The Central Dogma
The central dogma states
that information in nucleic
acid can be perpetuated or
transferred, but the transfer
of information form into
protein is irreversible.
Gene Expression and Regulation
Genes Can Be Expressed with Different Efficiencies at Different Times and Environments
Translation
• The conversion of the information in the language of a nucleid acid into the language of a protein
• Translation of the RNA message (mRNA) into a
polypeptide chain is catalyzed by the ribosome
The Ribosome
“Large protein- manufacturing machine”
The Prokaryotic Ribosome
The Genetic Code
• Generally, the correspondance between the
information stored in the language of nucleid acid and protein
• Defines how the message is translated (”a nucleid acid –amino acid dictionary”)
• More specifically, the correspondance between triplets of nucleotides in the mRNA (read from 5’ to 3’) and
amino acids in protein (read from N-terminus to C-
terminus)
Triplet code (why?)
Codon = group of three
consecutive nucleotides = triplet Start codon (in green)
• AUG
Stop codons (in orange)
• UAA, UAG, UGA
Redundant (usually the 3rd
nucleotide), because 61 codons for 20 amino acids
The Genetic Code
4n > 20, when n={3,4,5,...}
The Genetic Code
Three Conceivable Kinds of Genetic Codes
Interpretation of the Code
• The meaning of a codon that represents an amino acid is determined by the tRNA that corresponds to it
• This requires base pairing between the codon in mRNA with the anticodon of the tRNA within the ribosome
• The meaning of the termination codons is determined directly by the protein factors
• Chemically similar amino acids are represented by related codons to minimize the effect of mutations
• Identical in almost all living organisms (differences in the code of mitochondrial DNA)
Transfer RNAs (tRNAs)
• Adaptor molecules that match amino acids to codons in mRNA
• Any cell contains different types of tRNA molecules sufficient to incorporate all 20 amino acids into protein
• Some tRNAs can recognise more than one codon
• About 80 nucleotides in length
Structures of tRNAs
All tRNAs share a general
common structure that includes:
• an anticodon triplet loop (pairs with mRNA codons)
• an acceptor stem
(to which the amino acid is attached)
Structures of tRNAs
Coupling of amino acids to tRNAs
1. The amino acid is accepted by the aminoacyl-tRNA
synthetase enzyme and is adenylated
2. The proper tRNA is
accepted by the enzyme and the amino acid residue is
transferred to the 2’ or 3’ OH of the 3’-terminal residue of the RNA
Individual synthetase for each amino acid and corresponding
Reading frames
6 reading frames (a–f) in dsDNA (of course, only 3 in mRNA)
ORF = Open Reading Frame From start codon to stop codon
5’ ATGTTTGCTGACGGTTTAACGGAAGGCGGAAACATGGCGAAGAAAAAACCAGTAGAAAAA 3’
---+---+---+---+---+---+
3’ TACAAACGACTGCCAAATTGCCTTCCGCCTTTGTACCGCTTCTTTTTTGGTCATCTTTTT 5’
a M F A D G L T E G G N M A K K K P V E K b C L L T V * R K A E T W R R K N Q * K K c V C * R F N G R R K H G E E K T S R K K ---+---+---+---+---+---+
d H K S V T * R F A S V H R L F F W Y F F e N A S P K V S P P F M A F F F G T S F f T Q Q R N L P L R F C P S S F V L L F
Structure of Prokaryotic mRNAs
mRNA has also regions that do not encode for a protein
Shine-Dalgarno sequence (SD) = Ribosome Binding Site (RBS)
The first AUG after SD-sequence is interpreted as the start site of
Shine-Dalgarno Sequences
Help to align ribosomes on mRNA to properly start translation Can base-pair with a sequence (ACCUCCUUA) contained in the ribosomal RNA
The Mechanism of Translation
Initiation in Prokaryotes
The Mechanism of Translation
Elongation in Prokaryotes (1)
E = exit site
P = peptidyl binding site A = aminoacyl binding site
The Mechanism of Translation
Elongation in Prokaryotes (2)
Binding of a specific amino acid tRNA to A site
The Mechanism of Translation
Elongation in Prokaryotes (3)
Peptide bond formation:
chain transfer from peptidyl tRNA to aminoacyl tRNA
The Mechanism of Translation
Elongation in Prokaryotes (4)
Translocation of peptidyl tRNA from A site to P
site. Ribosome moves one codon to the right, and the now uncharged tRNA
moves from P site to E site.
The Mechanism of Translation
Elongation in Prokaryotes (5)
Ribosome is ready to start another cycle.
The cycles will continue until a termination codon is
reached.
The Mechanism of Translation
Termination in Prokaryotes
The Two Steps of Decoding
The genetic code is translated by means of two adaptors that act one after another
Energetics of Translation
For a polypeptide of N residues, a minimum of 4N high energy phosphates (such as ATP or GTP) must be hydrolysed.
Cellular peptide bond synthesis 160 kJ/mol.
Peptide bond synthesis in dilute solutions 20 kJ/mol.
Making a defined sequence of amino acids comes with an energy cost.
The Regulation of Protein Synthesis
When translation is regulated, it is generally done at the initiation state:
1. The tertiary structure of the mRNA can prevent its attachment to the ribosomal subunit
2. Proteins may bind to the mRNA, blocking initiation 3. Anti-sense RNA may block initiation
