Results and Discussion

Results and Discussion

The antigens production: proteasome subunits expression.

Primers design and PCR amplification

To produce the antigens used for antibody phage-display selection, the cDNA of

proteasome subunits α2, α4, α7, β1, β1i and β7 were amplified by PCR and inserted

into the pTriEx-4 Ek/LIC Vector. This vector (Fig.24) does not require any restriction

enzymes but needs some specific flanking sequences on the insert. These sequences

were considered in designing appropriated primers by Vector NTI program, as

table3 shows.

PCR reaction was performed as described in materials and methods chapter. After

PCR amplification, an electrophoresis on agarose gel was run, to verify the result

and the specificity of amplification (see Fig.23). Proteasome subunits lengths is 730nt

for α2 subunit, 810nt for α4, 770nt for α7, 750nt for β1, 845nt for β1i and 855nt for β7;

as expected all amplification products give an electrophoresis band between 700 and

900bp (see fig 21, 22 and 23 plus table4). Figure 23 show a primer specificity test. β1i

primers were incubated with three different un-specific substrates (asp1, asp2 and

asp3) to verify their specificity. Primers gave amplification only when incubated

with β1i cDNA, none with the others templates. Where there is not amplification,

the primers bands are clearly visible.

Table3. Primers used to amplify cDNA with PCR.

The cDNAs came from RZPD (Deutsches Ressourcenzentrum für Genomforschung, German Resource Center for Genome Research). cDNA sequences were cloned into bacterial vectors, amplified in liquid cultures, purified and store in the freezer. Then purified plasmids were used for the PCR amplification and proteasome subunits production.

f indicates forward primers. r indicates reverse ones.

Subunits Primer

Ordered primers

β1

_{PSMB1_LIC_f}

GACGACGACAAGAT

_ATTCGGC

GTTGTCCTCTACAGCCATGT

PSMB1_LIC_r

GAGGAGAAGCCCGGT

TCCTTCCTTAAGGAAACA

GTTTCCTCCCTG

β1i

_{PSMB1i_LIC_f}

GACGACGACAAGAT

_C

GCTCATAGGAACCCCCACC

PSMB1i_LIC_r

GAGGAGAAGCCCGGT

TGATTGGCTTCCCGGTACT

GGTG

α2

_{PSMA2_LIC_f}

GACGACGACAAGAT

_CGGGTAC

GGCGGAGCG

PSMA2_LIC_r

GAGGAGAAGCCCGGT

GCTATGGCAGCCAAGTAA

TCCTTAACTTC

α4

_{PSMA4_LIC_f}

GACGACGACAAGAT

_AGGACCAC

GTCTCGAAGATATGACTCC

PSMA4_LIC_r

GAGGAGAAGCCCGGT

TTATCCTTTTCTTTCTGTTC

TTTTTCTTTCTTCTC

α7

PSMA7_LIC_f

GACGACGACAAGAT

GAGCTACGACCGCGCCATC

PSMA7_LIC_r

GAGGAGAAGCCCGGT

CTTTTCGTTTTC

GATGCTTTCTTTTGTTTCTT

β7

PSMB7_LIC_f

GACGACGACAAGAT

GGCGGCTGTGTCGGTGTATG

Table4. Technical specifications of the proteasome subunits cDNA.

Start

End

Subunit Length

PCR

Vector

alfa

2

3

707

705

730

5945

4

70

855

786

810

6025

7

74

820

747

770

5990

beta

1

38

764

727

750

5970

1i

238

1057

820

845

6060

7

15

845

831

855

6070

Fig21. Human cDNA PCR products of α2, α4, α7 and β7 subunits. Samples result between 1033 and 653 bp. They should be all in a range of 900-700bp

Fig22

Human cDNA PCR product of β1 subunit. According to electrophoresis gel the proteasome subunit is between 1033 and 653bp. Indeed it is 750bp.

The marker used was the DNA marker MVI

Fig23 Primers Specificity.

None amplification for unspecific samples asp1, 2 and 3 but only for the specific template β1i cDNA. Where there is not amplification the primer bands are visible.

After the amplification, PCR products were purified by the DNA purification kit

which uses a selectively permeable membrane to separate DNA from the other PCR

reagents. Sample concentration was then measured by spectrophotometer. Using the

Beer Lambert Law it is possible to relate the amount of light absorbed to the

concentration of the absorbing molecule. At a wavelength of 260 nm, the average

extinction coefficient for double-stranded DNA is 0.020 (μg/ml)

-1

_cm

-1

_{; thus, an}

optical density (or "OD") of 1 corresponds to a concentration of 50 μg/ml for

ds-DNA.

An indicative measure of DNA solution purity with respect to protein

contamination is given from the ratio of absorptions at 260nm versus 280nm, since

protein (in particular, the aromatic amino acids) tends to absorb at 280nm. An

acceptable grade of purity is given by OD

260

/ OD

280

= 1.8. The method was described

for the first time by Warburg and Christian in 1942 (Warburg 1942).

As summarized in table , all proteasome subunits gave a good purity and a

concentration of about 100 μg/ml.

Table5. PCR amplified proteasome subunits cDNA were purified and evaluated before to insert into the plasmid for cloning.

Sample

OD260

OD280

OD260/OD280 (purity)

Concentration

[μg/ml]

Α2

0,021

0,011

1,93

104,41

Α4

0,022

0,014

1,51

109,61

Α7

0,021

0,009

2,31

105,45

Β1

0,023

0,007

3,26

116,91

Β1i

0,019

0,003

5,89

97,16

Β 7

0,019

0,005

3,69

94,05

Insertion in plasmids and sequencing

A suitable plasmid vector and bacteria receptive strains were used for expression of

proteasome subunits in bacteria cells.

The pTriEx-4 Ek/LIC vector (Fig.24) is ideal for expression in different host cells,

including mammalian, insect and bacteria cells. Target proteins sequences are

inserted immediately downstream of an enterokinase cleavage site so that all

vector-encoded fusion sequences can be removed from the purified protein.

Fig.24 The pTriEx-4 Ek/LIC vector the Ek/LIC cloning site is under T7 promoter, controlled by lac operator. The Ap gene allows ampicillin resistance and is useful to select bacteria harbouring the plasmid. Proteins expressed by pTriEx-4 Ek/LIC cloning kits present a histidine-tail at their C-term.

The poli-linker site is near to a poli-histidine coding sequence, so expressed proteins

have his-tail at their C-term, useful for their purification and detention.

The foreign protein in this plasmid is under the tight control of the T7lac promoter.

For its expression, the plasmid requires the transformation into appropriate E. coli

strains. Therefore, Ek/LIC vector was amplified in a host cell, purified, sequenced to

control the insertion and finally inserted into another E. coli strain, here Origami

B(DE3)pLacI cells were used, specific for protein expression.

The ligation-independent cloning (LIC) was developed for the directional cloning of

PCR products without the need of restriction enzyme digestion or ligation reactions.

It requires the addition of a flanking sequence to each side of target gene, as seen

above for primers design. The LIC method uses the 3' → 5' exonuclease activity of T4

DNA Polymerase to create specific 13- or 14-base single-stranded overhangs in the

vector (Fig25). These sticky ends are not complementary themselves, to avoid any

annealing and function of plasmid without the insert, making cloning very efficient

because only the desired product can be formed during the annealing process.

Transformation took place by heat-shock; the hot water bath gives bacteria a shock

strong enough to open some holes in their membrane. Plasmids use these holes to

enter the host cell. After transformation, bacteria were incubated at 37°C to

completely de-froze and reactivate them before to plating on TYE + ampicillin

selective medium.

The insertion was verified with an electrophoresis after PCR amplification of four

colonies for each sample. The PCR was performed using the proteasome

subunits-specific primers and the results were about 900 and 700 bp length, in accord with the

expectations (table5, Fig26). This demonstrates that growing cells contain the

plasmid with the inserted antigen-coding gene.

From each samples some clones were chose for a glycerol stock and for plasmid

purification: α2 III, α4 IV, α7 IV, β1 I, β1i IV, β7 I.

Fig.25 the Ek/LIC strategy. After amplification with primers that include the indicate 5’ LIC extensions, the PCR inert is treated with T4 DNA polymerase and dATP, annealed to the Ek/LIC vector and transformed into competent E.coli cells.

F

ig.26 Insertion in the plasmid test: PCR amplification of proteasome subunits α2, β1 and β1i. Samples are different sizes due to different length of the proteasome subunit genes. The marker used was DNA 100bp.

Chosen clones were used for plasmid purification by QIA prep Spin Kit, which

allows separating the plasmid from the other cellular components. Purified plasmids

were linearized by the XbaI enzyme and sequenced. The restriction enzyme XbaI

was chosen among enzymes able to cut the plasmid, but having their restriction

sequence outside the insert, to avoid it was cut. The plasmids results more than five

thousands base pairs long, as expected from the length of plasmid plus the inserted

gene (Fig27).

An aliquot of purified plasmids was then sequenced by the MWG Company. This

step was important to know if the gene sequences of proteasome subunits were

correctly conserved during amplification and insertion in the plasmid or if some

mutations were introduced. Any mutation could compromise the right gene

expression and protein conformation, nullifying the entire work of antibody

selection.

The resulting sequences were compared to ones published on Gene Bank by CLC

Combined Work Bench software (Fig28) and looked identical, without any mutation

in the coding part of the gene.

Fig.27 Plasmid Purification Test. Plasmids result more than 5000 bp long, as expected. The marker used was DNA marker III.

Fig.28 α4 subunit sequence. The plasmid sequencing result, upper, and the Gene Bank sequence, lower, are identical. The primer is indicated.

Proteasome subunit expression

For the expression of proteasome subunits, the pTriEx-4 Ek/LIC plasmids had to be

inserted into the appropriate E.Coli strain.

Here Origami B(DE3)pLacI cells were used. Origami is a strain containing two

plasmids with thioredoxin reductase (trxB) and glutathione reductase (gor) genes,

which enhance disulfide-bound formation in cytoplasm helping the folding of

proteins. TrxB- and gor-containing plasmids are selectable on kanamycin and

tetracycline, respectively.

Origami B(DE3)pLacI cells are derived from LacZY mutant of BL21 strain and are

lysogenic for the bacteriophage λDE3.

The DE3 strains posses a chromosomal copy of the T7RNA polymerase gene (Dyson

et al. 2004; Schofield et al. 2007) under the control of LacUV5 promoter, inducible by

IPTG (Isopropyl β-D-1-thiogalactopyranoside, a compound used as a molecular

mimic of lactose metabolites and able to trigger transcription of the lac operon).

The foreign gene in pTriEx-4 Ek/LIC vector is under T7 promoter control; adding

IPTG at the medium it is possible to induce LacUV5 promoter to codify for T7RNA

polymerase and it can translate the inserted gene binding the T7 promoter sequence.

The strain contains also a plasmid coding for the lac repressor gene, lacI. Because

pTriEx is a high copy plasmid, lacI allows repression of both the T7lac promoter that

controls inserted gene expression and the lacUV5 promoter that regulates T7 RNA

polymerase, suppressing any basal expression of the foreign protein. The plasmid

bringing lacI gene is selectable on chloramphenicol containing medium.

The heat-shock transformation was tested by PCR amplification of a colony picked

up from plates by using primers specific for the proteasome subunit genes inserted

in the plasmid.

As Figure29 shows, each clone gave amplification, and fell between the seventh and

eighth marker band, corresponding to a length of 900-700 bp, proving that everyone

contains the plasmid and the inserted sequence.

A glycerol stock of all these samples giving a positive result to PCR analysis was

prepared.

Fig.29 Insertion test. PCR amplificates of plasmid inserted in Origami B(DE3)pLacI cells were tested with electrophoresis on agarose gel.

The marked used was DNA 100bp

Positive colonies from insertion test were cultured for antigen expression until their

exponential growth point, when they were induced to produce the proteasome

subunits by IPTG. The antigen expression was then tested by western blot. The

western blot was developed using peroxidase-conjugated anti his-tag antibody that

recognises and binds the poli-histidine tail of antigens.

The peroxidase enzymes oxidize their substrates using hydrogen peroxide as

oxidizing agent; usually substrates used in detection techniques have a peculiar

change in their chemical structure consequently to the oxidation. These changes

bring them to get a different colour, as in the case of ELISA development, or to emit

electrons, as for the western blot, where emitted electrons go to impress X-ray film

to create a sample picture. The commonly used peroxidase is the horseradish one,

HRP, which usually is conjugated with antibody, allowing its homing on the

sample. All clones gave expression of proteasome subunit after induction with IPTG.

Clones expressing the proteasome subunits α4, β1, β1i and β7 were chose for a big

scale culture that could guarantee a big amount of protein. After induction, bacteria

cells were broken by sonication, and proteins separated from cellular debris by

centrifugation before the Ni-NTA beads purification.

Ni-NTA beads are agarose beads, with an average diameter of 50 μm; they contain

particles with strongly metal-chelating nitrilotriacetic acid (NTA) groups covalently

bound to their surfaces. This NTA group is charged with nickel and used for capture

the protein His-tag that could then be eluted using the kit elution buffer (Fig30).

An SDS gel developed by Comassie Blue coloration and Bradford assay were used

to test the purification and quantify the proteins, respectively.

Fig.30 Schematic explanation of Nickel action on capturing proteins. Ni is represented like hexagons. The Beads and the NTA bound are also showed.

The Bradford assay is a simple, rapid, inexpensive and sensitive assay method for

proteins evaluation. It uses the action of Coomassie brilliant blue G-250 dye (CBBG)

that specifically binds to proteins at arginine, tryptophan, tyrosine, histidine and

phenylalanine residues, even if the assay primarily responds to arginine residues

(eight times as much as the other listed residues). CBBG binds to these residues in

the anionic form, which has an absorbance maximum at 595 nm (blue). The free dye

in solution is in the cationic form, which has an absorbance maximum at 470 nm

(red). The assay is monitored at 595 nm in a spectrophotometer, a measure of the

CBBG-protein complex.

Because of absorbance spectra of the two Coomassie Brilliant Blue G-250 species

partially overlap, a standard curve is required for this assay; in case of arginine rich

protein the standard curve needs to be done with an arginine rich protein as well,

here the BSA (Bovine Serum Albumine) was used for the standard curve. It allows

obtaining the equation to calculate sample concentration (Fig.31). The evaluation

was done in three times, one for samples α4 and β1i, another for samples β7 and β1

and the last one for bacterial proteins that will be used as negative control in the

selection techniques; results are showed in table6.

BSA Standard Curve

y = 1,1102x - 0,5495 R2 = 0,9961 -0,8 -0,6 -0,4 -0,2 0 0,2 0,4 0,6 0,8 0 0,2 0,4 0,6 0,8 1 1,2 Concentration A b so rb an ce BSA Lineare (BSA)

Fig31 Excel analysis using the BSA standard curve and its equation. The curve is an example of the ones used for quantify the α4, β1i, β1 and β7 produced proteins. A similar curve was used to quantify unspecific bacteria proteins (Bac) to use as negative control in the follow assays.

Table6. Bradford assay results for serial dilution of BSA (control) and samples α4 and β1i(A), β1 and β7 (B) and bacteria proteins (C). data were analysed using standard curves and equations by the spreadsheet program excel.

Sample

Concentration

α4

0,633 mg/ml

β1i

1,13mg/ml

β1

0,698mg/ml

β7

0,759mg/ml

Bacterial Proteins

0,3211mg/ml

Antibody selection by Phage Display

Immunoselection

The phage display technique has been performed using the Tomlinson I + J library.

These semi-synthetic phage-antibody libraries are the lasts created by Greg Winter’s

lab at the MRC Laboratory of Molecular Biology and the MRC Centre for Protein

Engineering and have a complexity of about 1.2 x 10

9

_{, which approximates the}

complexity of the human immune system.

Tomlinson I + J Human synthetic libraries are scFv phagemid libraries displaying

human antibody sequences as fusion protein to the minor coat protein, pIII (as

previously seen scFv fragments comprise a single polypeptide with the V

H

and V

L

domains attached to one another by a flexible Glycine-Serine linker). These libraries

were constructed by amplifying with universal degenerate primers the genes coding

for the variable portions of immunoglobulin molecules from the peripheral blood

lymphocytes of unimmunized donors (Marks et al. 1992; Marks et al. 1991) . Both

libraries are based on a single human framework from V

H

and V

L

coding sequences

amplified by randomized aminoacids and designed to be as short as possible yet still

able to form an antigen-binding surface and to create a repertoire of highly diverse

solutions in a known structure.

Tomlinson libraries were constructed using pIT2 phagemid vectors (Fig32) and

cloning the scFv gene in frame with the gIII gene for the pIII protein.

When E .coli cells harbouring these phagemids are superinfected with helper phage,

phage particles displaying scFv-pIII fusion protein are produced.

These libraries are engineered to contain the ampicillin resistance bla gene, used to

select cells harbouring the plasmid, and the bacterial leader peptide sequence, pelB,

present at the 5’ end of the insertion site, which directs the foreign proteins (here the

scFv fragments) to the exportation in the periplasm.

Moreover the c-myc epitope and the hexahistidine tag coding sequences are present

at the 3’ end of the scFv gene to allow affinity purification and detection using

appropriate antibodies and nickel matrices, respectively. Finally the TAG amber

stop codon is present at the junction of the scFv gene and gIII. The presence of amber

stop codon allows the production of scFv molecules as soluble antibody molecules

instead of scFv-pIII fusion proteins. When the phagemid is present in a suppressor

strain of E. coli (TG1) the amber stop codon is not recognised as peptide chain

synthesis-terminator but translated as glutamine. Thus scFv-pIII fusion protein is

synthesized. When the phagemid is harboured by a non-suppressor strain of E. coli

(HB2151), the synthesis of peptide chain is terminated at amber stop codon,

releasing a soluble scFv molecule.

The scFv-gIII expression is due to the wild type lac promoter, which is controlled by

the lac inhibitor LacI, so that the synthesis of the protein, which could be toxic to the

host E. coli, can be suppressed by glucose. Alternatively, scFv antibody molecules

synthesis can be induced by IPTG.

Fig.32 the plasmid used for Tomlinson I + J library construction. The poli-linker site is up strain the gIII gene,

coding

for the pIII coat protein of M13 phages.

For immunoselection, phage libraries were incubated in immunotubes coated with

the antigen (the produced proteasome subunits) and selected for their binding

ability by washes of un-bounds phages.

Bound phages were then eluted with trypsin and used to infect TG1 E.coli cells.

Bacteria cells were plated on selective medium, grown and then the better colonies

were transferred in a 96 cell-well plate to create a collection of phage-producing

bacteria called the “master plate”. This had wells containing a phage clone each one

and named with a number and a letter code. Clone disposition of the master plate

was maintained in all subsequent culture and ELISA plates.

To prepare the phages to the second selection step, the ELISA assay, a master plate

copy was done, bacteria were grown and super-infected with the helper phage

KM13, to induce phage offspring production.

KM13, as seen before, codifies for a modified pIII containing a trypsin cleavage site;

this makes phages only expressing KM13 pIII non-infectious as pIII is cleaved

during trypsin digestion

KM13 also lacks the packaging sequence; thus, when a cell harbouring the phagemid

is super-infected with the helper phage, the progeny will be infective only if has a

pIII-scFv fusion protein on its capside, and will contain the phagemid instead than

the complete genome.

Phage clone screening by ELISA

The next day antibody-displaying phages were used for the ELISA. For each

proteasome subunit (α4, β1, β1i and β7), a 96-well ELISA plate were coated with the

antigen and another one with bacteria proteins as negative control. Plates were

incubated with phage offspring and un-bound phages were washed away.

ELISA assay was developed by chromogenic reaction involving the enzyme

peroxidase HRP and its substrate TMB. As seen above, this enzyme can oxidize the

substrate yielding to a characteristic change of colour, from white to blue and

subsequently, with the reaction stop by sulphuric acid, yellow.

The HRP is here used in conjugation with a specific anti M13 phage antibody.

To have a quantification of the reaction and consequently of the binding strength,

the ELISA plates were read using a spectrophotometer, measuring the optical

density of the solution at 650 nm and 450 nm. The difference between these optical

densities directly corresponds to the amount of coloured substrate and,

consequently, to bound phage.

B1/Bac 0 2 4 6 8 10 12 14 16 18 20 22 24 1 2 3 4 5 6 7 8 9 10 11 12 Phage clones A ss or b an ce r at io A B C D E F G H

Fig33. β1 ELISA selection.

B1i/Bac 0 2 4 6 8 10 12 14 16 18 20 22 24 1 2 3 4 5 6 7 8 9 10 11 12 Phage Clones A b so rb an ce R at io A B C D E F G H

B7/Bac 0 2 4 6 8 10 12 14 16 18 20 22 24 1 2 3 4 5 6 7 8 9 10 11 12 Phage Clones A b so rb an ce R at io A B C D E F G H

Fig35. β7 ELISA selection.

A4/Bac 0 2 4 6 8 10 12 14 16 18 20 22 24 1 2 3 4 5 6 7 8 9 10 11 12 Phage clones A b so rb an ce R at io A B C D E F G H

Fig.36 ELISA selection. Fig33-36 show the ratio between the measured absorbance of antigen and bacteria coated plate. A ratio major than two demonstrate a phage binding strength and affinity more than two times stronger for antigen than for negative control.

Each phage clone was tested for binding with both the antigen and unspecific

bacteria proteins. The bacteria proteins were used as negative control and the ratio

of the two measures gave an evaluation of phage binding specificity and strength.

Pictures 33-36 show ELISA results. There are some very good clones, able to bind

antigen more than two times stronger than bacteria proteins.

For β1, clones 1F, 1G, 2F, 4D, 4H, 6D, 7B, 7D, 8A, 9D, 10D and 11B gave a strong

reaction and were therefore chosen for further selections. For β1i, better clones were

1D, 2D, 2E, 2G, 2H, 3D, 3F, 4E, 5E, 5G, 5E, 8D, 8E, 9C and 10B. Using β7 subunit as

antigen, clones 2B, 2C, 2D, 2E, 3C, 4D, 5F, 6D, 10D, 11B, 12B and 12G were chosen

for further selection. Finally, for the α4 proteasome subunit where chosen 1C, 1D,

1H; 2C, 2F, 3H, 4A, 4F, 4H, 7A, 7H and 8H clones.

Phage clones screening by ELISA in dilution series

Further characterization of antibody displaying phages was done by ELISA in

dilution series to test antibody-antigen binding ability at different concentration.

A big scale culture was set up to obtain a big amount of phages after bacteria growth

and helper phage superinfection; phage progeny was collected and then used for

ELISA in dilution series. Also in this test, the bacterial proteins were used as

negative control.

The figure 37 is an example of how a Dilution ELISA should look like. Each couple

of column was coated with antigen (proteasome subunits) and control (bacteria

proteins) respectively and analyzed against a different antibody displaying-phage

clone at different concentration. Clones maintained the same name having in the

master plate.

The Dilution ELISA was developed with HRP-anti M13, its chromogenic substrate

TMB and sulphuric acid, for the first ELISA. Then plates were read by

spectrophotometer and data were analyzed using a spreadsheet program (Microsoft

Excel).

Results indicated the binding strength in different concentration of phage. As

showed in Fig. 38-41, the antigen-phage binding strength declines with phage

concentration, until became close to zero (blue line); phage-bacteria bound, instead,

appeared to be near to zero regardless of phage concentration (pink line).

For each proteasome subunit clones with the best binding profile were chosen.

For the proteasome subunit β1, the best binding phage clones were 1F, 1G, 2F, 4H,

7B, 8A and 11B. For the subunit β7, the best reacting were 2D, 3C and 5F. Against

the subunit α4 the selected antibody-displaying phages were 2F, 4H and 4A and for

the subunit β1i the best clones were 2E and 8D.

Fig.37. A dilution ELISA plate. The phage clone used in each column is written at the column bottom, the antigen used is written at the top; in this plate was tested the proteasome subunit β1 as antigen. On the left side of the picture the dilution scale is indicated. Each phage clone was tested in two columns, the antigen- and the bacteria protein-coated column. Yellow colouration indicate positive result, no-colour indicates negative result. Bacteria proteins used as negative control, gave no result

All these clones were able to selectively bind their own antigen among other

proteins; their bound strength was concentration dependent and it should be

considered in further uses of these antibodies.

The next analyses were done only on phage clones displaying antibody against β1

subunit and specifically on clones 8A, 1F, 1G, 2F, 4H, 7B and 11B.

β1

2F

0

0,05

0,1

0,15

0,2

0,25

10 1 5*10

-2

10 2 5*10

-3

10 3 5*10

-4

10 4 5*10

-5

Phage Clone Dilutions

A

b

so

rb

an

ce

B1 Bac Fig.38

β1i

2E

0

0,02

0,04

0,06

0,08

0,1

0,12

0,14

0,16

0,18

0,2

10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8

Phage Clone Dilutions

A

b

so

rb

an

ce

B1i Bac Fig39

Fig38 and 39 Antibody displaying phages react with their antigen (β1 in Fig38 and β1i in Fig39) in a concentration dependent way; 2F and 2E clone are shown. Blue line is antibody reaction with the antigen and pink one is antibody reaction with un-specific bacteria protein.

β7

5F

0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8

Phage Clone Dilutions

A

bs

or

ba

nc

e

B7 Bac

3C

0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8

Phage Clone Dilutions

A

b

so

rb

an

ce

B7 Bac

Fig.40 These are two of the antibodies against β7, 3C and 5F. All they show a good binding with the antigen (blue line) and a really few one with the control (pink line).

α4

2F

0 0,2 0,4 0,6 0,8 1 1,2 1,4 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8

Phage Clone Dilutions

A

bs

or

ba

nc

e

A4 Bac

4H

0 0,2 0,4 0,6 0,8 1 1,2 1,4 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8

Phage Clone Dilutions

A

b

so

rb

an

ce

A4 Bac

Fig.41 Examples of α4 clones. Even these antibodies, clones 2F and 4H showed a good antigen recognition and binding. Blue line is antibody reaction with the antigen and pink one is antibody reaction with the negative control.

Test of selected antibody function.

Function and binding ability of selected clones were checked by western blot of

antigen, proteasome subunit β1, and control, bacterial proteins; for detention was

used the selected antibody displaying-phages visualized by binding with the

anti-KM13 HRP-conjugated antibody.

At first it was run an SDS gel of antigen and control and transferred on a

nitrocellulose membrane. The membrane was then developed by Ponceaus Red, a

coloured substance able to bind proteins in a no-covalent way to verify if β1 and

bacteria proteins were properly run and transferred. Both β1 and bacterial proteins

gave the expected bands. After this control, the membrane was cut in seven strips,

each one containing both β1 and bacteria proteins, and used to test the seven

different phage clones 8A, 1F, 1G, 2F, 4H, 7B and 11B.

Before incubation with selected clones, the membrane was incubated milk-PBS to

saturate each free space and avoid un-specific binding. Selected antibodies were

used at the concentration giving the largest difference in binding antigen and

control, according to the dilution ELISA results. After one hour incubation, the

membrane was washed and the secondary anti-KM13 HRP-conjugated antibody

was added (Fig42).

Clones 7B and 11B showed bands hardly distinguishable from the background, but

the others showed a band at 38 kDa, as expected, and only on the antigen side of the

strip. This assay confirmed the specificity of Ab-antigen binding since none of the

antibodies reacted with the bacteria protein negative control, demonstrating their

selectivity.

Fig.42 Western blot test. In this western blot assay, the antigen (β1 proteasome subunit) and control proteins (bacteria cytosolic proteins) were visualized by antibody displaying phages binding. Each strip present the bacteria proteins control on the left and the β1 antigen on the right, as indicated at the strip bottom. The selected antibody displaying phage used is indicated on the strip top.

Production of soluble antibody fragments (scFv)

The best resulting clones from western blot were used to produce soluble antibodies

(scFv), which are smaller than displayed antibodies, lacking the phage particles and

therefore they are easier to handle and more useful for research uses.

To produce soluble fragments the antibody coding phagemid was transferred into

another bacteria strain called HB2151 (Ni et al. 2008). This bacteria strain has not,

like TG1, a terminator suppressor, useful to silencing the amber stop codon between

the inserted antibody sequence the pIII gene (gIII) and to produce a fusion protein.

HB2151 lacks this suppressor and can produce soluble antibody fragments unbound

to pIII. The absence of this suppressor, on the other side, will not express scFvs

having an amber stop codon in their sequence. Thus, not all selected antibody

fragments will express in this bacteria strain.

The scFv production was induced by IPTG and subsequently tested by western blot.

This was developed using the HRP-conjugated anti-His tag antibody, which

recognise scFv because of their His tag. As showed in picture 43, only two clones

gave a result. Most probably the others containing some stop codon in their coding

sequences and could not be expressed as full-length soluble fragments (scFv). The

expressed clones are 2F and 8A Abs, both selected against the β1 proteasome

subunit.

Fig.43 scFv expression test. The western blot of various phage clones expressing scFv against β1 proteasome subunit. Some clones gave no scFv detectable expression. The scFv show are about 30kDa, as expected. The lower bands are fragmentation of the scFv, while the uppers are dimerization.

scFv purification

The further analyses of antibody function, in particular the immunostaining, need a

purified solution of scFv samples, so clones 2F and 8A were produced by IPTG

induction of big scale HB2151 culture, to get a high amount of antibody. Soluble

antibody fragments were purified in different steps. The first one was a Ni-NTA

beads column for his-tag protein purification.

The result was tested by SDS gel and showed an undetectable expression of 8A

clone and too much background due to the presence of his-tag bacteria proteins.

Therefore, the next step of purification was done only on the 2F scFv clone using

HPLC, high-performance liquid chromatography, a powerful tool for purification.

The HPLC is a form of column chromatography used to separate components of a

mixture by chemical interactions between the substance being analyzed (sample, or,

more properly, analyte) and the chromatography column. In the gradient elution

HPLC, the analyte is forced through a column of the stationary phase (usually a tube

packed with small round particles having a special surface chemistry) by pumping a

liquid (mobile phase) at high pressure through the column. A small volume of the

sample is introduced into the stream of mobile phase and its run on the column

length is retarded by specific chemical or physical interactions with the stationary

phase. The amount of retardation depends on the nature of the analyte, stationary

phase and mobile phase composition, so both the stationary and the mobile phase

are chosen according the analyte features. The use of pressure increases the linear

speed giving the components less time to diffuse within the column, leading to

improved resolution.

The gradient elution HPLC is characterized by changing in mobile phase

composition, forming a gradient. The gradient helps speed up elution by allowing

components that elute faster to come off the column under different conditions than

slower components, which are retained by the column. By changing the composition

of the solvent, components that are to be resolved can be selectively more or less

associated with the mobile phase and elute in different moments.

There are different kinds of HPLC, depending of the different columns used. Here, a

sepharose ion exchange chromatography column was used, where retention of

analytes is based on their attraction with the charged sites of stationary phase

(Aguilar 2004).

HPLC outputs are chromatograms, where the absorbance of analytes is registered

and put in graph with the elution time. For this assay, two registrations were done,

one at the wavelength of 220 nm, where the peptide bound absorbs, the second at

280 nm, where aromatic amino acids have their maximum of absorbance. After two

round of HPLC purification, the selected antibody 2F showed a big absorbance in

the first fractions of elution and appeared clearly separated by the other proteins

(Fig.44), as the SDS electrophoresis of HPLC aliquots confirms. (Fig.45). After HPLC

purification, 2F scFv needed to be concentrated and dialysed to change the buffer

used for purification. Subsequently its concentration was estimated by Bradford

assay, using BSA to construct a standard curve and get the equation. Antibody

concentration resulted 0,704 mg/ml.

Fig.44 scFv purification HPLC resulting chromatogram shows a big absorbance peak after about 5 minutes of elution. The other peak represents some other proteins contaminating the solution.

Fig.45. Selected antibody scFv purification. SDS electrophoresis result. Aliquots from HPLC were run on SDS electrophoresis gel and gave the expected band without contaminants. Aliquots are indicated with their elution time, in seconds.

Immunostaining

Human cell culture, fixation and immunostaining

Selected antibody fragment was used to visualize its own antigen, the β1

proteasome subunit, by immunostaining of cell cultures.

Human dermal fibroblasts were used at 28

TH

_{and at 19}

TH

_{passages, then split and}

transferred to microscope slide, when they were directly fixed and immunostained.

For this assay, microscope slides were incubated as explained in Table P, with one

sample, two negative controls and one positive control well each one.

Table7. Scheme of immunostained slides

In columns there are the slide wells, in rows there are the cells and antibodies added to the slides. + is for added components, - for no added ones.

Negative

Control:

no 2F Ab

Negative

Control:

no 2° Ab

Positive Control:

commercial Ab anti

α2 subunit

Sample

Fibroblasts

+

+

+

+

Proteasome specific

Ab

-

2F

-

2F

secondary Ab

9 E 10

-

commercial Ab

9 E 10

Anti-mouse

Alexa

Alexa

Alexa

Alexa

The 9E10 Ab, a mouse antibody recognising the scFv myc-tail, was used to bind the

2F fragment. The positive control was performed by mouse-derived anti-α2

proteasome subunit commercial antibody. Both 9E10 and anti-α2 proteasome

subunit Ab need a secondary antibody for their detection. Here an anti-mouse

antibody conjugated with Alexa488, a substance that fluoresces at the wavelength of

488nm, in green spectrum, was used that allowed Ab detection by confocal

microscopy.

The cellular nuclei were visualized by using Drag5, a red fluorescing molecule that

selectively bind the DNA. The confocal microscope pictures were corrected by

subtraction of the negative control images to avoid background influence (see Fig 46

and 47). They demonstrate the 2F ability of binding to the β1 proteasome subunit

directly in cultured cells, since, as expected, β1 appears ubiquitous in the cell.

Fig.46 Modified confocal image. Middle age human skin fibroblasts immunostained with the selected 2F antibody. The selected antibody bound by secondary Ab 9E10 and Alexa488, gave a green colour while the nucleus detector Drag5 gave a red colour.

Fig.47 Modified confocal microscope image.. Young human fibroblasts immunostained with the selected antibody. In green, the selected antibody, in red the nucleus detector Drag5. This picture was obtained by confocal microscope. The negative controls were subtracted from the sample picture to remove the background.

Conclusions

Progressive accumulation of abnormal and aggregated proteins is one of the most

widely reported age-related changes. In particular, oxidized, glycoxidized, and

ubiquitinated proteins have been shown to accumulate in an age-related fashion in

various organisms (Oliver et al. 1987), in cells undergoing aging in culture

(Chondrogianni et al. 2002; Chondrogianni and Gonos 2008; Chondrogianni et al.

2003; Chondrogianni et al. 2008; Verbeke et al. 2001), and in certain pathologies, such

as Alzheimer’s and Parkinson’s diseases (Keller et al. 2000). Furthermore, the fact

that there is a reciprocal relationship between the rate of protein turnover and aging

(Carrard et al. 2002; Carrard et al. 2003; Chondrogianni et al. 2002)indicates that the

protein degradation pathways are impaired with age (Beedholm et al. 2004;

Petropoulou et al. 2000).

Since the proteasome is implicated in protein turnover, the fate of the proteasome

during aging has recently received considerable attention. Evidence has been

provided for abnormalities in intracellular proteolysis widespread in aging, and

age-related alterations in the proteasomal system, including a decreased activity of the

proteasome toward artificial peptide substrates as well as the ability to degrade

oxidized proteins during aging, have been reported (Beedholm et al. 2004; Carrard

et al. 2002; Farout and Friguet 2006; Friguet et al. 2000).

The present work is part of the European project “Proteomage”, whose primary aim

is to develop a functional analysis of evolutionarily conserved mechanisms of ageing

based on advanced proteome analysis.

Using proteomic analysis of aging processes in a variety of models including whole

organisms and human cell cultures, this project wants identify genes involved in

longevity and understand how protein concentration and expression change during

cell lifespan.

Genes involved in longevity, together with optimal environment conditions, allow

individuals to survive to advanced old age in good cognitive and physical function

and in the absence of major age-related diseases.

Studying them and their variants in healthy and un-healthy aging could open new

prospective for aging-related disease treatment.

A significant part of this project attention was put protein turnover and degradation.

In this prospective, proteasome behaviour in cell lifespan assumes a big importance

and new tools for proteasome detection appear very useful.

Here phage display technique was used as fast and easy method to get new

antibodies for proteasome visualization and proteasome subunits discerning.

Good phage clones were selected against the β1, β1i, β7 and α4 proteasome subunits

from the phage Tomlinson I + J library and tested for their reaction with the antigen

by ELISA assay. One soluble antibody fragment was product for the β1 subunit (2F

clone) and used on cultured human skin fibroblasts to visualize the antigen. These

antibodies could be suitable for further research involving proteasome.

References

Aguilar MI (2004) HPLC of peptides and proteins: basic theory and methodology. Methods Mol Biol 251, 3-8

Akamatsu Y, Cole MS, Tso JY, Tsurushita N (1993) Construction of a human Ig combinatorial library from genomic V segments and synthetic CDR3 fragments. J Immunol 151, 4651-4659

Andersen PS, Stryhn A, Hansen BE, Fugger L, Engberg J, Buus S (1996) A recombinant antibody with the antigen-specific, major histocompatibility complex-restricted specificity of T cells. Proc Natl Acad Sci U S A 93, 1820-1824

Azzazy HM, Highsmith WE, Jr. (2002) Phage display technology: clinical applications and recent innovations. Clin Biochem 35, 425-445

Baek H, Suk KH, Kim YH, Cha S (2002) An improved helper phage system for efficient isolation of specific antibody molecules in phage display. Nucleic Acids Res 30, e18

Barbas CF, 3rd, Kang AS, Lerner RA, Benkovic SJ (1991) Assembly of combinatorial antibody libraries on phage surfaces: the gene III site. Proc Natl Acad Sci U S A 88, 7978-7982

Bardag-Gorce F, Farout L, Veyrat-Durebex C, Briand Y, Briand M (1999) Changes in 20S proteasome activity during ageing of the LOU rat. Mol Biol Rep 26, 89-93

Beedholm R, Clark BF, Rattan SI (2004) Mild heat stress stimulates 20S proteasome and its 11S activator in human fibroblasts undergoing aging in vitro. Cell Stress Chaperones 9, 49-57

Bergman Y, Cedar H (2004) A stepwise epigenetic process controls immunoglobulin allelic exclusion. Nat Rev Immunol 4, 753-761

Borissenko L, Groll M (2007) 20S proteasome and its inhibitors: crystallographic knowledge for drug development. Chem Rev 107, 687-717

Breitling F, Dubel S, Seehaus T, Klewinghaus I, Little M (1991) A surface expression vector for antibody screening. Gene 104, 147-153

Brissette R, Prendergast JK, Goldstein NI (2006) Identification of cancer targets and therapeutics using phage display. Curr Opin Drug Discov Devel 9, 363-369

Bulteau AL, Petropoulos I, Friguet B (2000) Age-related alterations of proteasome structure and function in aging epidermis. Exp Gerontol 35, 767-777

Cabilly S (1999) The basic structure of filamentous phage and its use in the display of combinatorial peptide libraries. Mol Biotechnol 12, 143-148

Carrard G, Bulteau AL, Petropoulos I, Friguet B (2002) Impairment of proteasome structure and function in aging. Int J Biochem Cell Biol 34, 1461-1474

Carrard G, Dieu M, Raes M, Toussaint O, Friguet B (2003) Impact of ageing on proteasome structure and function in human lymphocytes. Int J Biochem Cell Biol 35, 728-739

Chappel JA, He M, Kang AS (1998) Modulation of antibody display on M13 filamentous phage. J Immunol Methods 221, 25-34

Charlton K, Harris WJ, Porter AJ (2001) The isolation of super-sensitive anti-hapten antibodies from combinatorial antibody libraries derived from sheep. Biosens Bioelectron 16, 639-646

Chondrogianni N, Fragoulis EG, Gonos ES (2002) Protein degradation during aging: the lysosome-, the calpain- and the proteasome-dependent cellular proteolytic systems. Biogerontology 3, 121-123

Chondrogianni N, Gonos ES (2005) Proteasome dysfunction in mammalian aging: steps and factors involved. Exp Gerontol 40, 931-938

Chondrogianni N, Gonos ES (2008) Proteasome activation as a novel antiaging strategy. IUBMB Life 60, 651-655

Chondrogianni N, Stratford FL, Trougakos IP, Friguet B, Rivett AJ, Gonos ES (2003) Central role of the proteasome in senescence and survival of human fibroblasts: induction of a senescence-like phenotype upon its inhibition and resistance to stress upon its activation. J Biol Chem 278, 28026-28037

Chondrogianni N, Trougakos IP, Kletsas D, Chen QM, Gonos ES (2008) Partial proteasome inhibition in human fibroblasts triggers accelerated M1 senescence or M2 crisis depending on p53 and Rb status. Aging Cell 7, 717-732

Ciechanover A, Ben-Saadon R (2004) N-terminal ubiquitination: more protein substrates join in. Trends Cell Biol 14, 103-106

Clackson T, Hoogenboom HR, Griffiths AD, Winter G (1991) Making antibody fragments using phage display libraries. Nature 352, 624-628

de Haard H, Kazemier B, van der Bent A, Oudshoorn P, Boender P, Arends JW, van Gemen B (1999) Vernier zone residue 4 of mouse subgroup II kappa light chains is a critical determinant for antigen recognition. Immunotechnology 4, 203-215

Devlin JJ, Panganiban LC, Devlin PE (1990) Random peptide libraries: a source of specific protein binding molecules. Science 249, 404-406

Duenas M, Borrebaeck CA (1995) Novel helper phage design: intergenic region affects the assembly of bacteriophages and the size of antibody libraries. FEMS Microbiol Lett 125, 317-321

Dyson MR, Shadbolt SP, Vincent KJ, Perera RL, McCafferty J (2004) Production of soluble mammalian proteins in Escherichia coli: identification of protein features that correlate with successful expression. BMC Biotechnol 4, 32

Ethen CM, Hussong SA, Reilly C, Feng X, Olsen TW, Ferrington DA (2007) Transformation of the proteasome with age-related macular degeneration. FEBS Lett 581, 885-890

Etlinger JD, Goldberg AL (1977) A soluble ATP-dependent proteolytic system responsible for the degradation of abnormal proteins in reticulocytes. Proc Natl Acad Sci U S A 74, 54-58

Farout L, Friguet B (2006) Proteasome function in aging and oxidative stress: implications in protein maintenance failure. Antioxid Redox Signal 8, 205-216

Ferrington DA, Husom AD, Thompson LV (2005) Altered proteasome structure, function, and oxidation in aged muscle. FASEB J 19, 644-646

Forster A, Masters EI, Whitby FG, Robinson H, Hill CP (2005) The 1.9 A structure of a proteasome-11S activator complex and implications for proteasome-PAN/PA700 interactions. Mol Cell 18, 589-599

Friguet B, Bulteau AL, Chondrogianni N, Conconi M, Petropoulos I (2000) Protein degradation by the proteasome and its implications in aging. Ann N Y Acad Sci 908, 143-154

Gao C, Mao S, Kaufmann G, Wirsching P, Lerner RA, Janda KD (2002) A method for the generation of combinatorial antibody libraries using pIX phage display. Proc Natl Acad Sci U S A 99, 12612-12616

Garrard LJ, Henner DJ (1993) Selection of an anti-IGF-1 Fab from a Fab phage library created by mutagenesis of multiple CDR loops. Gene 128, 103-109

Goldberg AL (2005) Nobel committee tags ubiquitin for distinction. Neuron 45, 339-344 Goletz S, Christensen PA, Kristensen P, Blohm D, Tomlinson I, Winter G, Karsten U (2002)

Selection of large diversities of antiidiotypic antibody fragments by phage display. J Mol Biol 315, 1087-1097

Goyns MH, Charlton MA, Dunford JE, Lavery WL, Merry BJ, Salehi M, Simoes DC (1998) Differential display analysis of gene expression indicates that age-related changes are restricted to a small cohort of genes. Mech Ageing Dev 101, 73-90

Griffiths AD, Williams SC, Hartley O, Tomlinson IM, Waterhouse P, Crosby WL, Kontermann RE, Jones PT, Low NM, Allison TJ, et al. (1994) Isolation of high affinity human antibodies directly from large synthetic repertoires. EMBO J 13, 3245-3260

Groll M, Brandstetter H, Bartunik H, Bourenkow G, Huber R (2003) Investigations on the maturation and regulation of archaebacterial proteasomes. J Mol Biol 327, 75-83

Groll M, Heinemeyer W, Jager S, Ullrich T, Bochtler M, Wolf DH, Huber R (1999) The catalytic sites of 20S proteasomes and their role in subunit maturation: a mutational and crystallographic study. Proc Natl Acad Sci U S A 96, 10976-10983

Haas AL, Warms JV, Hershko A, Rose IA (1982) Ubiquitin-activating enzyme. Mechanism and role in protein-ubiquitin conjugation. J Biol Chem 257, 2543-2548

Harrington LC, Rogerson AC (1990) The F pilus of Escherichia coli appears to support stable DNA transfer in the absence of wall-to-wall contact between cells. J Bacteriol 172, 7263-7264

Hawkins RE, Russell SJ, Winter G (1992) Selection of phage antibodies by binding affinity. Mimicking affinity maturation. J Mol Biol 226, 889-896

Hicke L (2001) Protein regulation by monoubiquitin. Nat Rev Mol Cell Biol 2, 195-201

Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Hudson P, Winter G (1991) Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res 19, 4133-4137

Hoppe T (2005) Multiubiquitylation by E4 enzymes: 'one size' doesn't fit all. Trends Biochem Sci 30, 183-187

Hough R, Pratt G, Rechsteiner M (1987) Purification of two high molecular weight proteases from rabbit reticulocyte lysate. J Biol Chem 262, 8303-8313

Hu G, Lin G, Wang M, Dick L, Xu RM, Nathan C, Li H (2006) Structure of the Mycobacterium tuberculosis proteasome and mechanism of inhibition by a peptidyl boronate. Mol Microbiol 59, 1417-1428

Hufton SE, Moerkerk PT, Meulemans EV, de Bruine A, Arends JW, Hoogenboom HR (1999) Phage display of cDNA repertoires: the pVI display system and its applications for the selection of immunogenic ligands. J Immunol Methods 231, 39-51

Husom N (2003) [Self-chosen Cesarean section--conflict of choice and knowledge]. Tidsskr Nor Laegeforen 123, 1552-1555

Ja WW, Olsen BN, Roberts RW (2005) Epitope mapping using mRNA display and a unidirectional nested deletion library. Protein Eng Des Sel 18, 309-319

Janeway CA, Jr. (2001) How the immune system protects the host from infection. Microbes Infect 3, 1167-1171

Karzai AW, Roche ED, Sauer RT (2000) The SsrA-SmpB system for protein tagging, directed degradation and ribosome rescue. Nat Struct Biol 7, 449-455

Kehoe JW, Kay BK (2005) Filamentous phage display in the new millennium. Chem Rev 105, 4056-4072

Keller JN, Dimayuga E, Chen Q, Thorpe J, Gee J, Ding Q (2004) Autophagy, proteasomes, lipofuscin, and oxidative stress in the aging brain. Int J Biochem Cell Biol 36, 2376-2391 Keller JN, Hanni KB, Markesbery WR (2000) Possible involvement of proteasome inhibition

in aging: implications for oxidative stress. Mech Ageing Dev 113, 61-70

Kelly KA, Nahrendorf M, Yu AM, Reynolds F, Weissleder R (2006) In Vivo Phage Display Selection Yields Atherosclerotic Plaque Targeted Peptides for Imaging. Mol Imaging Biol Khalil AS, Ferrer JM, Brau RR, Kottmann ST, Noren CJ, Lang MJ, Belcher AM (2007) Single

M13 bacteriophage tethering and stretching. Proc Natl Acad Sci U S A 104, 4892-4897 Kohler A, Cascio P, Leggett DS, Woo KM, Goldberg AL, Finley D (2001) The axial channel of

the proteasome core particle is gated by the Rpt2 ATPase and controls both substrate entry and product release. Mol Cell 7, 1143-1152

Kolonin MG, Bover L, Sun J, Zurita AJ, Do KA, Lahdenranta J, Cardo-Vila M, Giordano RJ, Jaalouk DE, Ozawa MG, Moya CA, Souza GR, Staquicini FI, Kunyiasu A, Scudiero DA, Holbeck SL, Sausville EA, Arap W, Pasqualini R (2006) Ligand-directed surface profiling of human cancer cells with combinatorial peptide libraries. Cancer Res 66, 34-40

Kolonin MG, Pasqualini R, Arap W (2002) Teratogenicity induced by targeting a placental immunoglobulin transporter. Proc Natl Acad Sci U S A 99, 13055-13060

Kondo A, Ueda M (2004) Yeast cell-surface display--applications of molecular display. Appl Microbiol Biotechnol 64, 28-40

Kramer RA, Cox F, van der Horst M, van der Oudenrijn S, Res PC, Bia J, Logtenberg T, de Kruif J (2003) A novel helper phage that improves phage display selection efficiency by preventing the amplification of phages without recombinant protein. Nucleic Acids Res 31, e59

Kretzschmar T, Zimmermann C, Geiser M (1995) Selection procedures for nonmatured phage antibodies: a quantitative comparison and optimization strategies. Anal Biochem 224, 413-419

Kristensen P, Ravn P, Jensen KB, Jensen K (2000) Applying phage display technology in aging research. Biogerontology 1, 67-78

Kristensen P, Winter G (1998) Proteolytic selection for protein folding using filamentous bacteriophages. Fold Des 3, 321-328

Kupsch JM, Tidman NH, Kang NV, Truman H, Hamilton S, Patel N, Newton Bishop JA, Leigh IM, Crowe JS (1999) Isolation of human tumor-specific antibodies by selection of an antibody phage library on melanoma cells. Clin Cancer Res 5, 925-931

Kwon YD, Nagy I, Adams PD, Baumeister W, Jap BK (2004) Crystal structures of the Rhodococcus proteasome with and without its pro-peptides: implications for the role of the pro-peptide in proteasome assembly. J Mol Biol 335, 233-245

Lang IM, Barbas CF, 3rd, Schleef RR (1996) Recombinant rabbit Fab with binding activity to type-1 plasminogen activator inhibitor derived from a phage-display library against human alpha-granules. Gene 172, 295-298

Lee CK, Klopp RG, Weindruch R, Prolla TA (1999) Gene expression profile of aging and its retardation by caloric restriction. Science 285, 1390-1393

Lipovsek D, Pluckthun A (2004) In-vitro protein evolution by ribosome display and mRNA display. J Immunol Methods 290, 51-67

Liu CW, Li X, Thompson D, Wooding K, Chang TL, Tang Z, Yu H, Thomas PJ, DeMartino GN (2006) ATP binding and ATP hydrolysis play distinct roles in the function of 26S proteasome. Mol Cell 24, 39-50

Lodish (2004) Molecular cell biology (5th ed.).

Lowe J, Stock D, Jap B, Zwickl P, Baumeister W, Huber R (1995) Crystal structure of the 20S proteasome from the archaeon T. acidophilum at 3.4 A resolution. Science 268, 533-539 Lubkowski J, Hennecke F, Pluckthun A, Wlodawer A (1998) The structural basis of phage

display elucidated by the crystal structure of the N-terminal domains of g3p. Nat Struct Biol 5, 140-147

Marks JD, Griffiths AD, Malmqvist M, Clackson TP, Bye JM, Winter G (1992) By-passing immunization: building high affinity human antibodies by chain shuffling. Biotechnology (N Y) 10, 779-783

Marks JD, Hoogenboom HR, Bonnert TP, McCafferty J, Griffiths AD, Winter G (1991) By-passing immunization. Human antibodies from V-gene libraries displayed on phage. J Mol Biol 222, 581-597

Martinez-Vicente M, Sovak G, Cuervo AM (2005) Protein degradation and aging. Exp Gerontol 40, 622-633

Matsuura T, Pluckthun A (2003) Selection based on the folding properties of proteins with ribosome display. FEBS Lett 539, 24-28

Mavrangelos C, Thiel M, Adamson PJ, Millard DJ, Nobbs S, Zola H, Nicholson IC (2001) Increased yield and activity of soluble single-chain antibody fragments by combining high-level expression and the Skp periplasmic chaperonin. Protein Expr Purif 23, 289-295 McCafferty J, Griffiths AD, Winter G, Chiswell DJ (1990) Phage antibodies: filamentous

Meiners S, Heyken D, Weller A, Ludwig A, Stangl K, Kloetzel PM, Kruger E (2003) Inhibition of proteasome activity induces concerted expression of proteasome genes and de novo formation of Mammalian proteasomes. J Biol Chem 278, 21517-21525

Mian IS, Bradwell AR, Olson AJ (1991) Structure, function and properties of antibody binding sites. J Mol Biol 217, 133-151

Mintz PJ, Kim J, Do KA, Wang X, Zinner RG, Cristofanilli M, Arap MA, Hong WK, Troncoso P, Logothetis CJ, Pasqualini R, Arap W (2003) Fingerprinting the circulating repertoire of antibodies from cancer patients. Nat Biotechnol 21, 57-63

Murata S, Sasaki K, Kishimoto T, Niwa S, Hayashi H, Takahama Y, Tanaka K (2007) Regulation of CD8+ T cell development by thymus-specific proteasomes. Science 316, 1349-1353

Nagler C, Nagler G, Kuhn A (2007) Cysteine residues in the transmembrane regions of M13 procoat protein suggest that oligomeric coat proteins assemble onto phage progeny. J Bacteriol 189, 2897-2905

Nakamura M, Tsumoto K, Kumagai I, Ishimura K (2003) A morphologic study of filamentous phage infection of Escherichia coli using biotinylated phages. FEBS Lett 536, 167-172

Nam JM, Nair PM, Neve RM, Gray JW, Groves JT (2006) A fluid membrane-based soluble ligand-display system for live-cell assays. Chembiochem 7, 436-440

Nandi D, Tahiliani P, Kumar A, Chandu D (2006) The ubiquitin-proteasome system. J Biosci 31, 137-155

Nemazee D (2006) Receptor editing in lymphocyte development and central tolerance. Nat Rev Immunol 6, 728-740

Ni M, Yu B, Huang Y, Tang Z, Lei P, Shen X, Xin W, Zhu H, Shen G (2008) Homology modelling and bivalent single-chain Fv construction of anti-HepG2 single-chain immunoglobulin Fv fragments from a phage display library. J Biosci 33, 691-697

Nissim A, Hoogenboom HR, Tomlinson IM, Flynn G, Midgley C, Lane D, Winter G (1994) Antibody fragments from a 'single pot' phage display library as immunochemical reagents. EMBO J 13, 692-698

O'Connell D, Becerril B, Roy-Burman A, Daws M, Marks JD (2002) Phage versus phagemid libraries for generation of human monoclonal antibodies. J Mol Biol 321, 49-56

Oliver CN, Levine RL, Stadtman ER (1987) A role of mixed-function oxidation reactions in the accumulation of altered enzyme forms during aging. J Am Geriatr Soc 35, 947-956 Orum H, Andersen PS, Oster A, Johansen LK, Riise E, Bjornvad M, Svendsen I, Engberg J

(1993) Efficient method for constructing comprehensive murine Fab antibody libraries displayed on phage. Nucleic Acids Res 21, 4491-4498

Pansri P, Jaruseranee N, Rangnoi K, Kristensen P, Yamabhai M (2009) A compact phage display human scFv library for selection of antibodies to a wide variety of antigens. BMC Biotechnol 9, 6

Paschke M (2006) Phage display systems and their applications. Appl Microbiol Biotechnol 70, 2-11

Pasqualini R, Ruoslahti E (1996) Organ targeting in vivo using phage display peptide libraries. Nature 380, 364-366

Petropoulou C, Chondrogianni N, Simoes D, Agiostratidou G, Drosopoulos N, Kotsota V, Gonos ES (2000) Aging and longevity. A paradigm of complementation between homeostatic mechanisms and genetic control? Ann N Y Acad Sci 908, 133-142

Rabl J, Smith DM, Yu Y, Chang SC, Goldberg AL, Cheng Y (2008) Mechanism of gate opening in the 20S proteasome by the proteasomal ATPases. Mol Cell 30, 360-368

Rajotte D, Arap W, Hagedorn M, Koivunen E, Pasqualini R, Ruoslahti E (1998) Molecular heterogeneity of the vascular endothelium revealed by in vivo phage display. J Clin Invest 102, 430-437

Rajotte D, Ruoslahti E (1999) Membrane dipeptidase is the receptor for a lung-targeting peptide identified by in vivo phage display. J Biol Chem 274, 11593-11598

Rakonjac J, Jovanovic G, Model P (1997) Filamentous phage infection-mediated gene expression: construction and propagation of the gIII deletion mutant helper phage R408d3. Gene 198, 99-103

Rape M, Jentsch S (2004) Productive RUPture: activation of transcription factors by proteasomal processing. Biochim Biophys Acta 1695, 209-213

Rattan SI (1995) Ageing--a biological perspective. Mol Aspects Med 16, 439-508

Rhyner C, Weichel M, Fluckiger S, Hemmann S, Kleber-Janke T, Crameri R (2004) Cloning allergens via phage display. Methods 32, 212-218

Rondot S, Koch J, Breitling F, Dubel S (2001) A helper phage to improve single-chain antibody presentation in phage display. Nat Biotechnol 19, 75-78

Russel M (2004) Introduction to phage biology and phage display.

Russel M, Model P (1989) Genetic analysis of the filamentous bacteriophage packaging signal and of the proteins that interact with it. J Virol 63, 3284-3295

Sanchez L, Ayala M, Freyre F, Pedroso I, Bell H, Falcon V, Gavilondo JV (1999) High cytoplasmic expression in E. coli, purification, and in vitro refolding of a single chain Fv antibody fragment against the hepatitis B surface antigen. J Biotechnol 72, 13-20

Sanz I (1991) Multiple mechanisms participate in the generation of diversity of human H chain CDR3 regions. J Immunol 147, 1720-1729

Schimmele B, Grafe N, Pluckthun A (2005) Ribosome display of mammalian receptor domains. Protein Eng Des Sel 18, 285-294

Schofield DJ, Pope AR, Clementel V, Buckell J, Chapple S, Clarke KF, Conquer JS, Crofts AM, Crowther SR, Dyson MR, Flack G, Griffin GJ, Hooks Y, Howat WJ, Kolb-Kokocinski A, Kunze S, Martin CD, Maslen GL, Mitchell JN, O'Sullivan M, Perera RL, Roake W, Shadbolt SP, Vincent KJ, Warford A, Wilson WE, Xie J, Young JL, McCafferty J (2007) Application of phage display to high throughput antibody generation and characterization. Genome Biol 8, R254

Scott MG, Levine AD, Butch AW, Bowen MB, Macke KA, Nahm MH (1990) Production, characterization and use of five monoclonal antibodies to human IL-4. Lymphokine Res 9, 81-93

Sergeeva A, Kolonin MG, Molldrem JJ, Pasqualini R, Arap W (2006) Display technologies: application for the discovery of drug and gene delivery agents. Adv Drug Deliv Rev 58, 1622-1654

Sharon M, Taverner T, Ambroggio XI, Deshaies RJ, Robinson CV (2006) Structural organization of the 19S proteasome lid: insights from MS of intact complexes. PLoS Biol 4, e267

Sheets MD, Amersdorfer P, Finnern R, Sargent P, Lindquist E, Schier R, Hemingsen G, Wong C, Gerhart JC, Marks JD (1998) Efficient construction of a large nonimmune phage antibody library: the production of high-affinity human single-chain antibodies to protein antigens. Proc Natl Acad Sci U S A 95, 6157-6162

Sitte N, Huber M, Grune T, Ladhoff A, Doecke WD, Von Zglinicki T, Davies KJ (2000) Proteasome inhibition by lipofuscin/ceroid during postmitotic aging of fibroblasts. FASEB J 14, 1490-1498

Smith DM, Chang SC, Park S, Finley D, Cheng Y, Goldberg AL (2007) Docking of the proteasomal ATPases' carboxyl termini in the 20S proteasome's alpha ring opens the gate for substrate entry. Mol Cell 27, 731-744

Smith DM, Kafri G, Cheng Y, Ng D, Walz T, Goldberg AL (2005) ATP binding to PAN or the 26S ATPases causes association with the 20S proteasome, gate opening, and translocation of unfolded proteins. Mol Cell 20, 687-698

Smith GP (1985) Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228, 1315-1317