MICROBIOLOGIA MEDICA, Vol. 24 (4), 2009
252
La K. pneumoniae carbapenemase (KPC) appartiene alle ß-lattamasi di classe A (contenenti serina) che appartengono al gruppo funzionale 2f. Segnalate per la prima volta in USA nel 2001(1) sono state identificate successivamente anche in Europa.
I ceppi KPC sono tipicamente resistenti alle penicilline, alle cefalosporine a spettro esteso ed all’aztreonam (2,3) presentano un comportamento peculiare nei confronti dei carbapenemi: le MIC sono prossime alla sensibilità o bor-derline (eccezion fatta per ertapenem).
A questo pattern si associa spesso la resistenza ai chinolo-nici. L’informazione della resistenza è veicolata da plasmi-di (4,5), cio’ spiega sia la loro estrema plasmi-diffusibilità, sia l’implicazione delle KPC negli outbreaks. Nonostante la loro diffusione ad oggi esistono solo rari casi di segnala-zioni di isolamenti di questo fenotipo in Italia. Scopo del presente lavoro è quello di presentare due casi clinici rela-tivi all’isolamento di KPC nel nostro ospedale.
Le due KPC sono state isolate: la prima da una coltura di CVC in un paziente affetto da morbo di Crohn, la seconda in un campione di urina in una paziente cateterizzata colpi-ta da Ictus. Nessun paziente aveva una storia recente di viaggi all’estero.
I ceppi sono stati caratterizzati mediante Vitek 2 ed E-test (bioMérieux) (figura I). Il fenotipo è stato confermato mediante l’esecuzione del saggio di Hodge (6) (figura I) e PCR blaKPC Gli ampliconi ottenuti sono stati in segui-to sequenziati usando i seguenti primers: per la regione proteica da aa 89-399
F-5’CGGAACCATTCGCTAA-ACTC3’ e R- 3’GGCGGCGTTATCACTGTATT5’; per la regione proteica da aa 372 - 874 F- 5’CGCCGTGCAA-TACAGTGATA3’ e R-3’CGTTGACGCCCAATCC5’ (8). Le sequenze sono state analizzate mediante ABI Prism 310 (Applied Biosystems), e comparate con la banca dati National Center for Biotechnology Information database (http://www.ncbi.nlm.nih.gov/). La relazione genetica fra gli isolati è stata determinata mediante Rep-PCR usando il sistema DiversiLab (bioMérieux) (figura II).
Entrambi gli isolati sono risultati resistenti alle beta-latta-mine, ai chinolonici, all’ertapenem, ma sensibili ad imi-penem, meroimi-penem, tigeciclina e colistina. Il test di Hodge è risultato positivo (figura I) ed il sequenziamento ha evidenziato il genotipo KPC 2 (7,8).
I due isolati (indicati nella figura II con i numeri 1 e 2) mostravano relazione clonale. Entrambi i pazienti sono stati trattati con successo con tigeciclina. Nel presente studio presentiamo anche le farmaco sensibilità ai princi-pali antimicrobici di altri isolati di K. pneumoniae. In totale abbiamo caratterizzato 149 K. pneumoniae (dal Dicembre 2008 ad oggi) di cui 7 esibivano un comporta-mento KPC-like.
Delle sette sospette KPC (totale 4 pazienti, escludendo i duplicati) solo due si sono confermate con fenotipo KPC. Nella figura III sono illustrate le farmaco sensibilità glo-bali in cui si evidenzia anche una ridotta sensibilità alla tigeciclina. Nella figura IV sono illustrate le farmaco sen-sibilità solo dei 4 isolati KPC-like. Nella figura V le far-maco sensibilità delle due KPC.
EMERGENCE OF KPC-PRODUCING KLEBSIELLAE PNEUMONIAE
Klebsiella pneumoniae KPC: first isolations in Italy
Carla Fontana1,2, Marco Favaro1, Loredana Sarmati3, Silvia Natoli 4, Anna Altieri2, Maria Cristina Bossa2,
Silvia Minelli2, Cartesio Favalli1,2
1 Department of Experimental Medicine and Biochemical Science University of Tor Vegata Rome
2 Microbiology Lab, Polyclinic Tor Vergata Foundation
3 Infectiouse Disease, Polyclinic Tor Vergata Foundation
4ICU, Polyclinic Tor Vergata Foundation
Key words: Klebsiella pneumoniae, PCR, KPC, Hodge’s test
Klebsiella pneumoniae KPC: primi isolamenti in Italia
SUMMARY
Klebsiella pneumoniae carbapenemase (KPC) was detected in two isolates of carbapenem-resistant K. pneumoniae in an italian teaching hos-pital. This is the first report of a KPC-producing isolates in our country. The first strain was isolated from a urine sample collected from a indwelling urinary catheter in a ICU-patient with subdural haematoma, while the second was from the culture of the central venous catheter (CVC) in a patient affected by Crohn’s disease admitted in gastroenterology ward. Both were resistant to all ß-lactams, susceptible to imipen-em and meropenimipen-em and resistant to ertapenimipen-em.They were resistant to other classes of non-ß-lactams antibiotics such as quinolones, amino-glycosides (with the exception of amikacin), trimethoprim-sulfamethoxazole (TMP-SMX) as well as to nitrofurantoin.The isolates were not associated with travel abroad. They were found to contain the plasmid encoded carbapenemase gene blaKPCand were also positive to the
Hodge’s test.The detection of KPC-producing bacteria has important implications in infection control and public health.
The K. pneumoniae carbapenemase (KPC) belong to class A ß-lactamases of the functional group 2f. Reported for the first time in U.S. in 2001, these agents were subsequently identified in Europe. KPC strains are typically resistant to penicillins, extended-spectrum cephalosporin and aztreonam and present a peculiar behavior against carbapenems in that MIC is close to the susceptibility value or is borderline (except for ertapenem).This pattern is often associated with resistance to quinolones.The information is conveyed by the resistance plasmids, thus explaining their diffusion and implication in outbreaks of KPC. Despite this, to date there are few reports concerning the isolation of this phenotype in Italy.The purpose of this paper is to present two clinical cases related to the isolation of KPC in our hospital.
The KPC-producing strains have been respectively isolated: the first in a patient with Crohn’s disease, and the second in a patient with a subdural haematoma. Nono of these patient had a recent history of travel abroad. The strains were characterized by Vitek 2 and E-test (bioMérieux). The phenotype was confirmed through the execution of the Hodge’s test and by PCR blaKPC. The genetic relationship between isolates was determined by Rep-PCR.
Both isolates were resistant to ß-lactams, quinolones and ertapenem, and were susceptible to imipenem, meropenem, tigecycline and col-istin. The Hodge’s test was positive and the sequence analysis of the blaKPC gene revealed a KPC gene type 2. The fingerprinting showed that the isolates were clonally related. Both patients were successfully treated with tigecycline.
KPC represents a real challenge either for the clinicians, who have limited therapeutic options to treat infections due to this microorgan-ism, and for the laboratory, since their correct identification is necessary to reduce the dissemination of the pathogen.
Corresponding author: Marco Favaro
253
MICROBIOLOGIA MEDICA, Vol. 24 (4), 2009 FONTANA C, FAVARO M, SARMATI L, et al
Figura I. Test di Hodge ed E-test
MICROBIOLOGIA MEDICA, Vol. 24 (4), 2009
254
Le KPC rappresentano un vero dilemma per il clinico che
vede ridotte le possibilità terapeutiche, ma lo sono ancor di più per il laboratorio in quanto la loro rapida e corretta iden-tificazione è essenziale per contrastarne la diffusione. EMERGENCE OF KPC-PRODUCING KLEBSIELLAE PNEUMONIAE
Figura III. Farmaco sensibilità globale dei 149 isolati
Figura IV. Farmaco sensibilità dei 4 isolati KPC - like
MICs (mg/ml)
Isolati AMP AMC PIP PTZ CAZ CTX FEP IPM MEM EPT AMK CIP TGC CS TMP-SMX NT
Isolato caso 1 32 32 128 128 16 64 16 1 2 8 2 8 1 0.5 320 512
Isolato caso 2 32 32 128 128 16 64 16 1 2 8 2 8 1 0.5 320 512
Figura V. Farmaco sensibilità delle due KPC
255 MICROBIOLOGIA MEDICA, Vol. 24 (4), 2009
BIBLIOGRAFIA
1. Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases: Clin Microbiol Rev 2007, 20:440-58.
2. CLSI (Performance Standards for antimicrobial susceptibility testing): Clinical and Laboratory Standards Institute: Performance standards for antimicrobial susceptibility testing. Sixteenth informational supplement, M100-S19. 2009, Clinical and Laboratory Standards Institute, Wayne, PA. 3. Evaluation of methods to identify the Klebsiella pneumoniae
carbapene-mase in Enterobacteriaceae: J Clin Microbiol 2007, 45:2723-5 Hossain A, Ferraro MJ, Pino RM, Dew RB II I, Moland ES, Lockhart TJ, Thomson KS, Goering RV, and Hanson ND:
4. Plasmid mediated carbapenem-hydrolyzing enzyme KPC-2 in an Enterobacter sp. Antimicrob Agents Chemother 2004,48:4438-4440.
5. Goldfarb D, Harvey SB, Jessamine K, Jessamine P, Toye B, Desjardins M: Detection of plasmid mediated KPC-Producing Klebsiella pneumoniae in Ottawa, Canada: Evidence of Intra-Hospital Transmission. J Clin Microbiol 2009, 47(6):1920-2
6. Anderson KF, Lonsway DR, Rasheed JK, Biddle J, Jensen B, McDougal LK, Carey RB, Thompson A, Stocker S, Limbago B, Patel JB. Bratu S, Landman D, Alam M, Tolentino E, and Quale J:Detection of KPC car-bapenem-hydrolyzing enzymes in Enterobacter spp. From Brooklyn, New York. Antimicrob Agents Chemother 2005, 49:776-778.
7. Poirel L, Pitout JD, Nordmann P: Carbapenemases: molecular diversity and clinical consequences. Future Microbiol 2007, 2:501-12
8. Naas T, Cuzon G, Villegas MV, Lartigue MF, Quinn JP, Nordmann P: Genetic structures at the origin of acquisition of the beta-lactamase blaKPC gene. Antimicrob Agents Chemother 2008, 52(4):1257-63.