Chapter 7
LESSONS FROM EXPERIMENTAL GENERATION OF INTRACELLULAR ANGIOTENSINOGEN AND A11
Julia L. Cook, Ph.D.
Richard N. Re, M.D.
Ochsner Clinic Foundation New Orleans, Louisiana
INTRODUCTION
A large body of evidence has accumulated, principally over the
last decade, favoring the existence of both intracellular AT1 receptors
(ATIR) and angiotensin I1 (AII).~-~ However, the h c t i o n and
consequence of intracellular receptor or receptor-ligand complexes has,
until recently, remained ambiguous. Using two alternative approaches,
we have, of late, shown that AII, generated in an intracellular fashion,
can enhance proliferation of cells that express the A T ~ R . ~ . ~ A11 generated
in an intracellular manner can also alter the distribution of the ATIR. In
several cell types that we have investigated, the ATIR (visualized as a
fluorescent fksion protein) is present in the endoplasmic reticulum and
Golgi, and on the plasma membrane. Intracellular generation of AII is
accompanied by a redistribution of the cognate ATI receptor; plasma
membrane associated receptor is diminished and receptor accumulates in
the nucleus. The following reviews the approaches that we have used to
(1) generate intracellular A11 and ATIR, (2) establish that the
intracellular AII is retained and is functionally active within cells that
express the corresponding receptor, (3) demonstrate ligand-mediated
receptor trafficking, and (4) explore signaling mechanisms involved in
altered growth kinetics.
MATERIALS AND METHODS pPreAogen1 pPreAogen,,
Rat preangiotensinogen was PCR amplified using upstream 5'-GATCGACTCGAGGCCACC~ACTCCCACGGGGGCAGGC-3' (ATG start site underlined), downstream primer [Ang(-S)D3] 5'- ACCTATCGAGACCGAGGTACCTGCACCACATTTTGGGGGTTAT C-3' and the rat Aogen clone, gift of K. ~ p c h . ~ ATG'-to-ATC mutant preangiotensinogen was PCR amplified using upstream 5'-GATCGACTCGAGGCCACC~ACTCCCACGGGGGCAGGC-3y and downstream Ang(-S)D3. Products were digested with Xho IKpn I and ligated to Xho I/Kpn I-digested pEGFP-Nl (Clontech, Palo Alto CA) in order to generate pPreAogenlEGFP and pPreAogenATc/EGFP.
An -1 100 bp fragment containing the ATI, receptor (Genbank accession #NM_030985) was RTBCR amplified from rat liver RNA
using upstream primer
5'- G A T C G A A A G C T T G C C A C C A T G G C C C T T C T G C T -3'
and downstream primer
5'- CGAGACCGAGGATCCTGCTCCACCTCAAAACAAGACGC
-3'. The product was 1) digested with Hind III/Bam HI, ligated to Hind III/Bam HI-digested pDsRed2-N1 and designated AT1-RlDsRed2, and 2) digested with Hind III/Bam HI, ligated to Hind III/Bam HI-digested pEYFP-N1 and designated ATJUEYFP.
pEGFP-F encodes a farnesylated EGFP (Clontech, Palo Alto CA). It contains the 20 amino acid farnesylation signal from c-Ha-Ras fused to the C-terminus of EGFP and binds to the inner face of the plasma membrane
7,8.TO generate pFarn/DsRed2, the farnesylation sequence was amplified from pEGFP-F using upstream primer 5'- G A T C G A A A G C T T G C C A C C A T G A A G C T G A T
-3' and downstream primer
5'- CGAGACCGAGGATCCTGGGAGAGCACACACTTGCAGCT-3'.
The PCR amplification product was digested with Hind I11 and Bam HI
and ligated to Hind III/Bam HI-digested pDsRed2-N1. The resulting
pFadDsRed2 possesses the farnesylation peptide fused to the N-
terminus of DsRed2.
Lessons from Experimental Generation of Intracellular Angiotensinogen and AN 75
The complete coding region of the mouse Nrf2 cDNA was ligated downstream of the EGFP gene in the vector pEGFP-C3 to generate pNrfl-FWEGFP
Enzyme Immunoassay
Angiotensin I1 levels were measured using a competitive enzyme immunoassay (Phoenix Pharmaceuticals Inc., Belmont CA) in which a biotinylated AII peptide competes with peptide in standard solution or samples as de~cribed.~
RESULTS AND DISCUSSION
I. Intracellular AII: Is A11 produced within cells or transported into cells?
A number of studies suggest that intracellular AII, ATtR andlor A1I:ATlR receptor:ligand complexes exist and may be functionally a ~ t i v e . ~ - ~ In the conventional paradigm, angiotensinogen (Aogen), generated from preangiotensinogen, is channeled through the secretory pathway and processed to A11 extracellularly. Since receptors for uptake of AT1 have not been identified, the existence of intracellular A11 necessitates an alternative paradigm. Three possible paradigms follow.
(I) Paradigm 1: Intracellular AII is generated from an alternative form of non-secreted angiotensinogen. Alternative translation products, resulting in extracellular and intracellular active peptides exist for many different proteins. Often these are generated through alternative translation start site ~ s e . ' ~ " ' ~
The AVAII encoding portion of preangiotensinogen lies
immediately downstream of the signal peptide-encoding region. Signal
peptides contain hydrophobic core domains and, acting as biological
addresses, direct proteins to the ER transl~con.'~.'~ Signal peptide
truncation by alternative translation start site selection could produce a
non-secreted form of angiotensinogen. Indeed Corvol and ~ o l l e a ~ u e s ' ~ - ' ~
have found cell-free translation of rat liver RNA in a rabbit reticulocyte
lysate sytem to yield two products (around 52,500 and 55,700). These
products are reduced to a single electrophoretic band upon treatment with renin. Therefore, the investigators have suggested that the size difference must reflect a difference in the pre-region (signal peptide). Examination of the DNA sequence between the transcription start site and the
~ ~ ~ ( h 4 e t ' ) translation start site, reveals the existence of no additional in-frame AUGs. Since there also exist no in-frame AUG codons within the signal peptide (excepting, of course, the classically identified AUG at position I), we asked whether translation might be initiated at a non- classical or non-canonical codon. Our inspection of the signal sequence of the Aogen precursor indicates the existence of three in-frame CUGs (Fig. 1). A number of studies show that non-canonical CUG sequences may function as alternative translation start sites. All three of the CUG codons in the Aogen signal-encoding sequence are present in the context of a perfect Kozak consensus sequence [PuNNAUGPu, where conservation of the purines (Pu) is ~ritical,2~]. This context has been found to be crucial for non-AUG as well as AUG start site cod on^.^'
1 10 20
mt m r pro Thr ~ i y ma ~y Leu LYO ma Thr ue ~ h s cys Ile LOU Thr Trp V ~ I ser lffi ACU CCC A m G W GCA GfC M G GCC ACC AUC UUC P C AUC QACC ffiG GUC AGf
Figure I . The 5'-end of the rat Aogen transcript. AI/AII-encoding region and downstream in-frame CUG(Leu) codons are indicated in boxes. Upstream in-frame CUGs are underlined.
1 20 40 60
30 40
Non-AUG translation start codons have been found to generate proteins of bFGF, FGF-3, c-myc 2/c-myc 1 among others.
10-12,14Translation of these mRNAs can start at AUG or an alternative codon (the most commonly used of which is CUG) and the choices often determine the subcellular localization of the resulting proteins. Most notably, the parathyroid hormone-related peptide transcript, the protein of which may be secreted or localized to the nucleus, possesses in-frame non-AUG (CUG and GUG) codons within the signal peptide (as does the pre-Aogen t r a n ~ c r i ~ t ) . ' ~ Use of these alternative translation start sites results in loss of the signal peptide and retention of the translated PTHrP.
Since a nuclear localization signal lies mid-region in the PTHrP protein, those peptides that are not secreted are necessarily localized to the nucleus. Therefore, PTHrP is either secreted or translocated to the
LW ~ h r Ala ~ i y
lJ
ACA GCU GGCI I
F
ASP mo vs ~r us nfs pro phe nis reu CAC CGC GUA UAC AUC CAC CCC UUU W U CUC
~ e u Tyr Tyr ser ryr ssr Tnr ~ y s ma CUC UAC UAC AGC M G AG ACC UCC GCC
Lessons from Experimental Generation of Intracellular Angiotensinogen and All 77 nucleus based on translation start site choice. By comparison, human bFGF is either retained in the cytoplasm or transported to the nucleus based upon alternative translation start site usage.10
We performed theoretical translations of the Aogen precursor from each of the three in-frame CUGs within the signal peptide.
Theoretical translation from the first (most 5') in-frame CUG [cuG(L~u*)] results in elimination of only seven amino-terminal amino acids. A cleavable signal peptide is still recognizable in this protein using the internet search tool, PSORT (http://us.expasy.org/). The second in- frame CUG [cuG(L~u'~)] results in elimination of the first 15 amino acids and the theoretical translation product shows no N-terminal signal peptide by either of two different signal prediction methods (PSG and GvH:von Heijne's method). Indeed, this translation product is predicted to be primarily cytoplasmic by Reinhardt's method and the k-NN prediction. The predicted size of the full-length pre-Aogen product is 52 kDa and that translated from the second CUG of the signal peptide is 50.5 kDa (using Peptide Mass program, Expasy).
We asked, therefore, whether any of the alternative in-frame CUGs in the signal peptide might be used to generate a non-secreted angiotensinogen. A common method for investigating potential alternative translation start sites which might be active in specific cell types and/or under particular conditions is mutation of the primary translation start site or candidate alternative sites followed by examination of the transfected DNA translation products.
Therefore, we mutated the archetypal ATG at position 1 to a non-initiator
ATC in order to select for translation from alternative potential start
sites. PreAogenATc was then ligated upstream of EGFP in an EGFP
expression plasmid. A major alternative protein product (- 68 kDa) is
generated from expression of this construct in COS cells (Figure 2). As
the EGFP moiety is 30 kDa, the Aogen moiety is necessarily -38 kDa
and is generated from a start site considerably downstream from the
AIIAII encoding portion of the mRNA. A T G ( M ~ ~ ~ ~ ) is present in the
context of a Kozak consensus sequence and theoretical translation of this
product (Aogen 99477) is consistent with the size of our major protein
product by Western blot. However, a minor product of 80 kDa is also
generated. Deduction of the 30 kDa GFP moiety size, provides for an
Aogen moiety of 50 kDa, a size consistent with generation of an
alternative product from the second in-frame CUG. This product would,
in theory, both be retained intracellularly and possess the AVAII-
encoding region. Note that we do not know whether either of these
products is formed in native cells. However, the larger of these
products is consistent with intracellular Aogen and AII generation
through alternative start site use. It is also possible that the alternative
99-477
translation product Aogen is generated under some conditions and may have functional relevance; since this product does not contain the AI/AII sequence, however, any .function would necessarily be independent of intracellular AII.
-Figure 2. Western blot of COS cell extracts 48 h post-transfection with indicated plasmids. Blots were screened with anti-GFP antibody (Santa Cmz Biotech. Inc.)
and HRP-conjugated rabbit anti-ZgG (ECL kit). The band sizes of the preAogenATc/EGFP products, by regression analysis are 80 and 68 kDa. Assuming a GFP moiety size of -30 kDa, these correspond to Aogen sizes of 50 and 38 kDa. Note that no product is observed in cells transfected with pPreAogen/EGFP. Indeed, we find preAogen/EGFP to be rapidly traficked through the secretory pathway;
AogedEGFP is not strongly detectable in COS cells using fluorescence microscopy either, except following application of a cold block.' Lanes
1,2: 50 ug: Lanes 3, 6:
1ug: Lane
4:100 ug; Lane 5: 90 ugprotein.
Do we have any evidence for intracellular retention of a native or
experimentally unaltered form of Aogen? Our prior published studies
show that AogedEGFP is not visible within cells at 24 h post-
transfection except upon application of a cold block. Cold-induction
slows the rate of transport of Aogen through the secretory pathway
Lessons from Experimental Generation of Intracellular Angiotensinogen and AII 79 permitting accumulation to visible levels. However, at 48 h post- transfection, even in the absence of a cold-block, a low-level of diffuse cytoplasmic fluorescence is observed in COS and CHO-Kl cells. This may argue for the presence of an alternative, intracellular form of Aogen in these cells; this form of Aogen could accumulate to higher levels depending upon the cell type and culture or in vivo conditions.
(2) Paradigm 2: Intracellular AII is generated from angiotensinogen after internalization of angiotensinogen from the extracellular space. The recent report of the existence of an Aogen receptor on the placenta-derived cell line, cRL-7548,22 provides evidence in favor of this model. Furthermore, it has been shown that A11 and renin coexist in the storage granules of kidney juxtaglomerular cells.
These cells do not express angiotensinogen and an ATI receptor blocker does not block intracellular A11 accumulation; Mercure and c0lleagues,2~
therefore, suggest that angiotensinogen may be internalized into JG cells.
In addition, Peters and associates24 have demonstrated that adult cardiac myocytes internalize unglycosylated prorenin after which intracellular angiotensins are generated. In corresponding control experiments they show that angiotensins supplied in the culture medium are not internalized; intracellular angiotensins are likely generated from intracellular angiotensinogen. This is certainly an area that merits further investigation.
(3) Paradigm 3: Intracellular AII is present and active in cells after receptor-mediated internalization and escape from the endosomes.
Endosomal escape is a well-established but poorly understood concept.
There exists a general consensus that polycation-DNA complexes enter cells via endocytotic pathways and that endosomal escape into the nucleus precedes DNA expression, but the technicalities are yet undefined. Presumably, receptors or receptor:ligand complexes can similarly escape endosomes and enter the nucleus and, indeed, the mechanisms by which this might occur have been discussed at length (for re vie^^^‘^'). A nuclear localization signal (NLS) consensus homology, which appears to be functional by competitive peptide studies, has been identified in the cytoplasmic tail of the ATI receptor and may play a role in nuclear localization of the receptor andlor receptor:ligand complex.28
Regardless of the mechanism by which AII is generated or
imported, it does accumulate to significant levels within cells. We
sought, therefore, to identify the functional significance of intracellular
A11 by devising experimental methods for generation of intracellular AII
exclusive of extracellular AII.
11. Strategies for experimental generation of intracellular A11
a. Ang(-S)Exp/pSVL, Ang(-S)Cntr/pSVL
To investigate the potential for (and subsequent effect of) Ang I1 generation within cells, we mutated a rat Aogen cDNA and ligated it into an expression plasmid (pSVL) to produce a nonsecreted (-S) form of Aogen (Figure 3 ~ ) . ~ Ang(-S)Exp lacks the N-terminal signal sequence required for secretion. Ang I1 produced from this protein is, in theory, generated through an intracrine mechanism and processing of Ang(- S)Exp to AII requires intracellular renin and ACE or equivalent enzymes. The corresponding control Ang(-S)Cntr lacks both the signal sequence and part of the AVAII-encoding portion. We have shown that the fluorescent fusion products of both of these proteins are retained intracellularly and accu&ulate to high levels.'
cDNA (bp)
Rat PreAngiotensinogen cDNA
M - - - 4 D R V Y l H P F H L
Figure 3. (A) Illustration of the rat preAogen cDNA, corresponding protein domains/features and relative positions of amplijkation primers used to generate Ang(- S)Exp and Ang(-S)Cntr products. [Upstream primer
=Ang(-S) U1, downstream primer
=Ang(-S)D, PCR product
=Ang(-S)Exp]. [Upstream primer
=Ang(-S)U2, downstream primer
=Ang(-S)D, PCR product
=Ang(-S)Cntr]. Ang(-S)Exp represents a mutated Aogen which lacks a signal sequence (non-secreted) but possesses an intact AI domain.
Ang(-S)Cntr represents an Aogen clone with a mutated AI domain. The signal peptide
extends from M (methionine at amino acid position 1) to G (glycine at amino acid
position
24).Lessons from Experimental Generation of Intracellular Angiotensinogen and AII 8 1
...
TAC AAG TCC GGA CTC AGA TCT CGA GCT CAA CCT TCA GAC CGC GTA TAC ATC CAC CCC l T T TAGI I I I I I I I I I I I I I 1 I I l l
...
ECFP Arg Gly Leu Arg Ser Arg Ala Gln A h Ser Asp Arg Val Tyr Ile His Pro Phe***
J M
spacer A11
...
TAC AAG TCC GGA CTC AGA TCT CGA GCT CAA GCT TCA TAC GAC CAC CGC GTA m ccc ATC TAGI I I 1 I I I I l l I I I I I I I l l
...
ECFP Arg Gly Leu Arg Ser Arg Ala Gln Ala Ser Tyr Asp His Arg Val Phe Pro Ile***
I -
spacer Allc
Figure 3. (B) Illustration of expression plasmids encoding fluorescent fusion proteins.
pECFP/AII
(i)andpECFP/AIIc
(ii)(encodes scrambled control O ~ A Z I ) . ~
b. ECFPIAII
In order to determine the effects of intracellular A11 on COS-7 and CHO-K1 cells we designed and generated a fusion construct of the A11 peptide-encoding sequence with enhanced cyan fluorescent protein (blue fluorescence) (see Figure 3B for plasmid illustration). As a control, we prepared a similar plasmid encoding a peptide of scrambled AII sequence fused to ECFP (Figure 3B). In each case, the encoded peptide is separated fiom ECFP by a ten amino acid spacer arm. ECFPIAII proved to be reactive to both anti-A11 and anti-EGFP antibodies as determined by western blot confirming the presence and integrity of both domains in the expressed fusion protein.2
Three-dimensional models for ATIR in complex with AII~~"'
suggest that the peptide ligand is at least partially buried in the receptor
binding pocket suggesting that the ligand might function poorly as a
fusion protein. However, Hunyady and colleagues3* have shown that an
AII-labeled fluorophore which possesses, at the amino-terminus, the
bulky multi-aromatic ring structure, rhodamine, retains functional
integrity. In addition, Yadav and associates33 have investigated at length
the specific properties of rhodamine conjugated at the ~~s~ (substituted
for Val) position of AT1 and show it to be biologically active, to bind to
the receptor and to be internalized efficiently. Consistent with these observations, in the present study, N-terminal ECFP-conjugated AII appears to retain intracellular biological activity.
While a number of studies have utilized ATIR fusion proteins with variable results, to our collective knowledge, this is the first study to employ an angiotensin I1 fluorescent fusion protein and to monitor its effects upon receptor distribution and signal transduction.
111. Growth kinetics of transfected cells
a. Expression of intracellular A11 in cells which express native receptor
We have shown that intracellular A11 expressed as Ang(-S)Exp is growth stimulatory for cells which possess native ATIR and enzymes required to process Aogen to AII.~ Expression plasmids Ang(- S)Exp/pSVL and Ang(-S)Cntr/pSYL were transiently transfected into H4- 11-E-C3 rat hepatoma cells and mitotic indices measured at 48 h post- transfection. Ang(-S)Exp/pSVL consistently increased nuclear labeling by approximately 20% (p < 0.05) in six separate experiments. The control plasmid, Ang(-S)Cntr/pSVL, had no effect upon nuclear labeling. Stably integrated Ang(-S)Exp/pSl?L increased labeling an average of 33% (p <
0.00 1) over Ang(-S)Cntr/pSVL.
Anti-A11 antibodies completely suppressed exogenous AII-
induced proliferation of H4-11--EX3 naive cells but failed to inhibit
growth of Ang(-S)Exp/pSZ stably-transfected cells verifying that Ang
I1 generated by the transgene is not exported and does not act through an
extracellular mechanism. Furthermore, we show by A11 EIA that Ang(-
S)Exp expression in H4-11-E-C3 cells substantially enhances intracellular
A11 levels while no increase is detectable in the medium (Figure 4).
Lessons from Experimental Generation of Intracellular Angiotensinogen and AII 83
All EIA
transfrrcted cells
I
media from transfected cells
!&!&I medium with All (10-9 molll)
'imre 4. Cellular AII levels were determined in mock-H4-11-E-C3 cells and those stably
L
F
-transfected Ang(-S)Exp/pSVL or Ang(-S)Cntr/pSVL using Phoenix Pharmaceutical EIA kit (linear range of 0.1
-0.8 ng/ml) with human antibody. Percent cross-reactivity to AI
=