SUPPLEMENTARY FIGURES
Supplementary Figure 1
Supplementary Figure 1: Related to figure 1 and figure 2
a) PET/CT analysis of 11C-MHED uptake in denervated iBAT lobe of mice (n=6) pre- treated with vehicle or desipramine (10 mg/kg i.p.) 30 min before tracer injection.
b) Western Blot and densitometric analysis of UCP-1 levels in iBAT of mice acclimated either at 21°C (n=6) or at 26°C (n=6). Relative UCP-1 values for densitometric analysis were determined by normalization for the housekeeping protein GAPDH. ** p<0.005 vs 26°C.
c) Western Blot and densitometric analysis of UCP-1 levels in iBAT of animals chronically treated either with vehicle (n=6) or with CL316,2431 (1 mg/kg die, n=6) for 4 weeks. * p<0.05 vs vehicle.
d) Analysis of 11C-MHED uptake (SUV) in SNS denervated iBAT depots of mice (n=5) analyzed by three repeated PET/CT imaging sessions (1 week of recovering between the scans). In session 1 animals were treated with vehicle, in session 2 mice were treated with CL316,243 (1 mg/kg). In session 3 mice were treated with CL316,243 + SR59230A.
CL316,243 was administered 1 hour before 11C-MHED injection. SR59230A pre-treatment (5mg/kg per os) was performed 1 hour before CL316,243 injection.
e) Analysis of the percentage of increase in 18F-FDG SUV values after CL316,243 treatment, as in figure 2h. SUV values for SD and HFD vehicle treated mice were cumulated since they were not statistically different. * p<0.05 vs SD + CL316,243, ***
p<0.0005 vs vehicle.
Supplementary Figure 2 a)
b) c)
Supplementary Figure 2: Related to figure 3
a) Coronal (top) and transverse (bottom) views of PET/CT fused (left) and CT (right) images showing 11C-MHED and 18F-FDG accumulation in the inguinal subcutaneous white adipose tissue (i.s. WAT, arrows) of a representative mouse chronically treated with vehicle for 4 weeks. Radioactive counts are expressed as SUV. Red lines indicate the image sections reported in the transverse views.
b) Analysis of 11C-MHED uptake in the of C57BL6 mice chronically treated with vehicle (n=5) or with CL316,243 (1 mg/kg die) (n=6), and analyzed after 3 weeks or 4 of CL316,243 administration. SUV values for mice treated for 3 and 4 weeks with vehicle were cumulated since they were not statistically different.
c) MicroCT analysis of the i.s. WAT density (Houndsfield Units) in C57BL6 mice after 3 or 4 weeks of CL316,243 or vehicle administration, in the same animals shown in supplementary figure 2b. ** p<0.005 vs vehicle. * p<0.05 vs vehicle or animals treated with CL316,2434 for 4 weeks.
Supplementary methods
RNA extraction and semi-quantitative real-time RT-PCR
Subcutaneous inguinal WAT or interscapular BAT from 20wk-old mice were dissected and quickly frozen in N2 upon sacrifice and then stored at -80°C for subsequent total RNA extraction. Total RNA from WAT or BAT was isolated individually using the TRIzol reagent (Life Technology Italy, Monza, IT) and quantified spectrophotometrically at 260/280 nm.
The integrity of all RNA samples was evaluated on a 0.8% agarose gel. Semi-quantitative real-time RT-PCR (qPCR) assays were performed in triplicate and a standard curve from consecutive 5-fold dilutions of a cDNA pool representative of all samples was included.
The first-strand cDNAs were synthesized from 1 μg of total RNA using oligo-(dT)20 primers and the Superscript III RT kit at 50°C for 60 mins, according to the manufacturer’s protocol (Life Technology Italy, Monza, IT). qPCR analysis was performed using the iQ Sybr Green Supermix (BioRad, Hercules, California, USA) and primers for the genes of interest with iCycler (BioRad) instrumentation and software. Relative expression analysis was corrected for PCR efficiency and normalized to the reference gene TBP.
Primer sequences were as follows: Tbp F-actcctgccacaccagcttctga, R- tgactgcagcaaatcgcttggga, 60°C,154bp; UCP-1 F-acctgcctctctcggaaacaag, R- ttctgaccttcacgacctctgtag, 60°C, 95 bp; PGC-1 F-tctgggtggattgaatggtgtag, R- gtgtctctgtgaggaccgctag, 60°C, 156bp.
Immunoblotting
Approximately 50 mg of a given tissue sample were homogenized in T-PER Tissue Protein Extraction (Pierce), to which 1x protease and phosphatase inhibitors (Roche), 1mMNaVO4 and 1mMNaF were added. Tissue lysates were then centrifuged at 15,000 xg for 15 min to remove lipids and insoluble debris. Protein concentrations were analyzed using the BCA
reagent (Pierce), and the volume required for 50 µg of protein was determined. Samples were then separated by SDS-PAGE under reducing conditions and transferred to PVDF membrane (Millipore). The PVDF membranes were stained with Ponceau S (to visualize protein bands), followed by immunoblot analysis. Horseradish peroxidase-conjugated rabbit or mouse secondary antibody was used to visualize primary antibodies with the SuperSignal substrate (Pierce). Blot images were obtained using Molecular Imager ChemiDoc XRS+ (Biorad) and signals were quantified using Image Lab version 3.0.1 software.
Histological and Immunohistochemical analysis
Tissue specimens were fixed in 10% phosphate buffered formalin for histological and immunohistochemical analysis. Either BAT or WAT underwent standard hematoxylin-eosin staining for morphological analysis. Formalin fixed, paraffin embedded fat tissue samples were cut into 5µm sections. After deparaffinization and inhibition of endogenous peroxidase activity, slides were subjected to antigen retrieval in citrate buffer (pH 6) and then incubated with 10% of normal goat serum for 45 min. Sections were stained o.n. at 4°C with rabbit polyclonal anti-TH antibody (1:400; Millipore), primary antibodies were revealed using a commercially available avidin-biotin-immunoperoxidase staining system (Vectastain Elite ABC Kit, Vector Laboratories, USA). In the negative controls, the immunostaining was performed without the primary antibody.
Sections evaluations were performed at magnifications of 10x , 20x and 40x using an image cytometer consisting of a single 2/3” CCD colour camera (JVC Professional Europe, UK) mounted on a microscope (DMLB microscope, Leica Microsystems, Germany) equipped with a motorized scanning table (Märzhäuser, Germany) controlled by Cytometrica software (C&V, Italy).
