the cell membrane via nucleoside transporters, gemcitabine undergoes complex intracellular conversion to the nucleotides gemcitabine diphosphate (dFdCDP) and triphosphate (dFdCTP) responsible for its cytotoxic actions. The cytotoxic activity of gemcitabine may be the result of several actions on DNA synthesis. dFdCTP competes with deoxycytidine triphosphate (dCTP) as an inhibitor of DNA polymerase. dFdCDP is a potent inhibitor of ribo-nucleoside reductase, resulting in depletion of deoxyribonucleotide pools necessary for DNA synthesis and, thereby, potentiating the effects of dFdCTP. dFdCTP is incorporated into DNA and after the incorporation of one more nucleotide leads to DNA strand termination. This extra nucleotide

(20)

may be important in hiding the dFdCTP from DNA repair enzymes, since incorporation of dFdCTP into DNA appears to be resistant to the normal mechanisms of DNA repair. Gemcitabine can be effectively inactivated mainly by the action of deoxycytidine deaminase to 2,2'-difluorodeoxyu-ridine. Furthermore, 5'-nucleotidase opposes the action of nucleoside kinases by catalysing the conversion of nucleotides back to nucleosides. Additional sites of action and self-potentiating effects have been described. Evidence that up- or down-regulation of the multiple membrane transporters, target enzymes, enzymes involved in the metabolism of gemcitabine and alterations in the apoptotic pathways may confer sensitivity/resistance to this drug, has been provided in experimental models and more recently also in the clinical setting. Synergism between gemcita-bine and several other antineoplastic agents has been demonstrated in experimental models based on specific pharmacodynamic interactions. Knowledge of gemcitabine cellular pharmacology and its molecular mechanisms of resistance and drug interaction may, thus, be pivotal to a more rational clinical use of this drug in combination regimens and in tailored therapy [42].

2.1.6. Curcumin and pancreatic cancer

Curcumin natural polyphenol derived from turmeric (Curcuma longa), could be a promising anti-cancer drug exhibiting anticancer effects alone and synergic effects in combination with other cytotoxic agents or antican-cer drugs (e.g., gemcitabine, 5-fluorouracil, and oxaliplatin) [43, 44]. A number of preclinical studies have demonstrated anticancer effects for cur-cumin in various types of tumors, including pancreatic [45], colorectal [46], prostate [47], ovarian [48], lung [49] and et al. Curcumin is also known for activating and regulating lipopolysaccharide (LPS)-stimulated monocytes and macrophages, dendritic cells and inhibiting IL-1, IL-6, IL-8 and TNF-α protein along with inhibition of NF-κB activation [50, 51].

2.2. Post-transcriptional regulation by RBPs in pancreatic cancer

Gene expression is controlled by diverse mechanisms before, during, and after transcription. Many oncoproteins, tumor suppressor proteins, and other cancer-related proteins are encoded by mRNAs whose half-lives and/or translation are tightly regulated [5]. Chromatin modification factors, as well as transcriptional repressors, silencers, and enhancers, are related to

(21)

the eukaryotic RNA transcription in the nucleus. However, there is increasing evidence that post-transcriptional regulation of gene expression is as widespread as transcriptional control if not more so [52]. Post-transcrip-tional regulation is a very important mechanism to control gene expression in changing environments and increasingly recognised to be a powerful, general determinant of the quantitative changes in proteomes, and, therefore, a driving force for cell phenotypes [3]. Gene expression is intricately regulated at the post-transcriptional level by RNA-binding proteins (RBPs) via their interactions with pre-messenger RNA (pre-mRNA) and mRNA during development [4]. RNA-binding proteins (RBPs) regulate biologic processes through post-transcriptional control of target mRNAs. These proteins regulate mRNA stability and protein translation. Through these mechanisms, RBPs can efficiently and reversibly alter the proteome of a cell. The impact of RBPs on the expression of cancer-associated genes is well recognised [5]. RBPs typically have thousands of mRNA targets which encode proteins with critical biologic functions. However, very little is known about the mechanism regulating RBP activities in RNA metabolism [53].

2.2.1. RNA binding protein HuR

The expression of distinct collections of proteins allows cancer cells to develop, survive, proliferate, and colonise other tissues. Cancer cell metabo-lism differs from normal cells, yet the regulatory mechanisms responsible for these differences are incompletely understood, particularly in response to acute changes in the tumor microenvironment [54]. Cancer-related gene expression programmes are strongly influenced by post-transcriptional mechanisms. HuR (ELAVL1 or embryonic lethal abnormal vision-like protein 1) is a member of the Hu family of RNA-binding proteins and originally identified in Drosophila as essential for neural development [6]. It is the product of the human ELAVL1 gene located on human chromosome 19p13.2 and was first cloned in 1996 [55]. The HuR protein is extensively expressed in many cell types, including adipose, intestine, spleen, and testis. By contrast, other ELAV family members in mammals, including HuB, HuC and HuD, are almost exclusively found in neuronal tissues [6]. The expression of HuR and other RBPs are perturbed in several pathological conditions, such as breast cancer, lung cancer, mesothelioma, ovarian cancer and colon cancer [6]. HuR was one of the first RBPs studied in cancer cells, and remains one of the best characterised to date [10], and an RNA-binding

(22)

protein, acts under acute stress to regulate core signaling pathways in cancer through post-transcriptional regulation of mRNA targets [54]. HuR binds to mRNAs primarily at U- or AU-rich sequences which are typically, but not exclusively located in the untranslated regions of target transcripts [56]. In response to cellular stressors (e.g., ultra violet light, chemotherapeutics or hypoxia), cytoplasmic levels of HuR increase and post-transcriptional regulatory functions of HuR are exerted on its bound mRNA cargo. The importance of HuR biology in tumorigenesis is supported by numerous clinicopathologic studies across diverse tumor types which consistently reveal a correlation between cytoplasmic HuR expression (i.e., “activated” HuR) and tumor aggressiveness [54].

2.2.1.1. HuR function

HuR activity and function is associated with its subcellular distribution, transcriptional regulation, translational and post-translational modifications [6]. HuR has three RNA recognition motifs (RRMs) through which it interacts with target mRNAs, preferentially those bearing U- or AU-rich sequences in their 5′UTRs and 3′UTRs [56]. HuR has been reported to regulate the expression of many molecules by different post-transcriptional mechanisms which are important components of eukaryotic gene expres-sion, including mRNA trafficking, mRNA decay, and protein translation [6]. Increasing evidence supports HuR is the first RBP that is shown to play a critical role in carcinogenesis and cancer progression by functioning as either an oncogene or a tumor suppressor regulating the expression of va-rious target genes (Fig. 2.1).

(23)

Fig. 2.1. The diverse functions of HuR in cancer development and

progression through the regulation of the stability or translation of target mRNAs that encode multiple cancer-related proteins [6].

Clinical data suggest that HuR overexpression is significantly related to specific clinicopathological features, advanced stage, positive lymph nodes, and poor survival in cancer patients [6]. HuR is primarily nuclear and has been implicated in mRNA splicing [57], but its nuclear functions remain obscure. By contrast, HuR’s ability to stabilise and/or modulate the translation of many of its target mRNAs is closely linked to its translocation to the cytoplasm [56]. The transport of HuR across the nuclear envelope involves a specific HuR domain (the HuR nucleocytoplasmic shuttling sequence or HNS) and several transport machinery components, including CRM1, transportins 1 and 2, and importin-1α [58–60]. These and other post-translational modification of HuR that affect HuR abundance, subcellular localisation, and mRNA binding are summarised in Fig. 2.2.

(24)

Fig. 2.2. HuR protein and post-translational modification

by cancer-related enzymes [5].

A number of cancer-related transcripts containing AREs, including mRNAs for proto-oncogenes, cytokines, growth factors, and invasion factors, have been characterised as HuR targets. It has been proposed that HuR has a central tumorigenic activity by enabling multiple cancer pheno-types [6].

(25)

2.2.1.2. Post-transcriptional regulation of gene expression by HuR

The regulation of a large subset of target mRNAs and protein transla-tion by HuR is dependent on the molecular structure of the HuR protein. HuR binding the cis-acting regulatory element is found in the 5′ untranslated region (UTR) or in the unstable mRNAs of the 3′UTR. As a trans-acting factor, HuR protein can recognise and bind the adenylate/uridylate (AU)- and U-rich elements (AREs) in the UTR of mRNA or poly (A) tail through three classic RNA recognition motifs (RRMs) [61]. Because ARE-mediated rapid degradation of mRNA is an important mechanism of post-transcriptional gene regulation in mammalian cells, the direct interaction between the HuR protein and AREs confers post-transcriptional regulation of gene expression by increasing both mRNA stability and/or protein translation [5]. Recent studies have revealed the interactions between HuR and microRNAs (miRNAs). Functional investigations show that HuR and miRNAs might have the same mRNA functional site [62]. Due to HuR function, it can promote cell proliferation, enhance cell survival, elevate local angiogenesis, reduce immune recognition, increase cancer invasion and metastasis [5] and resistance and sensitivity to the drug [6].

Cyclooxygenase-2 (COX-2) is highly expressed in many cancers, asso-ciated with increased angiogenesis [9]. Although COX-2 plays a major role in mediating inflammation, its inhibitors are also effective anticancer drugs which function by blocking angiogenesis and tumor proliferation [9]. HuR binds to an AU-rich sequence in the COX-2 3′UTR, stabilises the COX-2 mRNA, and increases COX-2 biosynthesis [10]. Colon cancer cells with elevated cytoplasmic HuR levels also expressed higher levels of COX-2 and in one recent report, HuR was shown to regulate COX-2 levels during colon carcinogenesis [62]. The same correlation between HuR and COX-2 levels was seen in human mesothelioma, where it was further established that overall survival was strongly influenced by the subcellular localisation of HuR [63].

2.2.1.3. Shuttling of HuR from the nucleus into the cytoplasm

It is well known that intracellular HuR is predominantly localised within the nucleus of resting cells. Under various stimulations, HuR can bind ARE-containing mRNAs in the nucleus. The HuR-mRNA complex is then transported to the cytoplasm. Once HuR is bound to the target transcript, it stabilises the message and protects it from rapid degradation by

(26)

exonucleases. HuR releases itself from the mRNA and returns rapidly to the nucleus after completing the process of stabilising mRNA [5]. This translocation from the nucleus to the cytoplasm appears to be an important aspect of HuR stabilising function. Many stress stimulators have been reported to induce HuR shuttling, including ultraviolet radiation, lipopolysa-charide, chemical compounds, alterations in the microenvironment, cyto-kines, viral infection and hormone treatment [5]. Most of these reported exogenous stimuli result in a significantly increased cytoplasmic accumu-lation of HuR protein (Table 2.1) The mechanism by which HuR shuttles from the nucleus to the cytoplasm is incompletely understood.

Table 2.1. Exogenous regulators that influence the expression and function

of HuR [5].

Regulators Effect on HuR

UV Cytoplasmic accumulation ↑

Compound

Ethanol Cytoplasmic accumulation ↑

LPS Cytoplasmic accumulation ↑

Tamoxifen Cytoplasmic accumulation ↑

Gemcitabine Cytoplasmic accumulation ↑

Nitric oxide mRNA ↓, protein ↓

HIV protease inhibitor Cytoplasmic accumulation ↑

Microenvironment change

Hypoxia Cytoplasmic accumulation ↑

Amino acid limitation Cytoplasmic accumulation ↑

Bile salts Cytoplasmic accumulation ↑

Serum Cytoplasmic accumulation ↑

Polyamines depletion Cytoplasmic accumulation ↑

Nature reagent

Green tea Cytoplasmic accumulation ↓

Ginkgo biloba extract Cytoplasmic accumulation ↓

Triptolide Cytoplasmic accumulation ↓

Cytokine

IL-1β Cytoplasmic accumulation ↑

TNF-α Cytoplasmic accumulation ↑

(27)

Table 2.1. Continued

Regulators Effect on HuR

Virus infection

HPV Cytoplasmic accumulation ↑

Alphavirus Cytoplasmic accumulation ↑

Hormone

Androgens Cytoplasmic accumulation ↑

17β-estradiol Cytoplasmic accumulation ↑

2.2.1.4. HuR expression in pancreatic cancer

In a recent study, elevated abundance of cytoplasmic HuR in pancreatic ductal adenocarcinoma (PDAC) is associated with a 7-fold lower risk of patient mortality [7]. The authors linked the cytoplasmic levels of HuR with binding of HuR to the deoxycytidine kinase (dCK) mRNA leading to its stabilisation and the enhanced expression of dCK. This observation was significant because dCK metabolises, and, thereby, activates, gemcitabine, a major component of a common chemotherapeutic regimen for PDAC. Accordingly, Costantino and colleagues proposed that the presence of elevated HuR enhances the efficacy of gemcitabine in PDAC and improves patient outcome [7].

2.2.2. RNA binding protein CUGBP2: functions and targets

The Bruno-like family of RNA-binding proteins has been implicated in several post-transcriptional regulatory processes, including pre-mRNA alternative splicing, mRNA stability and translation. The family was named due to their protein sequence similarity to Drosophila melanogaster Bruno [8]. The same family was also named CELF (CUGBP and ETR-3 like Fac-tors) [64]. In mammals, the CELF/Bruno-like family includes six members and is classified into two subgroups based on overall sequence similarity. One group is composed of CUGBP1 and CUGBP2 which share 76% amino acid sequence identity [65]. The other group contains BRUNOL1 (CELF3), BRUNOL5 (CELF5), BRUNOL6 (CELF6), and CELF4, which share 62-66% amino acid sequence identity with each other and 44% sequence identity with CUGBP1 [65]. CELF proteins have two consecutive RNA recognition motifs (RRMs) (RRM1-2) in the N-terminal region and another RRM (RRM3) in the C-terminal region. RRM2 and RRM3 are separated by a linker region that consists of 160-230 amino acids [66]. The RRMs show a

(28)

high degree of sequence similarity, but the sequences of the linker region between the second and third RRMs are less conserved [65]. CELF family members are expressed in multiple tissues with a distinct tissue distribution pattern. CUGBP1 is expressed in almost all tissues, BRUNOL1 and BRUNOL5 are restricted to the brain, and CUGBP2 is abundant in the heart, skeletal muscle, and brain [8]. CUGBP2 is one of the members of the CELF2 proteins family that possesses several alternatively spliced exons.

CUGBP2 (also known as ETR-3, Napor, and Brunol3), a paralogous protein of CUGBP1, is also known as an alternative splicing regulator. Similar to CUGBP1, CUGBP2 activates the inclusion of exon 5 in human cTNT mRNA via binding to MSE [64, 67].

In addition, Roberts et al. demonstrated that CUGBP2 protein is predo-minantly nuclear and its shuttling to the cytoplasm depends on its phosphor-rylation state [51]. Previous studies in cancer cells also demonstrated that under inflammatory stimuli, the overexpression of COX-2 protein increase PGE2 level, blocking the activation of CUGBP2, which modulates apop-tosis, tumor invasiveness and cancer angiogenesis [11, 12].

Many reports have demonstrated that the overexpression of the cyclooxygenase-2 (COX-2), a key enzyme in the conversion of arachidonic acid to prostaglandins and other prostanoids, is correlated with inflamema-tory processes. Increased level of prostaglandin E2 was also found in animal model of left ventricle of hypertrophy. Based on previous observations that demonstrated a regulatory loop between COX-2 and the RNA-binding protein CUGBP2, Moraes et al. studied cellular and molecular mechanisms of a pro-inflammatory stimulus in a cardiac cell to verify if the above two molecules could be correlated with the inflammatory process in the heart [68]. They also demonstrated a regulatory connection between COX-2 and CUGBP2 in the cardiac cells. Based on a set of different assays including gene silencing and fluorescence microscopy, Moraes et al. describe a novel function for the RNA-binding protein CUGBP2 in controlling the pro-inflammatory stimulus: subcellular trafficking of messenger molecules to specific cytoplasmic stress granules to maintain homeostasis [68].

CUGBP2 regulates splicing and translation of mRNAs linked to sexual differentiation why CUGBP2 is a novel sex-specific gene that is also regu-lated by estradiol in the neonatal rat anteroventral periventricular [49]. Although CUGBP2 is known as a splicing activator for the N-methyl-D-aspartate receptor 1 (NMDA R1) exon 21, CUGBP2 represses NMDA R1 exon 5 inclusion [69]. In addition, CUGBP2 was reported to repress the

(29)

inclusion of the IR exon 11 [70]. These studies showed that CUGBP2 has positive and negative regulatory roles in alternative splicing.

Most of the mammalian genes, including CUGBP2, are transcribed as alternatively spliced variants. Among the alternative exons of CUGBP2, the present study focused on the skipping of exon 14, which encodes the first half of RRM3. Because exon 14 of the CUGBP2 gene encodes the first half of RRM3, a skipping transcript produces CUGBP2 truncated in parts of RRM3 (CUGBP2 R3δ) [66]. However, it is unclear how this protein with partially truncated RRMs impacts functions of the alternative splicing in biological processes.

CUGBP2 was highly expressed in neural cells and in the adult brain compared to R3δ, which was the major product in the kidneys, liver and undifferentiated P19 cells. Transient transfection experiments showed simi-lar activities of CUGBP2 and R3δ, and both proteins promoted the use of the smooth muscle exon instead of the non-muscle exon of the ACTN1 minigene. On the other hand, CUGBP2 and R3δ had opposite effects on alternative splicing of exon 11 of IR; CUGBP2 repressed IR exon 11 inclu-sion, whereas R3δ did not and even slightly increased inclusion. This result suggests that the alternatively spliced isoform, R3δ, has a different function from that of CUGBP2. In addition, the results of molecular dynamics showed that the structure of the RRM domain differs significantly from that in the R3δ isoform, resulting in the disruption of its binding activity [66].

CUGBP2 expression in pancreatic cancer

CUGBP2 expression analysis in pancreatic cancer is relatively new. Subramaniam et al. found that curcumin inhibits pancreatic tumor growth through mitotic catastrophe by increasing the expression of RNA binding protein CUGBP2, thereby inhibiting the translation of COX-2 and VEGF mRNA. These data suggest that translation inhibition is a novel mechanism of action for curcumin during the therapeutic intervention of pancreatic cancers [11].

(30)

2.2.3. Cytoprotective molecule COX-2

Prostaglandins are short-chain lipid-derived metabolites involved in a wide variety of important physiological processes, such as ovulation, maintaining renal blood flow, and contributing to the cytoprotection of the gastric mucosa. However, prostaglandins are also significant players in many pathological processes, including the development of cancers. Cyclooxygenase (COX; also known as prostaglandin endoperoxide syntha-se – PGHS) is a key enzyme in the biochemical pathway leading to the synthesis of prostaglandins [71]. It mediates the conversion of arachidonic acid to prostaglandin G2 (PGG2) and, subsequently, reduces PGG2 to prostaglandin H2 (PGH2). PGH2 is then converted into different biolo-gically active prostanoids by specific prostaglandin synthases (Fig. 2.3) [72]. Two distinct forms of cyclooxygenase have been recognised. The first isoform, COX-1, was initially identified as the target of aspirin and other nonsteroidal anti-inflammatory drugs (NSAIDs). The existence of a second and distinct isoform of the enzyme designated COX-2 was detected. It was then shown that the 2 isoforms are encoded by 2 different genes located on 2 separate chromosomes, although they share 60 to 65% identity at the amino acid level [71].

Fig. 2.3. Pathway of prostaglandin E2 (PGE2) synthesis and roles

of PGE2 in cancer development [72]. 30

(31)

COX-1 is constitutively expressed in a wide variety of cells and tissues and is responsible for the production of prostaglandins involved in maintaining homeostasis. In contrast, COX-2 is normally absent (except in a small number of tissues, such as the placenta, brain, and kidney), and its expression is induced following stimulation by different mediators of inflammation, such as interleukin-1, tumor necrosis factor–1, and lipopoly-saccharide [71]. A large amount of epidemiological and experimental evidence supports a role for COX-2, the inducible form of the enzyme, in human tumorigenesis, notably in colorectal cancer [71]. In addition to colorectal cancer, many other types of human malignancies have now been shown to overexpress COX-2, such as breast, pancreatic, prostatic, gastric and other cancers [73-76]. Juuti et al. showed that COX‐2 is upregulated in 42–90% of pancreatic ductal adenocarcinomas and is a potential target for chemotherapy. Moreover, they showed that expression of COX‐2 was associated with poor outcome from pancreatic ductal adenocarcinoma and was independent on a tumor stage, grade, or age in multivariate analysis [74].

COX-2 mediates this role through the production of PGE2 that acts to inhibit apoptosis, promote cell proliferation, stimulate angiogenesis, and decrease immunity [71]. The half-life of COX-2 mRNA is short, but it is increased by various RNA binding proteins [77]. There are 2 groups of RNA binding proteins, one that increases the expression of COX-2, such as hnRNP A1, apobec-1 and HuR, and the second group that inhibits COX-2 expression, including CUGBP2, TIA1, TTP, TIAR and AUF1 [78-80].

Mukhopadhyay et al. previously showed that CUGBP2 increases COX-2 mRNA stability after binding to the ARE sequences in the COX-COX-2 3=UTR [79]. Sripathi M. Sureban et al. showed that in contrast to HuR, CUGBP2 inhibited translation of COX-2 mRNA [81]. Both CUGBP2 and HuR encode 3 RNA binding domains of the RNA recognition motif (RRM) type, 2 located at the amino terminal and the other one at the carboxy terminal. A critical difference between CUGBP2 and HuR is in the bridge region located between the second and third RRMs. This region is extended in CUGBP2 and is alanine and glutamine rich. Currently, the role of this bridge region in CUGBP2 is not well understood, but is believed to encode a nuclear localisation signal. The fact that HuR enhances, whereas CUGBP2 inhibits COX-2 mRNA translation, suggests opposing functions in regulating COX-2 mRNA translation of the 2 proteins. To identify this, Sripathi M. Sureban et al. first performed RNA binding studies. The results

(32)

revealed that the 2 proteins bind with similar affinities to the ARE sequen-ces in COX-2 3=UTR. However, CUGBP2 competed with HuR for the bin-ding. They also showed that ectopic expression of CUGBP2 protein is sufficient to block cellular mRNA translation by preventing HuR binding to the COX-2 mRNA. These results support a novel mechanism of translation inhibition used by CUGBP2, which complements the blockage of HuR binding [81].

2.2.4. Cytoprotective molecule HO-1

HOs are rate-limiting enzymes in the heme catabolism. Three HO isozymes have been identiﬁed: HO-1, HO-2 and HO-3 [82]. More attention has been paid to heme oxygenase-1 (HO)-1 because of its cytoprotective, antioxidant, maintaining microcirculation, modulating the cell cycle and anti-inflammatory functions [83].

Heme oxygenase 1 is a stress-responsive microsomal enzyme that acts on heme to cleave it and produce three products: carbon monoxide (CO), biliverdin (which is converted to bilirubin by biliverdin reductase), and free iron (Fe2+ that induces expression of the iron chelator ferritin) [82]. Three products of the heme metabolism are considered to be beneficial due to their immunomodulatory, anti-apoptotic, and vasoactive properties.

CO, despite its potential toxicity, has recently caused a great interest because of its function as a signaling molecule with vasodilatory effects mediated by cGMP, and its anti-apoptotic and anti-inflammatory effects. CO can travel freely throughout intracellular and extracellular compartments and exert a wide spectrum of modulating physiological effects on multi-systems [84].

Bilirubin, as a byproduct, is found to exert a beneﬁcial influence on many diseases, including atherosclerosis, inﬂammatory, autoimmune, dege-nerative diseases, and cancer, in which it serves as a highly lipophilic anti-oxidant [85].

Furthermore, Fe, the third product, despite its cytotoxic pro-oxidant effects, induces an over-expression of ferritin, which in turn has strong antioxidant effects through the depletion of free iron, and also other less characterised effects resulting in the induction of tolerogenic dentritic cells [86].

HO-1 protein, variously manifested in endothelial, epithelial, smoothes muscle and other cell types and plays a protective role in many models of disease via its anti-inflammatory, anti-apoptotic and anti-proliferative actions.

(33)

Overexpression of HO-1 has been shown to suppress immune responses and prolong the survival of allografts; however, the underlying mechanism is not clear [83].

Barberat et al. showed that in human pancreatic cancer there was a 6-fold and 3.5-6-fold up-regulation of HO-1 mRNA and protein levels, respect-tively, when compared to the normal pancreatic tissue. Treatment of the pancreatic cancer cell lines with GEM or radiation further induced HO-1 expression. A targeted knockdown of HO-1 expression led to pronounced growth inhibition of the pancreatic cancer cells and made tumor cells significantly more sensitive to radiotherapy and chemotherapy [13].

There is little data published on HuR regulation on HO-1, but we speculated that the expression of heme oxygenase-1 could be also controlled by CUGBP2. Kuwano et al. showed that NO stabilises mRNA subsets in fibroblasts, identified HuR as an RBP implicated in the NO response, revealed that HuR alone is insufficient to stabilise several mRNAs by NO, and showed that HO-1 induction by NO is regulated by HuR [87].

(34)

3. MATERIALS AND METHODS

3.1. Human pancreatic cancer tissues collection

Pancreatic carcinoma tissue samples were obtained from 20 patients undergoing a partial pancreatoduodenectomy (Whipple resection) for pan-creatic carcinoma. The presence of cancerous tissue in samples was con-firmed histologically. Samples of the normal pancreatic tissue were obtained through an organ donor programme from 6 individuals who were free of pancreatic disease. All samples of the normal tissue were obtained from the head of pancreas to ensure comparability with the tumor samples. In all experiments, tissue sections of normal and cancerous pancreas samples were processed simultaneously to ensure comparability in the results. For QRT-PCR analysis, freshly removed tissue samples were placed in RNALater (Ambion; Huntingdon, UK), whereas tissues for protein extraction were snaped frozen in liquid nitrogen in the operating room upon surgical removal and maintained at –80°C until the use.

Ethical approval was issued by the Ethics Committee of the Lithuanian University of Health Sciences (No. BE-2-10 and BE-2-17). Consent for the use of routine blood samples, biopsies, and surgical tissue specimens for the research purposes was obtained from all the patients or their representatives.

3.2. Immunohistochemistry

The antibodies against HuR 1:300 (mouse monoclonal anti HuR (Invitrogen)) and CUGBP2 1:200 (rabbit monoclonal anti Elav type RNA binding protein ETR3 from Abcam (ab186430)) were used for immuno-histological analysis of tissues from healthy donor (n=5), chronic pancreatitis (n=10), PDAC (n=10) and PDAC after neoadjuvant treatment (n=10). Standard staining protocols were used. Paraffin-embedded tumor section was dewaxed with xylene and rehydrated by using alcohol solutions at different concentrations. Endogenous peroxidase activity was quenched with 0.3% hydrogen peroxide in methanol. To block the nonspecific binding, slides were treated with nonimmune normal rabbit/mouse serum (Dako) for 1 hour. All primary antibodies were incubated on slides for 24 hours at 4°C. After washing in TBST, slides were incubated in corresponding biotinylated horseradich peroxidase-labeled secondary

(35)

antibodies (1:200; Dako). Immunohistochemistry was developed using the DAKO Envision+ system (Dako) and counterstained with hematoxylin.

3.3. Cell lines and growing conditions

Human pancreatic cancer cell lines Capan-1, Capan-2, MiaPaCa-2 and Su.86.86 were obtained from ATCC and were used for the analysis. Cells were grown in monolayers in sterile 75 cm2capacity flasks with 5 ml RPMI medium (Gibco/Invitrogen). Flasks with cells were cultured in incubator in a humidified atmosphere of 5% CO2 and 37 °C. Capan-1, MiaPaCa-2, Su.86.86 cells were grown in RPMI medium (Gibco/Invitrogen) with 10% FBS (Gibco/Invitrogen) and 1% penicillin / streptomycin solution (Gibco/ Invitrogen). Capan-2 cells were grown in RPMI medium with 20% FBS and 1% penicillin / streptomycin solution.

Capan-1 was obtained from a liver metastasis of a 40-year-old male

with pancreas adenocarcinoma in the head of the pancreas. Metastases were present in the regional lymph nodes. In athymic mice, Capan-1 tumor produced mucin and was morphologically and biochemically similar to the origin tumor. Although not reported in the original publication, a doubling time of 41 hours was subsequently determined for Capan-1 [88].

Capan-2 originated from a 56-year-old male with pancreatic

adenocar-cinoma. The primary tumor involved the head of the pancreas and infiltrated the duodenal wall distal to the ampulla. The patient underwent pancreatic-tomy, cholecystecpancreatic-tomy, partial gastrecpancreatic-tomy, large and small bowel omen-tectomy and splenectomy. The patient received postoperative chemotherapy and died 6.75 years later [88].

MiaPaCa-2 was derived from pancreatic adenocarcinoma of a

65-year-old man who presented abdominal pain for 6 months and a palpable upper abdominal mass. The tumor involved the body and tail of the pancreas and had infiltrated the periaortic area. The tumor did not express measurable amounts of carcinoembryonic antigen and an alkaline phosphatase stain was negative [88].

SU.86.86 was obtained from a 57-year-old woman with

adenocar-cinoma of the head of the pancreas. There was an extensive liver metastasis, and the tumor specimen was obtained from it. Histological evaluation showed a moderate-to-poorly differentiated adenocarcinoma [88].

(36)

3.4. Gemcitabine (GEM) treatment of pancreatic cancer cells

Cells were cultured in 96-well cell culture plates (3 × 103 cells/well) and were treated with gemcitabine (Eli Lilly, Indianapolis) to each well at separate concentrations of 0, 1, 5, 10, 50, 100, 500, 1000, 2000 and 5000 ng/mL to test the half maximal inhibitory concentration (IC50) of GEM. The treated cells were maintained at 37°C in 5% CO2 for 72 hours. To measure the proportion of living cells, MTT method was used (see ‘Cells viability test’).

IC50 for MiaPaCa-2 was 50 ng/ml, for Su.86.86 – 23 ng/ml, for Capan-1 – 5 µg/ml (Fig. 3.Capan-1). Capan-2 failed the IC50 measurement because of stable viability at the highest GEM concentration. In the following experiments we used IC40 – 5 µg/ml GEM concentration for Capan-2 cell line.

Fig. 3.1. Sensitivity of each cell line to Gem treatment. Capan-2 failing

the IC50, for experiments were used 5 µg/ml gemcitabine concentration.

(37)

3.5. Curcumin treatment of MiaPaCa-2 cells

30 mM curcumin C21H20O6 (MW: 368.38 g/mol) (Sigma) was diluted in dimethyl sulfoxide (DMSO) (Roth) and then at the growing medium. Cells were cultured in 96-well cell culture plates (3 × 103 cells/well) and treated with curcumin (Sigma) at 0, 5, 10, 15, 20, 25, 35 and 50 µM to determine cells viability in 24 hours using MTT method (see “Increased CUGBP2/CELF2 expression sensitises pancreatic cancer cells to gemcitabine treatment via post-transcriptional regulation pathway” ‘Fig. 5b’).

3.6. Cells viability test

Cell viability was assessed by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide) (Invitrogen) method. Cells were incubated with MTT (5 mg/ml) for 4 hours at 37°C with growing medium. After 4 hours incubation, all solution was removed and the formazan product was diluted with 200 µl dimethyl sulfoxide (DMSO) (Roth). The absorbance was measured by using the spectrophotometer (Tecan Sunrise) at a wavelength of 550 nm and reference 620 nm.

3.7. Transfection

CUGBP2, HuR and negative control siRNA were purchased from Ambion (USA). siCUGBP2 sequences: Sense: CCUCUUUAUUUACCACCUUtt Antisense: AAGGUGGUAAAUAAAGAGGtt siHuR sequences: Sense: UUAUCCGGUUUGACAtt

Antisense sequence: UGUCAAACCGGAUAAACGCaa

Transfection was performed when cell cultures reached 70–80% confluence in 96, 6 well plates or 25 cm2 flasks. Lipofectamine 2000 (Gibco/Invitrogen) was used according to the manufacturer’s instructions for all transfections with OptiMem medium (Gibco/Invitrogen). All experi-ments included two groups of control cells – untreated control and negative siRNA treated cells. Transfection efficiency was assessed using Block-iT Alexa Fluor Red reagents (Invitrogen). Silencing efficiency was evaluated

(38)

by Western blot analysis. Transfection of CUGBP2 siRNA was performed 24 hours before the GEM treatment. All assays were performed 72 hours after GEM treatment.

Fig. 3.2. Transfection efficiency was assessed using Block-iT Alexa

Fluor Red reagents. Microscopic observation showed 70–90% transfection efficiency.

(39)

3.8. RNA extraction and real-time polymerase chain reaction (RT-PCR)

Total RNA extraction was performed from tissues and cultured cells using PureLink RNA easy kit (Ambion) and TRI reagents (Zymo), according to the manufacturers’protocol without DNAse treatment. Purified RNA was quantified and assessed for purity by UV spectrophotometry (NanoDrop). cDNA was generated from 1 μg of RNA with High Capacity RNA-to-cDNA Kit (Applied Biosystems). The amplification of specific RNA was performed in a 20 μl reaction mixture containing 1X PCR master mix, primers, 2 μl of cDNA template or 2 μl of RTase negative template for negative control (Table 3.1 and 3.2). The PCR primers used for detection of CUGBP2, COX-2 and HO-1 were obtained from Invitrogen:

CUGBP2: FW TGCTTCAACCCCCAACTCC; REV GTCCTTGCAGAGTCCCGAGA HuR: FW GTGAACTACGTGACCGCGAA; REV GACTGGAGCCTCAAGCCG COX-2: FW GAATCATTCACCAGGCAAATTG; REV TCTGTACTGCGGGTGGAACA HO-1: FW TGCTCAACATCCAGCTCTTTGAGGA; REV CAGGAAACAGCTATGACC

Table 3.1 Amplifications reagents volumes per 1 reaction.

Volume per 1 reaction

TaqMan Universal PCR Master mix 10 µl

20x TaqMan Gen Expression Assay Mix 1 µl

RNAse free water 7 µl

cDNA 2 µl

qRT-PCR analysis (Table 3.2) was performed using ABI 7500 fast Real-Time PCR system (Applied Biosystem).

(40)

Table 3.2 The conditions for qRT-PCR reactions

Thermal Cycler Times and Temperatures

Initial Setup Each of Cycles Denature Anneal/Extend Sequence Detection

Systems (7900HT, 7700, 7000)

HOLD3 HOLD CYCLE

UNG activation 2 min 50°C

10 min 95°C 15 sec 95°C 1 min 60°C

Quantification was performed by delta delta Ct method, while b-actin was used for the normalisation. The PCR products were also loaded onto 2% agarose gels and visualised with ethidium bromide under UV light. RTase-negative samples did not generate CUGBP2, HuR, COX2- or HO1-specific products (Fig. 3.3, 3.4).

(41)

Fig. 3.3. Amplification RT’ase negative controls visualization

on agarose gel: CUGBP2 and HuR

(42)

Fig. 3.4. Amplification RT’ase negative controls visualisation

on agarose gel: COX-2 and HO-1

ROLE OF CUGBP2 AND HUR MEDIATED POST-TRANSCRIPTIONAL REGULATION IN ANTI-CANCER DRUGS RESISTANCE OF PANCREATIC ADENOCARCINOMA

Aldona Jasukaitien

ė

ROLE OF CUGBP2 AND HUR MEDIATED

POST-TRANSCRIPTIONAL REGULATION

IN ANTI-CANCER DRUGS RESISTANCE

OF PANCREATIC ADENOCARCINOMA

Aldona Jasukaitien

ė

CUGBP2 IR HUR

BALTYMŲ

NULEMTOS POTRANSKRIPCINĖS

REGULIACIJOS ĮTAKA KASOS

ADENOKARCINOMOS ATSPARUMUI

PRIEŠVĖŽINIAMS VAISTAMS

CONTENTS

ABBREVIATIONS

INTRODUCTION

1. AIM AND OBJECTIVES

2. REVIEW OF LITERATURE

3. MATERIALS AND METHODS