• Non ci sono risultati.

MATERIALS AND METHODS

N/A
N/A
Protected

Academic year: 2021

Condividi "MATERIALS AND METHODS"

Copied!
9
0
0

Testo completo

(1)

33

MATERIALS AND

METHODS

1. Embryos handling

In order to obtain Xenopus laevis embryos, each adult female used were injected with 800-1000 units of human chorionic gonadotropin (Gonasi HP 5000 U.I., Amsa) 12-14 hours prior to eggs collection. Ovulated eggs were fertilized with testis homogenate and let to develop in 0.1X MMR. Jelly coats were removed by using the dejelling solution.

2. Embryos microinjection and manipulation

For knock-down experiments, a morpholino antisense oligonucleotide, targeted to the 5’ untranslated region of 5-HT2B mRNA (Mo, Gene Tools, LLC), has been injected together with nuclear-β-galactosidase (n-β-gal) and Green Fluorescent Protein (GFP) in vitro transcribed capped mRNAs (see Results).

X5-HT2B-Mo sequence:

5’-GTGCCAGGGAATGGAGATTGTGTCT-3’

For over-expression experiments, X5-HT2B in vitro transcribe capped mRNA was injected together with nuclear-β-galactosidase (β-gal) and Green Fluorescent Protein (GFP) capped mRNA (see Results).

(2)

34 blastomere of two-cells stage embryos. Microinjections were performed using a Drummond "Nanoject" apparatus. Embryos were injected in 0.1X MMR and 3% Ficoll-400 and cultured overnight (O./N.) at 18° C in the same solution. Embryos were subsequently transferred in 0,1X MMR and incubated at Room Temperature (R.T.) until the desired developmental stage. Embryos were staged according to Nieuwkoop and Faber (1967).

When n-β-gal mRNA was used as a lineage tracer in microinjection experiments, β-gal staining was detected by fixing embryos in 1X MEMFA for 30 min. at R.T., washing in 1X PBS pH 7.3 and than incubating them in β-gal staining solution for 20- 30 min. at 37°C. Embryos were than fixed again in 1X MEMFA for 1 hour at R.T. and then gradually dehydrated with ethanol to be processed by whole mount in situ hybridization. The embryos treatment before in situ hybridization on sectioned embryos will be detailed afterward.

2.1. Capped mRNAs

Capped mRNAs were synthesized in vitro from the

template cDNAs using the SP6 mMESSAGE

mMACHINE Kit (Ambion). After DNase digestion to remove template cDNA, transcripts were purified with 0.1 volume of Ammonium Acetate to avoid embryos gastrulation defects, extracted with 1 volume of phenol/chloroform, Precipitate with 2 volume of 100% ethanol, resuspended in water at the 500 ng/µl concentration and stored at -20°C. Concentration and

(3)

35 length of transcripts were estimated by agarose gel electrophoresis.

2.1.1. Constructs used for over-expression analysis: linearization and capped mRNA transcription

- n-β-gal (NotI/Sp6), containing the nuclear-β-galactosidase reporter inserted into the pCS2+ vector (Chitnis et al,. 1995).

- pCMTEGFP (NotI/Sp6), containing the Enhanced Green Fluorescent Protein reporter gene inserted into the pCS2+ vector (a gift from D. Gilmour).

2.2. Pharmacological treatments

5-HT2B Selective antagonist (Sigma, cat. R 2533) was used to treat from stage 25 to 37 embryos at a final concentration of 150 μM. Culture medium plus was prepared fresh and changed daily.

3. RNA Extraction, cDNA Synthesis and qPCR

Total RNA was RNA was extracted from 15 embryos head and it was isolated using the TRIZOL Reagent (Invitrogen). To quantify gene expression levels, equal amounts of cDNA were synthesized using ImProm-II™ Reverse Transcription System (Promega) and mixed with GoTaq® qPCR Master Mix (Promega) 1X, primers 0,25 µM e 32 ng di cDNA. GAPDH was amplified as an internal control. All primers were designed to have a Tm of 60 ° C, the following are all sequences. All qPCR was conducted at 50°C for 5 min, and then 45

(4)

36 cycles of 95°C for: 95°C for 15s , 60°C for 20 s and 72°C for 40 s. The specificity of the reaction was verified by melt curve analysis. The threshold crossing value was noted for each transcript and normalized to the internal control. The relative quantitation of each mRNA was performed using the comparative “Delta-delta Ct” method. Statistical analysis was performed using the t-test. All experiments has been repeated on biological triplicated.

3.1 Primers used for qPCR gene expression analysis XFoxC2:

primer forward: GCCCCTTCTAATGTGTTTGG,

primer reverse: AAGCGCTGAAAACAGCTCAG

XPitx2:

primer forward: TCGGCCTGAAAAACGACATG, primer reverse: TGAGTTTTGCAGCCATCACC

XRaldh3:

primer forward: ATAAGTGGCCGCACTTTTGC, primer reverse: ACAGCCTTGTCAACATCTGC

XFoxC1:

primer forward: TGTGAGACAAACTGCGCTTC, primer reverse: ATGGGCACAGCAATAGGAAC

(5)

37

XRdh10:

primer forward: CTACCACCCCTGAAACCAGA, primer reverse: AGGAACCGGTACATGCAGAC

XDhrs3a:

primer forward: CAGGCGCAAGAAATCCTAAG, primer reverse: AAAGGCCACGTTACAGGATG

XCyp26A1:

primer forward: AGGTTTGGCTTCATCCCTTT, primer reverse: TTAGCGGGTAGGTTGTCCAC

XGapdh:

primer forward:CTTTGATGCTGATGCTGGAA, primer reverse:GAAGAGGGGTTGACAGGTGA

4. In situ hybridization

4.1. Purification of plasmidic DNA

Plasmidic DNA were prepared according to the alkaline lysis procedure, followed by chromatography over QIAGEN columns. After purification, circular plasmids were digested with appropriate restriction enzymes, in order to linearize templates for in vitro transcriptions. 4.1.1. Constructs used for gene expression analysis: linearization and RNA transcription to generate antisense mRNA probes

(6)

38 XDct-pBS: SacI/T7 XRaldh3-pGemTeasy: SpeI/T7 XFoxC1-pCS107: Asp718/SP6 XVax2-pBS: NotI/T7 XPax2-pBSIISK: EcoRI/T3 XTwist-pCR2.1: HindIII/T7

4.2. Synthesis of digoxigenin (DIG) labeled probes Linearized plasmids were used as template to synthesize digoxigenin-11-UTP- labeled (Boehringer Mannheim) antisense mRNA probes employing the RNA polymerases indicated above. In particular, transcription reactions were incubatedin the presence of 10 mM each of rATP, rCTP, rGTP, rUTP/DIG-11-rUTP (3/2) 2 hours at 37°C. After DNase digestion to remove template DNA, the amount and length of transcripts were estimated by agarose gel electrophoresis. Probes were than diluted in hybridization mix at a final concentration of 10 µg/ml and stored at -20°C for several months. 4.3. Whole mount in situ hybridization

Whole-mount in situ hybridization was performed by using standard procedures as described in Harland (1991), except that BM purple (Roche) was used as a substrate for the alkaline phosphatase. After colour development embryos were post- fixed on 1X MEMFA and bleached over a fluorescent light for about 1 hour to remove the pigment. Control experiments were performed with sense probes.

(7)

39 For histological examination, whole-mount in situ hybridization processed embryos were embedded in a paraffin solution according to the protocol described in Levin (2004) whit minor modification, and then sectioned at 12 µm thickness using a microtome.

4.4. In situ hybridization on frozen tissue sections Embryos collected for in situ hybridization on cryostat cut tissue sections were fixed 2 hours in 4% paraphormaldeyde in 1X PBS, cryo-protected with 20% sucrose in 1X PBS and subsequently embedded in the optimal cutting temperature (O.C.T.) compound (Sakura Finetek) and stored at -80°C.

In situ hybridization on 12 µm cryostat sectioned embryos was performed as described in Strahle et al., (1994) with minor modifications.

Control experiments were performed with sense probes. 5. Whole mount immunohistochemistry

Muscle specific 12/101 monoclonal antibody (1:10, Developmental Studies Hybridoma Bank), a Nerve specific 3A10 monoclonal antibody (1:100, Developmental Studies Hybridoma Bank) and anti-GFP polyclonal antibody (1:2000, Molecular Probes) were used following a standard immunohistochemistry procedure.

6. Neural crest cells transplantation assay

(8)

40 and β-gal capped mRNA as described above. Embryos over-expressing X5-HT2B were starved in MMR 0,1X until stage 15 and selected for the presence of the GFP in the neural plate. NCC transplantation assays were performed as described in Borchers et al., 2000, with minor modifications.

7. Tunel Assay

Tunel staining on whle mount embryos at stage 37 was performed by using the ApopTag Peroxidase Kit (Serologicals), following the manufacturer’s instruction 8. Solutions BLEACHING SOLUTION 2% H2O2 5% Formamide 0.5X SSC 1X PBS DEJELLING SOLUTION DTT (dithiothreitol) 3.2 mM Tris pH 8.8, 0.2 M MEMFA salts 10X MOPS (pH 7.4) 100 mM EGTA 2 mM MgSO4 1 mM Formaldehyde 3.7%

(9)

41 MMR (Marc’s Modified Ringer’s) 10X

NaCl 0.1M KCl 2mM MgSO4 1mM CaCl2 2mM HEPES (pH 7.8) 5mM EDTA 0.1mM

PBS (Phosphate Buffer Saline) 10X NaCl 137mM

KCl 2.07mM Na2HPO4 10mM KH2PO4 2mM pH 7.3

β-gal STAINING SOLUTION

K3Fe(CN)6 (Potassium Ferricyanide) 5mM K4Fe(CN)6 (Potassium Ferrocyanide) 5mM MgCl2 2mM

Red-gal substrate 1 mg/ml 1X PBS

Riferimenti

Documenti correlati

 test.skin: meshed skin of the geometric model in input; useful to adjust the model, verify the correctness of pre-processing (how data are transmitted to the thermal code)

In Figure 5.10 the expected Doppler frequencies for cars travelling on Aurelia roadway are shown and the green rectangular border represents the expected Doppler frequencies in

A large-scale comparative study and simulation study with adequate evaluation measures are needed to provide insights and practical guidelines for choosing the

This hollow cathode represents the first prototype for HETs, designed completely at the Centrospazio in a previous work, so the experimental activity has been focused on the

As for the value of Resistance to Uniaxial Compressive Strenght, the survey refers to the results obtained by the compressive press, being it a direct test; the instrument

In particular, the device is suitable to be employed for the communication function in a Cognitive Radio network where the sensing spectrum function is executed by

Up to now this class of low power thrusters has not been deeply studied, in fact, only recently there is a great interest to mini and micro satellites that ask for thruster

The draft Personal and Family Code abolishes the rule of double birth on the territory and provides for the acquisition of Cameroonian nationality by declaration only