List of Publications
95
List of publications and reprints
Paper published in the project of my PhD thesis:
1. Qiao H, Tuccori E, He X, Gazzano A, Field L, Zhou J-J, Pelosi P. (2009) Discrimination of
alarm pheromone (E)-β-farnesene by aphid odorant-binding proteins. Insect Biochem Mol
Biol. 39, 414-419.
2. Qiao H, He X, Schymura D, Ban L, Field L, Dani FR, Michelucci E, Caputo B, della Torre
A, Iatrou K, Zhou J-J, Krieger J, Pelosi P. (2010) Cooperative interactions between
odorant-binding proteins of Anopheles gambiae. Cell. Mol. Life Sci. DOI
10.1007/s00018-010-0539-8.
3. Sun Y, Qiao H, Ling Y, Yang S, Rui C, Pelosi P, Yang X. (2011). New analogues of
(E)-β-farnesene with insecticidal activity and binding affinity to aphid odorant-binding
proteins. J. Agr. Food Chem. (in press)
4. Mastrobuoni G, Dani FR, Caputo B, Qiao H, Iovinella I, Felicioli A, della Torre A, Pelosi P,
Moneti G. (2011) Strong female-biased expression of Odorant-binding proteins in the
antennae of Anopheles gambiae revealed by shot-gun mass spectrometry. (manuscript in
preparation)
Paper published outside the project of my PhD thesis:
5. Dani FR, Iovinella I, Felicioli A, Niccolini A, Calvello MA, Carucci MG, Qiao H,
Pieraccini G, Turillazzi S, Moneti G, Pelosi P. (2010) Mapping the expression of soluble
olfactory proteins in the honeybee. J Proteome Res. 5, 1822-1833.
Short Communication
Discrimination of alarm pheromone (E)-
b
-farnesene
by aphid odorant-binding proteins
Huili Qiaoa, Elena Tuccoria, Xiaoli Heb, Angelo Gazzanoc, Linda Fieldb, Jing-Jiang Zhoub, Paolo Pelosia,*
aDepartment of Agricultural Chemistry and Biotechnologies, University of Pisa via S. Michele, 4, 56124 Pisa, Italy bDepartment of Biological Chemistry, Rothamsted Research, Harpenden, UK
cDepartment of Veterinary Anatomy, Biochemistry and Physiology, University of Pisa, Pisa, Italy
a r t i c l e i n f o
Article history:
Received 17 November 2008 Received in revised form 23 February 2009 Accepted 5 March 2009 Keywords: Odorant-binding protein Aphids Acyrthosiphon pisum Ligand-binding (E)-b-farnesene a b s t r a c t
OBPs have been recently demonstrated to be required for odour perception in insects and directly involved in odour discrimination. In aphids they might represent new interesting targets for the control of their population in agriculture. Based on sequence information available in the EST database, we have cloned four genes encoding odorant-binding proteins (OBP) in Acyrthosiphon pisum and homologous genes in other aphid species. Unlike OBPs from other orders of insects, that are greatly divergent, in aphids these proteins have been found to be highly conserved, with differences between species limited to only few amino acid substitutions. On the contrary, similarities between OBP sequences of the same species are poor with 31% or less of identical amino acids. Three selected OBPs (OBP1, OBP3 and OBP8) have been expressed in bacteria and purified. Ligand-binding experiments have shown similar behaviour of the three proteins towards several organic compounds, but also some significant selectivities. In particular, (E)-b-farnesene, the alarm pheromone and its related compound farnesol exhibited good affinity to OBP3, but did not bind the other two proteins. We suggest that OBP3 could mediate response of aphids to the alarm pheromone.
Ó 2009 Elsevier Ltd. All rights reserved.
1. Introduction
Several aphid species are major pests in agriculture, affecting many different crops. The damage associated with their presence is mainly due to the vectoring of plant virus diseases which infect many crop plants. Aphids include a great number of species of different size, colour and shape, and occupying many niches. Despite such diversity, a single alarm pheromone, (E)-b-farnesene (Pickett et al., 1992; Bowers et al., 1972), is produced and utilised by most aphids. Out of 23 species examined, 21 contain (E)-b -farnesene in their pheromonal blend, while in 16 of them this compound represents the only or the major component (Francis et al., 2005). (E)-b-farnesene is secreted in the presence of danger and induces an immediate typical behaviour of dispersal. Simi-larly, the sex pheromone of many aphids is a mixture of nepe-talactone and its related alcohols nepetalactols with each species having its own pheromonal blend (Birkett and Pickett, 2003; Dawson et al., 1996). Both types of pheromones are not suitable
for use in population control. (E)-b-farnesene is not persistent in the environment, being a volatile hydrocarbon, susceptible to oxidation, owing to the presence of several double bonds in the molecule. Moreover, its chemical synthesis is complicated and expensive. However, some plants, such as the wild potato, syn-thesise (E)-b-farnesene as a product of their metabolism and thus may be naturally protected against these insects (Gibson and Pickett, 1983), and transgenic Arabidopsis thaliana carrying the genes for synthesising (E)-b-farnesene has been produced (Beale et al., 2006). This approach could be applied to crop plants with enormous economic benefits. The use of sex pheromones in the control of aphid populations is of little practical use in these mostly parthenogenetically reproducing insects.
Given the great economical impact of aphids, a better under-standing of their chemical communication system is highly desir-able in order to devise strategies and produce chemical tools for their population control. According to the current view, odorants and pheromones interact with membrane-bound olfactory recep-tors (Clyne et al., 1999; Vosshall et al., 2000), triggering olfactory neurons. However, very recently, odorant-binding proteins (OBPs), soluble polypeptides highly concentrated in the sensillar lymph bathing chemosensory neurons (Vogt and Riddiford, 1981; Pelosi
*Corresponding author. Tel.: þ39 050 2216626; fax: þ39 050 2216630. E-mail address:ppelosi@agr.unipi.it(P. Pelosi).
Contents lists available atScienceDirect
Insect Biochemistry and Molecular Biology
j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / i b m b
0965-1748/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2009.03.004
et al., 2006), have been shown to be essential for pheromone and odour perception in insects (Xu et al., 2005; Matsuo et al., 2007). For example, transgenic Drosophila, lacking the lush gene, that encodes one of its OBPs, were reported to be anosmic to the male pheromone vaccenyl acetate (Xu et al., 2005). Interestingly, behaviour experiments, performed with two Drosophila species, whose genes encoding two OBPs (OBP57d and OBP57e) had been exchanged, showed that avoidance from, or attraction to, some fatty acids could be reversed, even without any manipulation of their olfactory receptors (Matsuo et al., 2007). These data strongly suggest that OBPs are primary elements of odour recognition in insects. Most recently, it has been shown that a mutant of Drosophila LUSH can activate the specific olfactory neuron for vaccenyl acetate even in the absence of the pheromone, since this mutant can mimic the conformation of LUSH when bound to vac-cenyl acetate. (Laughlin et al., 2008).
In this study we have focused our attention on OBPs and their ligand-binding properties in aphids using currently available EST databases, from which we have extracted some nucleotide sequences encoding proteins readily recognisable as OBPs. Here we describe the cloning and sequencing of four OBPs from several aphid species, their bacterial expression and ligand-binding specificity. 2. Materials and methods
2.1. Reagents
Oligonucleotides were custom synthesised at Eurofins MWG GmbH, Ebersberg, Germany. (E)-b-farnesene was purchased from Bedoukian Research, Danbury, CT, USA. All other chemical reagents and ligands, except those synthesised in our lab and unless stated otherwise, were from Sigma–Aldrich and of reagent grade. 2.2. Synthesis of selected ligands
Esters were prepared by reaction of the appropriate acyl chlo-ride and alcohol at room temperature or by refluxing the acid and the alcohol in benzene for 6 h. The products were purified by distillation under reduced pressure.
2.3. RNA extraction and cDNA synthesis
Total RNA was extracted from 50 to 100 whole aphids, using the TRIÒReagent (Sigma), along with the manufacturer’s protocol, and
dissolved in 50mL of sterile water. cDNA was prepared from 10mL of total RNA by reverse transcription, using 200 units of M-MuLV Reverse Transcriptase (Fynnzymes) and 0.5 mg of an oligo-dT primer in a 50ml total volume. The mixture also contained 0.5 mM of each dNTP (GE Healthcare), 75 mM KCl, 3 mM MgCl2, 10 mM DTT
and 0.1 mg/ml BSA in 50 mM Tris–HCl, pH 8.3. The reaction mixture was incubated at 42C for 60 min and the product was either used
directly for PCR amplification or stored at 20C.
2.4. Polymerase chain reaction
Aliquots of 1mL of cDNA were amplified in a Bio-Rad Gene CyclerTM thermocycler, using 2.5 units of Taq DNA polymerase (EuroClone), 0.2 mM of each dNTP (EuroClone), 1mM of each PCR primer, 50 mM KCl, 2.5 mM MgCl2and 0.1 mg/ml BSA in 10 mM Tris–
HCl, pH 8.3, containing 0.1% v/v Triton X-100. After 5 min at 95C, 35
cycles were performed (30 s at 95C, 30 s at 50C and 60 s at 72C)
followed by 7 min at 72C. The forward primer contained the
sequence encoding the first six amino acids of the mature protein, preceded by an ATG start codon and an Nde I restriction site. The reverse primer contained the sequence encoding the last six amino
acids, followed by a stop codon and an EcoRI restriction site. The following primers were used (enzyme sites are underlined):
OBP1-forward: 50- AACATATGGAAAGCGACCAAGTCCCT -30; OBP1-reverse: 50- GTGAATTCTTAATCTGACGTGCAGGATC; OBP2-forward: 50-AACATATGTCGGACCCATGTAACATA -30; OBP2-reverse: 50- GTGAATTCTTATGCTTTAGGGAAGAAATT -30; OBP3-forward: 50- AACATATGCGATTTTCGACGGAACA -30; OBP3-reverse: 50- GTGAATTCTTATTAAGTTGACTTGTCGAGATC -30; OBP8-forward: 50- AACATATGGAAAACAATCAACAAAA -30; OBP8-reverse: 50- GTGAATTCTTATTACATGCTATTGCGTCTGAA.
2.5. Cloning and sequencing
PCR products were ligated into the pGEM (Promega) vector without further purification and the crude ligation product used to transform E. coli XL-1 Blue competent cells. DNA was extracted from positive colonies and custom sequenced at Eurofins MWG (Martinsried, Germany).
2.6. Cloning in expression vectors
pGEM plasmids containing the appropriate OBP sequence were digested with Nde I and EcoRI restriction enzymes for 2 h at 37C
and the digestion products were separated on agarose gel. The fragments were purified from gel slices and ligated into the expression vector pET30b (Novagen, Darmstadt, Germany) line-arised with the same enzymes. The resulting plasmids were sequenced to show that they encoded the mature OBPs.
2.7. Preparation of the proteins
BL-21 DE3 pLys E. coli cells were transformed with the pET30b vector containing the appropriate OBP sequence and when the culture had reached a value of OD600¼ 0.8 protein expression was
induced by addition of IPTG to a final concentration of 0.4 mM. Cells were grown for a further 2 h at 37C, harvested by centrifugation
and sonicated. After centrifugation, all the protein was present in the pellet and was solubilised in urea/DTT as described for other insects OBPs (Prestwich, 1993; Plettner et al., 2000; Ban et al., 2003; Kruse et al., 2003). Spontaneous renaturation was obtained by extensive dialysis against Tris buffer.
The proteins were purified by two anion-exchange chromato-graphic steps on DE-52 (Whatman) resin, followed by gel filtration on Superose-12 (Pharmacia) using a protocol described previously for other OBPs (Ban et al., 2003; Calvello et al., 2003).
2.8. Fluorescence measurements
Emission fluorescence spectra were recorded on a Jasco FP-750 instrument with a 1 cm light path quartz cuvette and 5 nm slits for both excitation and emission. The fluorescent probe N-phenyl-1-naphthylamine (1-NPN) was excited at 337 nm and emission spectra were recorded between 380 and 450 nm. To measure the affinity of 1-NPN to each protein, a 2mM solution of the protein in 50 mM Tris– HCl, pH 7.4, was titrated with aliquots of 1 mM ligand in methanol to final concentrations of 2–16mM. The affinity of other ligands was measured in competitive binding assays, using both protein and 1-NPN at 2mM in the presence of 2–16mM of each competitor.
For determining binding constants, the intensity values corre-sponding to the maximum of fluorescence emission (408–409 nm) were plotted against free ligand concentrations. The amount of bound ligand was then evaluated from the values of fluorescence intensity assuming that the protein was 100% active, with
a stoichiometry of 1:1 protein:ligand at saturation. The curves were linearised using Scatchard plots. Dissociation constants of the competitors (Ki) were calculated from the corresponding IC50
values, using the equation: Ki ¼ ½IC50=1 þ ½1-NPN=K1-NPN, where
[1-NPN] is the free concentration of 1-NPN and K1-NPN is the
dissociation constant of the protein/1-NPN complex. 2.9. Molecular modelling
A three-dimensional model of A. pisum OBP3 was generated using the on-line programme SWISS MODEL (Schwede et al., 2003; Guex and Peitsch, 1997; Arnold et al., 2006). Models were displayed using the SwissPdb Viewer programme ‘‘Deep-View’’ (Guex and Peitsch, 1997) (http://www.expasy.org/spdbv/) and the crystal structure of the PBP of Leucophaea maderae (PDB: 1ORG_A;Lartigue et al., 2003) as a template. Amino acid identity between the two proteins is 23%
3. Results and discussion 3.1. Identification of aphids OBPs
We performed a first search for aphids OBPs in the EST database, using the BLAST programme and the locust OBP1 (Genbank acc.no.
AF542076) as a template. This was not an exhaustive mining of aphid OBPs in the EST database and no attempt was later made to compare the number of OBPs obtained with those now available from the A. pisum genome. We obtained 36 aphid sequences (27 of them from the pea aphid A. pisum), that encoded proteins with the typical 6-cysteine signature of OBPs. Three of them (OBP1, OBP3 and OBP8) could be classified as ‘‘classical’’ OBPs, containing only the six conseved cysteines, whilst another (OBP2) differed mark-edly from the others for having a much longer N-terminus, that also contained two additional cysteines. Percent of identical amino acids between the locust OBP1 and the aphids sequences were 17, 16, 21 and 16% for OBP1, OBP2, OBP3 and OBP8, respectively, as calculated on the overlapping regions. Using specific primers for the ends of the sequences encoding the mature proteins, we amplified homologous genes from other aphid species (listed in the legend ofFig. 1), obtaining 2 additional sequences for OBP1, 6 for OBP2 and 5 for OBP8 (Fig. 1). The three classical OBPs of A. pisum, aligned inFig. 1are very divergent, with only six common residues, besides the six cysteine motif. Identities between each pair of OBPs are between 12 and 31%. In contrast with this high diversity, identity between OBPs of the same type in different species is very high with differences limited to no more than 2–3 amino acids, even between phylogenetically distant species, such as Pterocomma salicis and Tuberolachnus salignus, the first sharing with the other
Fig. 1. Upper. Amino acid sequences of three ‘‘classical’’ OBPs of A. pisum (Apis). Signal peptides are underlined. In addition to the six cysteine motif (asterisks) only six amino acids are conserved in all three proteins (indicated by dots). Identities between each pair of OBPs are between 12 and 31%. In contrast with such high diversity, identity between OBPs of the same type in different species is very high, differences being limited to no more than 2–3 amino acids. Lower. Sequences of OBP2 in seven species of aphids. This protein is longer than ‘‘classical’’ OBPs and has two additional cysteines. We obtained two additional sequences for OBP1, six for OBP2 and five for OBP8 in Myzus persicae (Mper), Megoura viciae (Mvic), Nasonovia ribisnigri (Nrib), Aphis fabae (Afab), Aphis craccivora (Acra), Metopolophium dirhodum (Mdir), Tuberolachnus salignus (Tsal) and Pterocomma salicis (Psal). GenBank acc.no. for all the sequences obtained are: ApisOBP1: FM242527, TsalOBP1: FM242558, PsalOBP1: FM242559, ApisOBP2: FM242528, MvicOBP2: FM242550, NribOBP2: FM242553, AfabOBP2: FM242555, AcraOBP2: FM242557, MdirOBP2: FM242538, PsalOBP2: FM242560, ApisOBP3: FM242529, ApisOBP8: FM242534, MperOBP8: FM242547, MvicOBP8: FM242552, NribOBP8: FM242554, AfabOBP8: FM242556, MdirOBP8: FM242542.
H. Qiao et al. / Insect Biochemistry and Molecular Biology 39 (2009) 414–419 416
species only the family (Aphididae), the second belonging to a different family (Lachnidae).Fig. 1also reports the sequences of OBP2 in the seven aphid species. This protein is also well conserved, although with a larger number of amino acid substitutions. Such high conservation of the sequences, unusual among insect OBPs (Pelosi et al., 2006), may be related to the fact that several aphid species, although phylogenetically distant, utilise the same
pheromone components, namely (E)-b-farnesene as the alarm pheromone (Pickett et al., 1992; Bowers et al., 1972), and nepeta-lactone and/or one of the isomeric nepetalactols as the sex pher-omone (Birkett and Pickett, 2003; Dawson et al., 1996).
It has been recently observed that major structural differences in insect OBPs are related to the length of their C-terminal region, that can undergo conformational changes triggered by the pH and the presence of a ligand. Accordingly, in long OBPs (z160 residues) the C-terminus can fold back into the binding pocket, in those of medium length (z120 residues) the C-terminus can only block the entrance to the binding site, while in short OBPs (z110 residues) no conformational change seems to occur (Pesenti et al., 2008). According to this classification, OBP3 with 118 residues, seems to fall in the group of medium OBPs, while OBP1 (140 aa) and OBP8 (144 aa) could belong to the group of long OBPs.
3.1.1. Expression of aphids OBPs
To verify the presence of the three classical OBPs in aphids and investigate their binding properties, we expressed the recombinant proteins in a bacterial system. We used a construct encoding the mature protein with the addition of an initial methionine, as described in the ‘‘Materials and methods’’. The recombinant proteins, as is the case for most insect OBPs, were expressed in high yields (more than 20 mg of protein per litre of culture), but were obtained as inclusion bodies and had to be denatured and rena-tured in order to obtain a soluble form. This process has been
Fig. 2. Expression and purification of OBP1, OBP3 and OBP8 from A. pisum. Electro-phoretic analysis (SDS-PAGE) of crude bacterial pellets before (pI) and after (In) induction with IPTG, and of purified samples (P) of the proteins. Molecular weight of markers (M) is from the top: 66, 45, 36, 29, 20 and 14 kDa.
Fig. 3. (A). Binding curve of 1-NPN to recombinant A. pisum OBP3 and Scatchard plot (inset). A 2mM solution of the protein in Tris buffer was titrated with 1 mM solution of 1-NPN in methanol to final concentrations of 2–16mM. Binding curves were measured also for OBP1 and OBP8 (data not shown) and dissociation constants (average of three replicates) were: OBP1: 6.9 1.0mM, OBP3: 5.9 1.4mM, OBP8: 5.5 0.6mM. (B, C) Competitive binding of selected ligands to A. pisum OBP3. A mixture of the protein and 1-NPN in Tris, both at the concentration of 2mM, was titrated with 1 mM solutions of each competing ligand to final concentrations of 2–16mM. Fluorescence intensities are reported as percent of the values in the absence of competitor. The same ligands were also used with OBP1 and OBP8 (data not shown). (D) Comparative binding properties of A. pisum OBP1, OBP3 and OBP8. For a more clear presentation, 1/Kivalues have been plotted. Ligands and dissociations constants (mM in brackets, in the order for OBP1, OB3, OBP8) were: (1) Ethyl benzoate (>100, >100, >100); (2) n-Butyl benzoate (12.4, 8.9, 5.9); (3) n-Hexyl benzoate (18.6, 5.2, 14.7); (4) n-Octyl benzoate (>100, >100, >100); (5) 3,7-Dimethyloctyl benzoate (>100, 14.9, 7.4); (6) 3,7-Dimethyloctyl acetate (>100, 13.4, >100); (7) Farnesol (>100, 4.5, >100); (8) (E)-b-Farnesene (>100, 9.0, >100); (9) Butylbenzophenone (3.1, 3.7, 2.9); (10) p-tert-Butylphenyl benzoate (9.3, 11.9, 4.4); (11)a-Amylcinnamaldehyde (4.7, 6.0, 4.4); (12) N-Benzyl-N0-phenylhydrazine (6.2, 14.9, 2.9). A star in the graph indicates that IC50values were
>100 and Kicould not be calculated.
reported to yield the OBPs in their native folding with the six cysteines correctly paired (Ban et al., 2003; Prestwich, 1993; Plettner et al., 2000; Kruse et al., 2003). The refolded OBPs were then purified by a combination of anion-exchange chromatography and gel filtration, along with protocols reported for proteins of the same family.Fig. 2shows the electrophoretic analysis of the crude bacterial pellets containing the recombinant proteins and samples of the purified OBPs.
3.1.2. Ligand-binding experiments
The three purified aphid OBPs were used in binding experi-ments to define the structural requireexperi-ments of ligands for effective interactions with the protein and investigate their specificity to odorants including pheromones.
All three proteins bound the fluorescent probe 1-NPN with micromolar dissociation constants in the range of other insect OBPs (OBP1: 6.9 1.0mM, OBP3: 5.9 1.4mM, OBP8: 5.5 0.6mM).
Fig. 3A shows the data for OBP3 and similar results were obtained with the other two proteins (data not shown). Using 1-NPN as the fluorescent reporter, we then measured the affinity of twelve selected compounds in competitive binding experiments.Fig. 3B and C reports the displacement of 1-NPN from the complex with OBP3 by those compounds. Parallel experiments were performed with the other two proteins and the dissociation constants were calculated for each compound from the concentration value that halved the initial 1-NPN fluorescence ([IC50]). InFig. 3D the
affini-ties of the ligands for the three proteins are compared. A first series of compounds, including linear alkyl benzoates of different chain length, were chosen to evaluate the size requirements for a ligand. The ideal length of the chain appeared to be between four and six carbon atoms, with a rapid loss of activity for shorter (ethyl benzoate) as well as longer chains (n-octyl benzoate). Interestingly, 3,7-dimethyloctyl benzoate exhibited better affinity than the
n-octyl derivative. The binding was not significantly affected by removal of the benzene ring, as shown by the behaviour of 3,7-dimethyloctyl acetate. A second series of ligands included compounds of different structures, both aliphatic terpenoids and aromatic compounds, bearing some structural similarity to the aromatic fluorescent probe 1-NPN. Some of the chemicals tested exhibited good affinity to all three proteins, whereas others were more selective. In particular, three ligands showed good affinity only to OBP3: (E)-b-farnesene, the alarm pheromone for most aphid species, its corresponding alcohol farnesol and 3,7-dime-thyloctyl acetate. This latter compound, although of a different chemical nature, has close similarity to (E)-b-farnesene, when comparing the shapes of the two molecules. The good affinity of these terpenoid structures to OBP3 could also be related to the apparently intriguing observation that 3,7-dimethyloctyl benzoate binds the same protein better than octyl benzoate. Based on the structure of the PBP of the cockroach L. maderae (acc no. 1orgA), we have modelled the folding of OBP3 of A. pisum.Fig. 4reports the alignment of the two proteins and the model of A. pisum OBP3 with some of the residues lining the binding sites. It is interesting to observe that five hydrophobic amino acids (Ile43, Leu48, Leu64, Val104 and Leu108) on opposite a-helical domains could well interact with the branched chains of terpenoids, likeb-farnesene. A sixth residue, Tyr84 could establish some interaction with thep
electrons of the two double bonds at one end ofb-farnesene or a hydrogen bond with the hydroxy group of farnesol.
We can observe that although each protein exhibits a broad spectrum of binding, the system is clearly capable of discrimina-tion. Such a system is at the same time specific and yet not limited in the number of potential ligands it can detect. On the other hand, a strong affinity of OBPs towards semiochemicals is not required when we consider that these proteins are highly concentrated in the sensillar lymph. In fact, with a protein concentration of 1 mM, even a dissociation constant of 10mM is enough to keep 99% of the ligand bound to the protein.
These data indicate that the aphid OBP3 is involved in detecting and recognising the alarm pheromone (E)-b-farnesene. The view that OBPs might also be responsible for recognising the chemical stimuli in addition to membrane-bound receptors, is consistent with recent publications on the essential role of OBPs in insect chemoreception (Xu et al., 2005; Matsuo et al., 2007; Laughlin et al., 2008). In particular, the latest report shows that OBPs are able to stimulate olfactory receptors even in the absence of a ligand, if they adopt a conformation mimicking that of the complex (Laughlin et al., 2008). It is possible that several different chemicals bind the same OBP, but perhaps only one or a few are able to induce the specific conformational change in the protein for an efficient interaction with the receptor. We should also be aware that, besides OBPs, olfactory receptors (Clyne et al., 1999; Vosshall et al., 2000), as well as membrane-bound proteins, called SNMPs (Rogers et al., 1997; Vogt, 2003), whose function is still unclear, are required for a correct functioning of the olfactory system in insects (Ha and Smith, 2006; Benton et al., 2007; Jin et al., 2008).
Finally, it is also important to consider that current OBP/ ligand-binding model is based on binding measurements per-formed at concentrations of OBPs about three orders of magni-tude lower than those present in the sensilla. It is difficult to predict what the behaviour of these proteins would be in their natural environment.
In any case, the active and essential roles of OBPs demonstrated in insect olfaction indicate the possibility of using these proteins as potential targets for interfering with the olfactory perception of insects as a way to control pest populations in the field. In partic-ular, the detailed study of the three-dimensional structure of OBP3 and its interaction with (E)-b-farnesene could help in the design of
Fig. 4. Model of A. pisum OBP3. The model was generated with the programme Swissmodel (Schwede et al., 2003; Guex and Peitsch, 1997; Arnold et al., 2006), using the PBP of Leucophaea maderae (PDB: 1ORG_A;Lartigue et al., 2003) as a template. In the alignment of the two proteins, identical residues are highlighted, those lining the binding site are in red font. Three of the hydrophobic residues in the binding site (Ile43, Leu48 and Val104) have their counterparts in the structure of L. maderae PBP. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
H. Qiao et al. / Insect Biochemistry and Molecular Biology 39 (2009) 414–419 418
new compounds to mimic alarm pheromones and affect aphid behaviours in the field.
Acknowledgements
Research partly supported by a PRIN Project, MIUR, Italy. We thank Patrizia Falabella of the University of Basilicata, Potenza, Italy for a generous sample of A. pisum RNA and Janet Martin, Lesley Smart and Gudbjorg Inga Aradottir at Rothamsted Research, UK for providing the other aphid species used in this work. We also appreciate the international exchange funding from the Royal Society, UK to JJZ.
References
Arnold, K., Bordoli, L., Kopp, J., Schwede, T., 2006. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bio-informatics 22, 195–201.
Ban, L.P., Scaloni, A., D’Ambrosio, C., Zhang, L., Yan, Y.H., Pelosi, P., 2003. Biochemical characterisation and bacterial expression of an odorant-binding protein from Locusta migratoria. Cell. Mol. Life Sci. 60, 390–400.
Beale, M.H., Birkett, M.A., Bruce, T.J., Chamberlain, K., Field, L.M., Huttly, A.K., Martin, J.L., Parker, R., Phillips, A.L., Pickett, J.A., Prosser, I.M., Shewry, P.R., Smart, L.E., Wadhams, L.J., Woodcock, C.M., Zhang, Y., 2006. Aphid alarm pheromone produced by transgenic plants affects aphid and parasitoid behavior. Proc. Natl. Acad. Sci. U. S. A. 103, 10509–10513.
Benton, R., Vannice, K.S., Vosshall, L.B., 2007. An essential role for a CD36-related receptor in pheromone detection in Drosophila. Nature 450, 289–293. Birkett, M.A., Pickett, J.A., 2003. Aphid sex pheromones: from discovery to
commercial production. Phytochemistry 62, 651–656.
Bowers, W.S., Nault, L.R., Webb, R.E., Dutky, S.R., 1972. Aphid alarm pheromone: isolation, identification, synthesis. Science 177, 1121–1122.
Calvello, M., Guerra, N., Brandazza, A., D’Ambrosio, C., Scaloni, A., Dani, F.R., Turillazzi, S., Pelosi, P., 2003. Soluble proteins of chemical communication in the social wasp Polistes dominulus. Cell. Mol. Life Sci. 60, 1933–1943.
Clyne, P.J., Warr, C.G., Freeman, M.R., Lessing, D., Kim, J.H., Carlson, J.R., 1999. A novel family of divergent seven-transmembrane proteins: candidate odorant recep-tors in Drosophila. Neuron 22, 327–338.
Dawson, G.W., Pickett, J.A., Smiley, D.W., 1996. The aphid sex pheromone cyclo-pentanoids: synthesis in the elucidation of structure and biosynthetic path-ways. Bioorg. Med. Chem. 4, 351–361.
Francis, F., Vandermoten, S., Verheggen, F., Lognay, G., Haubruge, E., 2005. Is the (E)-b-farnesene only volatile terpenoid in aphids? J. Appl. Entomol. 129, 6–11.
Gibson, R.W., Pickett, J.A., 1983. Wild potato repels aphids by release of aphid alarm pheromone. Nature 302, 608–609.
Guex, N., Peitsch, M.C., 1997. SWISS-MODEL and the Swiss-PdbViewer: an envi-ronment for comparative protein modelling. Electrophoresis 18, 2714–2723. Ha, T.S., Smith, D.P., 2006. A pheromone receptor mediates 11-cis-vaccenyl
acetate-induced responses in Drosophila. J. Neurosci. 26, 8727–8733.
Jin, X., Ha, T.S., Smith, D.P., 2008. SNMP is a signaling component required for pher-omone sensitivity in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 105, 10996–11001. Kruse, S.W., Zhao, R., Smith, D.P., Jones, D.N., 2003. Structure of a specific
alcohol-binding site defined by the odorant alcohol-binding protein LUSH from Drosophila melanogaster. Nat. Struct. Biol. 10, 694–700.
Lartigue, A., Gruez, A., Spinelli, S., Riviere, S., Brossut, R., Tegoni, M., Cambillau, C., 2003. The crystal structure of a cockroach pheromone-binding protein suggests a new ligand binding and release mechanism. J. Biol. Chem. 278, 30213–30218. Laughlin, J.D., Ha, S.T., Jones, D.N.M., Smith, D.P., 2008. Activation of sensitive neurons is mediated by conformational activation of pheromone-binding protein. Cell 133, 1255–1265.
Matsuo, T., Sugaya, S., Yasukawa, J., Aigaki, T., Fuyama, Y., 2007. Odorant-binding proteins OBP57d and OBP57e affect taste perception and host-plant preference in Drosophila sechellia. PLoS Biol. 5, 985–996.
Pelosi, P., Zhou, J.J., Ban, L.P., Calvello, M., 2006. Soluble proteins in insect chemical communication. Cell. Mol. Life Sci. 63, 1658–1676.
Pesenti, M.E., Spinelli, S., Bezirard, V., Briand, L., Pernollet, J.C., Tegoni, M., Cambillau, C., 2008. Structural basis of the honey bee PBP pheromone and pH-induced conformational change. J. Mol. Biol. 380, 158–169.
Pickett, J.A., Wadhams, L.J., Woodcock, C.M., Hardie, J., 1992. The chemical ecology of aphids. Annu. Rev. Entomol. 37, 67–90.
Plettner, E., Lazar, J., Prestwich, E.G., Prestwich, G.D., 2000. Discrimination of pheromone enantiomers by two pheromone binding proteins from the gypsy moth Lymantria dispar. Biochemistry 39, 8953–8962.
Prestwich, G.D., 1993. Bacterial expression and photoaffinity labeling of a phero-mone binding protein. Protein Sci. 2, 420–428.
Rogers, M.E., Sun, M., Lerner, M.R., Vogt, R.G., 1997. Snmp-1, a novel membrane protein of olfactory neurons of the silk moth Antheraea polyphemus with homology to the CD36 family of membrane proteins. J. Biol. Chem. 272, 14792– 14799.
Schwede, T., Kopp, J., Guex, N., Peitsch, M.C., 2003. SWISS-MODEL: an automated protein homology-modeling server. Nucleic. Acids. Res. 31, 3381–3385. Vogt, R.G., 2003. Biochemical diversity of odor detection: OBPs, ODEs and SNMPs.
In: Blomquist, G.J., Vogt, R.G. (Eds.), Insect Pheromone Biochemistry and Molecular Biology. Elsevier Academic Press, London, pp. 391–446.
Vogt, R.G., Riddiford, L.M., 1981. Pheromone binding and inactivation by moth antennae. Nature 293, 161–163.
Vosshall, L.B., Wong, A.M., Axel, R., 2000. An olfactory sensory map in the fly brain. Cell 96, 725–736.
Xu, P., Atkinson, R., Jones, D.N., Smith, D.P., 2005. Drosophila OBP LUSH is required for activity of pheromone-sensitive neurons. Neuron 45, 193–200.
R E S E A R C H A R T I C L E
Cooperative interactions between odorant-binding proteins
of Anopheles gambiae
Huili Qiao•Xiaoli He•Danuta Schymura•Liping Ban• Linda Field•
Francesca Romana Dani•Elena Michelucci•Beniamino Caputo •Alessandra della Torre• Kostas Iatrou• Jing-Jiang Zhou•Ju¨rgen Krieger• Paolo Pelosi
Received: 9 July 2010 / Revised: 23 August 2010 / Accepted: 23 September 2010 Ó Springer Basel AG 2010
Abstract To understand olfactory discrimination in Anopheles gambiae, we made six purified recombinant OBPs and investigated their ligand-binding properties. All OBPs were expressed in bacteria with additional produc-tion of OBP47 in the yeast Kluveromyces lactis. Ligand-binding experiments, performed with a diverse set of organic compounds, revealed marked differences between the OBPs. Using the fluorescent probe N-phenyl-1-naph-thylamine, we also measured the binding curves for binary mixtures of OBPs and obtained, in some cases, unexpected behaviour, which could only be explained by the OBPs forming heterodimers with binding characteristics different
from those of the component proteins. This shows that OBPs in mosquitoes can form complexes with novel ligand specificities, thus amplifying the repertoire of OBPs and the number of semiochemicals that can be discriminated. Confirmation of the likely role of heterodimers was dem-onstrated by in situ hybridisation, suggesting that OBP1 and OBP4 are co-expressed in some antennal sensilla of A. gambiae.
Keywords Odorant-binding protein Anopheles gambiae Protein expression Fluorescent binding assay Protein association Semiochemicals In situ hybridisation
Abbreviations
OBP Odorant-binding protein
MALDI-TOF Matrix-assisted laser desorption ionisation-time of flight
ESI-MS Electrospray ionisation mass spectrometry
FITC Phenyl-isothiocyanate
1-NPN N-phenyl-1-naphthylamine
Dedicated to the memory of the late Harald Biessmann, our colleague and dear friend, who completed the cloning and initial
characterization of the majority of Anopheles gambiae odorant-binding proteins.
H. Qiao and X. He contributed equally to the work.
Electronic supplementary material The online version of this article (doi:10.1007/s00018-010-0539-8) contains supplementary material, which is available to authorized users.
H. Qiao P. Pelosi (&)
Department of Biology and Agricultural Plants, University of Pisa, Via S. Michele, 4, 56124 Pisa, Italy e-mail: ppelosi@agr.unipi.it
X. He L. Ban L. Field J.-J. Zhou (&) Department of Biological Chemistry, Rothamsted Research, Harpenden, UK e-mail: jing-jiang.zhou@bbsrc.ac.uk D. Schymura J. Krieger
Institute of Physiology, University of Hohenheim, Stuttgart, Germany
F. R. Dani E. Michelucci
Centro Interdipartimentale di Spettrometria di Massa, University of Firenze, Florence, Italy
B. Caputo A. d. Torre
Dipartimento di Scienze di Sanita` Pubblica, Istituto Pasteur-Fondazione Cenci-Bolognetti,
Sezione di Parassitologia, University ‘Sapienza’, Rome, Italy K. Iatrou
Insect Molecular Genetics and Biotechnology Group, Institute of Biology, National Centre for Scientific Research ‘Demokritos’, Athens, Greece
Cell. Mol. Life Sci.
Introduction
Mosquitoes are vectors of many diseases, such as malaria, dengue and yellow fever, thus posing a major threat to human health worldwide, particularly in developing countries. At present, vector control is dependent on treatment with insecticides either on bed nets or as indoor residual sprays, although alternative approaches, based on the use of semiochemicals, are being investigated [1]. As for all other insects, mosquito host location uses olfactory cues, particularly carbon dioxide, a major attractant, toge-ther with lactic acid and otoge-ther volatiles produced by the host that can potentiate their behaviour. Interestingly, human sweat contains chemicals that have been reported to act as repellents of mosquitoes [2,3].
Synthetic mosquito repellents are widely used, but their mode of action remains unclear. DEET and Icaridin are the most commonly used in commercial products, which contain high levels (10–20%) of the active ingredient. Recently, it has been proposed that they also have insec-ticidal action, as acetylcholine esterase inhibitors [4]. This raises some concern as to the safety of these products for humans and other animals.
A number of other volatile compounds have been reported as mosquito repellents, such as nepetalactone, cinnanic aldehyde, citronellal and isolongifolenone [5–8], but all of these are effective only at very high concentra-tions. The structural diversity of the compounds and the lack of data on their mode of action mean that there is no rationale to allow the design of chemicals with improved repellency effect. Thus, the focus of this research, to devise alternative strategies for mosquito control, is on the bio-chemistry of olfaction. In particular, the proteins responsible for detecting and recognising host odours and pheromones are being investigated in order to elucidate the olfactory code of these insects. The genome of the main malaria vector Anopheles gambiae has 79 and 76 genes encoding putative olfactory receptors and gustatory receptors, respectively, as well as 60 genes for putative odorant-binding proteins (OBPs) [9]. Very recently, the screening of ligand specificity for 50 olfactory receptors has been published, a major work, representing a solid and important basis of information for future research [10,11]. We have focused our attention on the other protein partners involved in odour recognition, i.e., the OBPs [12–
14]. In the last few years the proposed role of OBPs has been raised from that of simple odorant carriers to that of being responsible, together with the membrane-bound olfactory receptors, for recognition and discrimination of odorant stimuli. In the silkmoth Bombyx mori, the activa-tion of the pheromone receptor requires the presence of the corresponding pheromone-binding proteins [15]. Silencing of the gene encoding LUSH, one of the OBPs of
Drosophila melanogaster, suppresses both electrophysio-logical and behavioural responses to vaccenyl acetate, the male pheromone for this species [16]. Moreover, it has been demonstrated that vaccenyl acetate, upon binding to LUSH, induces a conformational change in the structure of this protein, which allows stimulation of the corresponding olfactory receptor. This was elegantly demonstrated by a modified LUSH protein that mimics the structure of the LUSH/vaccenyl acetate complex and is able to activate the olfactory receptor even in the absence of the phero-mone [17].
Another elegant study has demonstrated the role of two OBPs (OBP57d and OBP57e) in the detection of two fatty acids that act as oviposition attractants in Drosophila sechellia. The same fatty acids act as repellents for D. mela-nogaster (and other Drosophila species), and experiments where the two genes encoding the OBPs were exchanged between two species of Drosophila produced, to some extent, a switch in behaviour, making the two fatty acids repellents of D. sechellia and attractants for D. simulans [18].
More recently and specifically in mosquitoes, it has been shown that silencing of the gene encoding OBP1 in A. gambiae [19] and in Culex quinquefasciatus [20] suppresses electrophysiological responses to indole, showing that in both species OBP1 is essential for the perception of indole. Overall, results to date confirm the important role of OBPs in odour perception and discrimination, and this, together with the great impact of disease vectors on human health, prompted us to study the specificity of binding between OBPs and olfactory ligands in A. gambiae. Given the enormous amount of work that would be involved in analysing all 60 putative OBPs, we selected for study those that have been found to be the most abundantly expressed in olfactory organs [1,9,21–24]. Molecular biology tech-niques have shown that only a small set of OBP-encoding genes are expressed in sensory organs at relatively high levels. In particular, those most abundantly expressed in female antennae are the classic OBPs 1, 3, 4, 5, 7, 9 and 17 and two of the C-plus OBPs, 47 and 48. In some cases the expression of the OBP genes is upregulated or downregu-lated after a blood meal, indicating that the corresponding proteins might be involved in host recognition [23]. The same authors have reported that each OBP is differentially expressed according to tissue and sex, while a substantial number of them (mainly belonging to the so-called ‘‘atypical OBPs’’) are not expressed in any part of the body of either sex [9].
Another important aspect of studying the contribution of OBPs in odour perception is the possibility that different OBPs might form heterodimers. Indeed, interactions between OBP48 and some classic OBPs, as well as between OBP1 and OBP4, have been reported using co-immuno-precipitation methods and cross-linking studies [22].
In the current study we have investigated the binding properties of selected OBPs of A. gambiae, expressed in heterologous systems, towards a number of potential semiochemicals using ligand-binding assays. We also provide data suggesting that OBP4 interacts with OBP1 and with OBP3, generating heterodimers with novel char-acteristics. Finally, our in situ hybridisation experiments indicate that OBP1 and OBP4 are co-expressed in some antennal sensilla of A. gambiae.
Materials and methods Insects
The A. gambiae used for most assays belonged to the GACAM-ST colony maintained in the Department of Public Health Sciences at the University of Rome, Sapienza (Italy). This colony originated from A. gambiae M-molec-ular form [sensu della Torre [25] females collected in Cameroon in 2004 and selected for a standard polytene complement (Xag, 2R?, 2L?, 3R?, 3L?)] [26]. All insects analysed were 2–4 days old. Specimens were killed by freezing at -20°C and kept at this temperature prior to analyses. Whole-mount in situ hybridisation experiments were carried out on A. gambiae molecular form S (strain Kisumu) kindly provided by Bayer CropScience (Monheim, Germany). Larvae were reared at 28 ± 1°C and 80 ± 10 RH and fed with cat pellets, and adults were maintained at 26 ± 1°C and 70 ± 10 RH and fed on 10% sucrose; both were kept in a day:night cycle of 12:12 h.
Reagents
All enzymes were from New England Biolabs. Oligonucleo-tides were custom synthesised at Eurofins MWG GmbH, Ebersberg, Germany. All other chemicals were either pur-chased from Sigma-Aldrich and were of reagent grade, or were synthesised in house using conventional synthesis routes. Cloning and sequencing
Plasmids containing the appropriate OBP cDNAs were subjected to PCR, using primers encoding the first and the last six amino acids of each sequence, flanked by NdeI and EcoRI restriction sites in the forward and reverse primer, respectively. The crude PCR products were ligated into a pGEM (Promega) vector, using a 1:5 (plasmid:insert) molar ratio and incubating the mixture overnight at room temperature. After transformation of E. coli XL-1 Blue competent cells with the ligation products, positive colo-nies were selected by PCR using the plasmid’s primers SP6 and T7 and grown in LB/ampicillin medium. DNA
was extracted using the GFX Micro Plasmid Prep (GE-Healthcare) kit and custom sequenced at Eurofins MWG (Martinsried, Germany).
Cloning in expression vectors
pGEM plasmids containing the appropriate sequences were digested with NdeI and EcoRI restriction enzymes for 2 h at 37°C, and the digestion products were separated on agarose gels. The fragments were purified from the gel and ligated into the expression vector pET5b (Novagen, Darmstadt, Germany), previously linearized with the same enzymes. The inserts in the resulting plasmids were sequenced to confirm that they encoded the correct mature proteins. Bacterial expression of the proteins
For expression of recombinant proteins, each pET-5b vector containing the appropriate OBP sequence was used to transform E. coli BL21(DE3)pLysS cells. Protein expression was induced by addition of IPTG to a final concentration of 0.4 mM when the culture had reached a value of O.D600= 0.8. Cells were grown for a further 2 h at 37°C, then harvested by centrifugation and sonicated. After further centrifugation, OBPs, present in the pellets (from 1 of culture) as inclusion bodies were solubilised by dissolving the pellet in 10 ml of 8 M urea, 1 mM DTT in 50 mM Tris buffer, pH 7.4, then diluting to 100 ml with Tris buffer and dialysing three times against Tris buffer. The OBPs were then purified using combinations of chromatographic steps anion-exchange resins, such as DE-52 (Whatman), QFF or Mono-Q (GE Healthcare), followed by gel filtration on Sephacryl-100 or Superose-12 (GE Healthcare) along with standard protocols previously adopted for other OBPs [27,28].
Cloning and expression in K. lactis
Introduction of the linearized OBP47 expression cassette into K. lactis cells was achieved by chemical transforma-tion using the K. lactis GG799 competent cells and NEB yeast transformation reagent. Transformants were selected by growth on YCB agar medium containing acetamide and the colonies analysed by PCR. Positive colonies were resuspended in 2 ml YPGal medium and shaken at 200–250 rpm and 30°C. Analysis of culture supernatant was performed after 2, 3 and 4 days of incubation to determine the best time to optimise protein yield.
Digestion with PNGase
Samples of OBP47 expressed in yeast (10 lg) in 100 ll 50 mM Tris-Cl pH 7.4 buffer were treated with 2 ll
(10 units) of PNGaseF at 37°C for 2 h. The digestion product was analysed by SDS-PAGE followed by Western blot analysis and MALDI mass spectrometry.
Preparation of antisera
Antisera were obtained in adult rabbits after repeated injections of the recombinant proteins emulsified in Fre-und’s adjuvant and used without further purification. The immunisations were performed according to the protocol approved by the University of Pisa ethics committee. Western blot analysis
After electrophoretic separation of proteins under dena-turing conditions (14% SDS-PAGE), duplicate gels were stained with 0.1% Coomassie blue G250 in 10% acetic acid, 25% ethanol or electroblotted onto Trans-Blot nitro-cellulose membrane (Bio-Rad Lab) by the procedure of [29]. After treatment with 2% powdered skimmed milk/ 0.05% Tween 20 in PBS overnight, the membrane was incubated with the crude antiserum against the relevant OBP at a dilution of 1:500 (2 h) and then with goat anti-(rabbit IgG) horseradish peroxidase conjugate (dilution 1:1,000; 1 h). Immunoreacting bands were detected by treatment with 4-chloro-1-naphthol and hydrogen peroxide. MALDI mass spectrometry
Protein samples were analysed on a MALDI-TOF/TOF mass spectrometer Ultraflex III (Bruker Daltonics, Bremen, Germany) using Flex ControlTM3.0 as the data acquisition software. A 1 ll volume of the sample was mixed with 1 ll of the matrix (sinapinic acid 10 mg/ml in CH3CN:H2O, 0.1% TFA, 70:30) on the target and allowed to dry. Spectra were acquired in linear mode over the m/z range 5,000–20,000. The instrument parameters were chosen by setting ion source 1 at 25 kV, ion source 2 at 23.45 kV, lens at 6.0 kV and pulsed ion extraction at 80 ns. The instru-ment was externally calibrated prior to analysis using the Bruker Protein I calibrant standard kit (5,000–17,000 Da) [30].
High resolution mass spectrometric analysis
A 5 lL solution of OBP47 expressed in E.coli was pre-pared after a 20-fold dilution with HCOOH 0.1%. ESI-MS spectra were recorded by direct introduction at 5 ll/min flow rate in an LTQ-Orbitrap high-resolution mass spec-trometer (Thermo, San Jose, CA), equipped with a conventional ESI source. The spray voltage was 3.1 kV, the capillary voltage was 45 V, the capillary temperature was kept at 220°C, and the tube lens voltage was 230 V.
The sheath and the auxiliary gases were set, respectively, at 17 (arbitrary units) and 1 (arbitrary units). For data acquisition, Xcalibur 2.0. software (Thermo) was used, and monoisotopic and average deconvoluted masses were obtained using the integrated Xtract tool. For spectra acquisition a nominal resolution (at m/z 400) of 100,000 was used.
The experimental isotope patterns in charge state 12? were compared with the theoretical patterns of the protein molecular formula as predicted with 6 or 5 disulfide bridges.
Fluorescence measurements
Emission fluorescence spectra were recorded on a Jasco FP-750 instrument at 25°C in a right angle configuration, with a 1-cm light path quartz cuvette and 5-nm slits for both excitation and emission. The protein was dissolved in 50 mM Tris-HCl buffer, pH 7.4, and ligands were added as 1 mM methanol solutions.
Fluorescence binding assays
To measure the affinity of the fluorescent ligand 1-NPN to each OBP, a 2 lM solution of the protein in 50 mM Tris-HCl, pH 7.4, was titrated with aliquots of 1 mM ligand in methanol to final concentrations of 2–16 lM. The probe was excited at 337 nm, and emission spectra were recorded between 380 and 450 nm. The affinity of other ligands was measured in competitive binding assays, using 1-NPN as the fluorescent reporter at 2 lM concentration and 2–16 lM concentrations for each competitor.
For determining binding constants, the intensity values, corresponding to the maximum of fluorescence emission were plotted against free ligand concentrations. Bound ligand was evaluated from the values of fluorescence intensity assuming that the protein was 100% active, with a stoichiometry of 1:1 protein:ligand at saturation. The curves were linearised using Scatchard plots. Dissociation constants of the competitors were calculated from the corresponding IC50 values, using the equation: KD= [IC50]/1 ? [1-NPN]/K1-NPN, where [1-NPN] is the free concentration of 1-NPN and K1-NPN is the dissociation constant of the complex protein/1-NPN.
Double whole-mount in situ hybridisation (double WM-FISH)
Antennae were dissected from 1- to 3-day old cold anaesthetised mosquitoes and fixed for 20–24 h at 6°C in 4% paraformaldehyde in 0.1 M Na2CO3, pH 9.5, 0.03% Triton X-100. After a wash at room temperature for 1 min in PBS (phosphate-buffered saline = 0.85% NaCl,
1.4 mM KH2PO4, 8 mM Na2HPO4, pH 7.1) with 0.03% Triton X-100, the antennae were incubated for 10 min in 0.2 M HCl, 0.03% Triton X-100. Subsequently, antennae were washed for 2 min in PBS with 1% Triton X-100 and transferred to whole mount in situ hybridisation solution (50% formamide, 59 SSC, 19 Denhardts reagent, 50 lg/ml yeast RNA, 1% Tween 20, 0.1% Chaps, 5 mM EDTA pH 8.0). If not prehybridised directly, antennae were stored at 6°C in the solution. Prehybridisation was performed at 55°C for 6 h, followed by incubation for at least 48 h at the same temperature in hybridisation solution containing the labelled OBP anti-sense RNA probes. Labelled riboprobes of OBP1 [digoxigenin (DIG)-labelled] and OBP4 (biotin-labelled) were transcribed from linearised plasmids containing the coding regions of the OBPs using a T3/T7 RNA tran-scription system (Roche) and recommended protocols. Posthybridisation, antenna were washed four times for 15 min each in 0.19 SSC, 0.03% Triton X-100 at 60°C and then treated with 1% blocking reagent (Roche) in TBS (100 mM Tris, pH 7.5, 150 mM NaCl), 0.03% Triton X-100 for 5 h at 6°C. The DIG-labelled probe was detected by incubation for at least 48 h with an anti-DIG alkaline phospatase-conjugated antibody (Roche) diluted 1:500 in TBS, 0.03% Triton X-100 with 1% blocking reagent; for detection of the biotin-labelled probe a strepavidin horseradish peroxidase-conjugate (1:100, TSA kit, Perkin Elmer) was included in the same solution. After washing five times for 10 min each in TBS with 0.05% Tween at room temperature, the DIG-labelled probe was visualised by incubation with HNPP [Roche; 1:100 in DAP-buffer (100 mM Tris, pH 8.0, 100 mM NaCl, 50 mM MgCl2] for 5 h in the dark at 6°C. After three 5-min washes in TBS with 0.05% Tween, the TSA kit/FITC development was conducted for 17–18 h at 6°C in the dark to visualise the biotin-labelled probe. Fol-lowing a short wash in PBS the antennae were mounted in moviol (10% polyvinylalcohol 4-88, 20 glycerol in PBS). All incubations and washes were made in a volume of 0.25 ml (in Quali-PCR tubes, Kisker, Germany) with slow rotation or moderate shaking. The binding of the probes was analysed for epifluorescence using a Zeiss LSM510 Meta laser scanning microscope (Zeiss, Oberkochen, Germany).
Molecular modelling
Three-dimensional models of A. gambiae OBP3 and OBP4 were generated using the on-line programme SWISS MODEL [31–33]. Models were displayed using the SwissPdb Viewer programme ‘‘Deep-View’’ [32] (http:// www.expasy.org/spdbv/).
Results and discussion Choice of the proteins
We selected six A. gambiae OBPs for our study, numbered in the Swiss-Prot data base as 1, 3, 4, 12, 19 and 47. They are all classic OBPs (with the conserved pattern of six cysteines), except for OBP47, which is much longer (173 amino acids instead of 119–132 for the others) and contains 13 cysteines. The genes encoding these OBPs have all been shown to be expressed at relatively high levels by Northern blot and microarray experiments [1,9,21] with all, except for OBP12 and OBP19, being in the top 10 OBPs most expressed in female antennae. OBP12 was included because its expression is almost three times higher in female antennae than in males, and OBP19, together with OBP47, is one of the few OBPs selectively expressed in the head.
Some of the OBPs chosen have interesting structural relationships with their counterparts in other mosquito species and in Drosophila. In particular, OBP1 and OBP3 are the orthologues of D. melanogaster OS-E and OS-F, respectively, and OBP4 is structurally similar to Dro-sophila LUSH. It is particularly interesting that these three proteins of Drosophila have been observed to be expressed in the same chemosensilla [34,35].
Expression, purification and partial structural characterisation
All six A. gambiae OBPs were expressed in E. coli and gave good yields of the recombinant proteins (20 mg/l). To minimise the effect of His-tags (or other sequences to allow affinity purification) on ligand-binding assays, we made constructs coding only for a starting methionine in addition to the mature protein sequence. As observed with most insect OBPs, our recombinant proteins were present in the bacterial cells as insoluble inclusion bodies and had to be solubilised by denaturation and reduction. Although the conditions used in this process are particularly harsh, the unfolded OBPs can be renatured correctly as demonstrated in several cases by binding experiments, pairing of disul-phide bridges and crystal structure [27, 36, 37]. OBP47, despite its length and the presence of 13 cysteine residues, was refolded into its active conformation as judged from its binding properties toward several ligands similar to those of other insect OBPs.
Purification of each OBP was accomplished using conventional techniques, combining anion-exchange chromatography with gel filtration. Figure1 shows the electrophoretic analysis of both the crude expression products and samples of purified proteins for each of the
six OBPs. The correct folding of OBP1, OBP3 and OBP4 was also supported by the observation that these proteins, after denaturation and renaturation, migrate as single bands on a native PAGE (Figure S1).
We also expressed OBP47 in the yeast K. lactis, obtaining yields of around 20 mg of protein per litre. In this case, the protein was secreted in the medium in its soluble form and could be purified easily, representing by far the major protein component of the culture medium. The OBP47 prepared in yeast migrated with a higher molecular weight on SDS-PAGE than did the protein expressed in the bacterial system, suggesting that glycosylation could have been introduced. To verify this, a sample of the yeast-pro-duced protein was digested with PNGase and the product analysed by SDS-PAGE followed by Western blot (Fig.2), as well as by MALDI mass spectrometry (Fig.3). The Western blot analysis, using a crude polyclonal antiserum against the bacterially expressed OBP47, showed the pres-ence of a band in the digested sample, migrating with the
same apparent mass as the bacterial OBP47 and indicating that the protein produced in yeast is glycosylated (Fig.2). Likewise, the MALDI spectrum showed a main broad peak around mass 21,517.6, indicating a heterogeneous popula-tion of glycosylated OBP47 and a minor peak at mass 18,922.5, in agreement with the calculated molecular weight of the de-glycosylated protein, assuming the
Fig. 1 Expression and purification of six OBPs of Anopheles gambiae. Upper two panels: electrophoretic analysis (SDS-PAGE) of crude bacterial pellets, each expressing one of the OBPs, before (Pre) and after (In) induction of the bacterial culture with IPTG. Lower panel: samples of purified OBPs. M: molecular weight markers of 66, 45, 29, 20 and 14 kDa
Fig. 2 Analysis and tissue expression of OBP47. Upper panel: OBP47 produced in the yeast K. lactis (1) migrating with an apparent molecular weight of about 22 kDa, whilst bacterial-expressed OBP47 (3) shows a mass of about 19 kDa, in agreement with the calculated value of 18,918 Da. Treatment of the yeast-expressed OBP47 with PNGase F (2) generates a band migrating with an apparent mass identical with that of the bacterial sample. Middle panel: Expression of OBP47 in head (H), thorax (Th) and abdomen (Ab) of An. gambiae (mixed sexes). Western blot analysis reveals the exclusive presence of OBP47 in the head. Lower panel: OBP47 is mostly expressed in heads without antennae of male (mH) and female (fH) mosquitoes, and is only barely detectable in the antennae of both sexes (mA and fA). M: molecular weight markers of 66, 45, 29, 20 and 14 kDa
presence of six disulphide bridges (18,918). The same antiserum was also used to probe the expression of OBP47 in different parts of the adult mosquito, and the results clearly indicate that expression is restricted to the head of both sexes (Fig.2). We can also observe that the OBP is present in mosquitoes in its glycosylated form, migrating with an apparent molecular weight of about 22 kDa. A second experiment showed that the expression of OBP47 is only a barely detectable in the antennae, with most of the reactivity being associated with heads without antennae (Fig.2). This finding might suggest that OBP47 could be most abundantly present in mouth structures, such as palpi and proboscis, with a putative function in taste.
As a first contribution to a structural characterisation of OBP47, we investigated the number of free cysteines in the
refolded protein. Derivatization of the bacteria-produced OBP with iodoacetamide gave a single molecular species with the MALDI mass spectrum giving a mass of 18,980.6 units (Fig. 3). The difference with respect to the non-derivitized protein (measured mass 18,922.5) is 58 units, accounting for a single cysteine residue being derivatised and indicating that only 1 of the 13 cysteines present in OBP47 is in its reduced form. To confirm this, and rule out the possibility of additional free cysteines buried in the core of the protein and hence not affected by the reagent, we also performed an exact measurement of the mass of the protein. In Fig.3 the portion of the elec-trospray mass spectrum relative to the 12 charge ion is compared with the theoretical spectra calculated for the formulae C825H1309N215O249S22and C825H1311N215O249S22
Fig. 3 a MALDI spectrum of OBP47 expressed in K. lactis and deglycosylated with PNGase; both the glycosylated and the degly-cosylated forms are present, the glydegly-cosylated being predominant. b MALDI spectrum of OBP47 expressed in E. coli. c MALDI spectrum of OBP47 expressed in E. coli after cysteine carboami-domethylation. The mass difference corresponds to a single carboamidomethyl group introduced in the derivatised sample. Calculated masses for OBP47 expressed in E. coli (assuming the
presence of six disulfide bridges) before and after carboamidomethy-lation are 18, 918 and 18,975, respectively. d, e Comparison of d the experimental spectrum of the 12?charge state of OBP47 expressed in E. coli and e the theoretical 12? charge state spectrum obtained by considering the protein to have six (in red) or 5 (in green) disulfide bridges in a ratio 7:3 (sum of the two spectra in black). Data were recorded on LTQ Orbitrap high resolution mass spectrometer Interactions between odorant-binding proteins
relative to the protein with, respectively, one and three free cysteines in a ratio of 7:3. This indicates that the most probable configuration of OBP47 is the one with a single free cysteine, as also suggested by the experiments per-formed with the derivatized protein.
Ligand-binding experiments
The six recombinant OBPs were then tested for their ligand-binding characteristics, using a number of small organic compounds in fluorescent displacement assays. First, affinity constants were measured for each protein to the fluorescent probe 1-NPN (N-phenyl-1-naphthylamine). All of the OBPs tested bind reversibly with 1-NPN with dissociation constants in the micromolar range. Figure4
shows the binding curves, and their relative linearisation, using Scatchard plots. In most cases the points fit a straight line, but for OBP47 and OBP19 the plot is curved upwards, allowing the evaluation of two binding constants. This phenomenon cannot be attributed to the presence of two binding sites on the same protein unit, as structural studies have clearly shown a compact structure for insect OBPs enclosing a single binding pocket. However, most of these OBPs will be present as dimers in the conditions used for the binding experiments [14], and it has been shown that when OBPs crystallize as dimers, the two monomeric structures, and therefore their binding pockets, cannot be considered equivalent [38]. Whether the phenomenon of
two binding constants is observed in ligand-binding experiments will be dependent on (1) the degree of asymmetry of the dimer and (2) the dissociation constant for the equilibrium monomer/dimer. In this respect it is worth recalling that the concentration of OBPs in the insect’s sensillum lymph is extremely high (in the milli-molar range), making any equilibrium strongly shifted towards the formation of dimers.
In a second series of experiments we measured the affinity of each OBP for a number of potential ligands in competitive binding assays, using 1-NPN as the fluorescent reporter.
We used both volatiles present in the environment, including some reported, or supposed, to be active on mosquitoes, as well as homologous series of synthetic ligands, such as benzoates, in order to define the structural requirements of an ideal ligand for each protein. The natural compounds we tested included (E)-2-hexenal, cit-ronellal, geranyl acetate and indole, which have all been reported to specifically activate olfactory receptors of A. gambiae [10]. In particular, indole has been reported as a ligand for OBP1, on the basis that silencing the gene encoding OBP1 suppresses electrophysiological response to indole, but not to other odorants [19]. Other compounds, such as 1-octen-3-ol, decanal, 6-methyl-5-hepten-2-one, menthol, linalool and p-cresol, were found to be constitu-ents of human sweat and to produce electrophysiological and behavioural responses in mosquitoes [2, 3]. DEET,
Fig. 4 Binding curves of 1-NPN and relative Scatchard plot analyses. A 2 lM solution of the protein in Tris-buffer was titrated with 1 mM solution of 1-NPN in methanol to final concentrations of 2–16 lM. Dissociation constants (average of three replicates) were OBP1: 4.7 lM (SD 2.5); OBP3, 2.3 lM (SD 1.6); OBP4, 1.6 lM (SD 1.2); OBP12, 8.9 lM (SD 0.3); OBP19, 2.1 lM (SD 0.6); OBP47, 2.7 lM (SD 0.2) H. Qiao et al.
Table 1 Binding of pure organic compounds to selected recombinant OBPs of A. gambiae
Ligand OBP1 OBP3 OBP4 OBP12 OBP19 OBP47
IC50 Int Ki IC50 Int Ki IC50 Int Ki IC50 Int Ki IC50 Int Ki IC50 Int Ki
Alcohols (Z)-3-Hexenol 82 67 72 1-Octanol 91 66 91 91 1-Octen-3-ol 82 71 71 71 1-Nonanol 88 62 65 1-Decanol 73 63 58 Linalool 78 66 73 73 Menthol 21 57 20.2 17 51 13.9 6 31 4.6 6 31 5.0 1-Dodecanol 77 64 14 46 10.7 14 46 11.8 3,7-Dimethyloctanol 61 a-Pentylcinnamyl alcohol 77 70 Farnesol 12 52 9.2 112 2.2 26 1.8 Retinol 4 26 3.1 55 5.2 30 4.2
Aldehydes and ketones
Hexanal 83 61 97 85 (E)-2-Hexenal 84 64 73 Octanal 102 66 8 42 6.1 73 73 (E)-2-Octenal 68 12 43 9.8 68 Nonanal 17 51 16.3 16 50 13.1 10 44 7.6 130 54 71 (E)-2-Nonenal 13 46 12.5 12 41 9.8 20 55 15.3 72 Decanal 80 86 17 51 13.0 17 51 14.3 (-)-citronellal 5.5 40 5.3 14 45 11.5 18 53 13.7 16 51 12.9 18 53 15.1 Benzaldehyde 96 60 65 93 69 a-Pentyl cinnamaldehyde 3.5 16 2.7 7.4 27 7.3 6-Methyl-5-hepten-2-one 88 63 78 87 Jasmone 80 64 78 Geranylacetone 67 72 93 Retinal 73 110 72 Carboxylic acids Pentanoic acid 71 Heptanoic acid 80 Octanoic acid 60 7-Octenoic acid 92 68 77 77 Nonanoic acid 80 Undecanoic acid 67 Benzoates Ethyl benzoate 59 121 17 52 13.7 Butyl benzoate 62 82 1.3 17 1.0 Hexyl benzoate 3.5 19 2.7 61 6.5 31 5.2 Octyl benzoate 20 54 15.3 92 16 50 12.9 3,7-Dimethyloctyl benzoate 3 30 2.3 20 53 19.8 1.7 29 1.4 3-Hexyl benzoate 11.7 39 11.6 20 52 16.1 4-Methylpentyl benzoate 1.8 12 1.4 12 43 11.9 6 25 4.8 p-Isopropylphenyl benzoate 10 39 7.6 15.5 49 15.3 5.8 36 4.7 Butyl p-tert-butylbenzoate 15 48 14.9 1.4 19 1.1 Phenyl benzoate 104 16 51 12.9 p-Tolyl benzoate 82 55
Icaridin and thymol were also tested as representatives of mosquito repellents. Table1 shows the IC50 values (the concentration of the ligand halving the initial fluorescence value) and the calculated inhibition constant (Ki) where possible for the OBP/ligand combinations. For weaker ligands, where IC50 values could not be measured, we report fluorescence intensity measured at the highest con-centration of ligand (16 lM) as percent of the initial value. Figure5 shows the displacement curves obtained with a selected set of ligands for each OBP.
As expected, on the basis of similar studies performed with other OBPs, a broad specificity can be observed for the OBPs of A. gambiae, with each protein preferentially binding to several related compounds. OBP1, OBP3 and OBP4 and, to some extent, OBP47 show some similarities in their binding spectra, being focussed on terpenoids of medium size and some structurally related molecules. Figure5 shows the affinities of these four OBPs to the same set of ligands. Thus, the best ligand for OBP1 is citronellal, OBP3 binds 2-octenal and 2-nonenal, and
several compounds bind rather strongly to OBP4, with menthol being the best among the natural volatiles. Men-thol is also the best natural ligand of OBP47, despite the marked structural differences between these two OBPs. We can also observe that the structures of citronellal and menthol have the same number of carbon atoms, arranged in the same terpene topology, the main difference being an additional bond, which closes the open chain of citronellal into the ring of menthol. 2-Octenal, on the other hand, differs from citronellal by two side methyl groups, apart from the position of the double bond.
Figure6 shows an alignment of the amino acids of OBPs 1, 3 and 4, together with the three-dimensional structure of OBP1 [39] and a model of OBP4. The sequences of OBP1 and OBP3 are very similar to each other, as are their Drosophila orthologues OS-E and OS-F, these in turn differ markedly from the mosquito OBP4 and its Drosophila orthologue LUSH. The binding cavity of OBP1 is lined with several branched amino acid residues, most of them conserved in OBP3 (also predicted to fold in
Table 1continued
Ligand OBP1 OBP3 OBP4 OBP12 OBP19 OBP47
IC50 Int Ki IC50 Int Ki IC50 Int Ki IC50 Int Ki IC50 Int Ki IC50 Int Ki
2-Phenylethyl benzoate 9.5 42 7.7 Benzyl benzoate 87 p-tert-Butylphenyl benzoate 6 29 4.6 10 41 9.9 5 30 4.0 Butyl p-nitrobenzoate 56 11 46 8.9 Isobutyl p-nitrobenzoate 84 64 Aromatic compounds m-Cresol 62 p-Cresol 71 71 71 p-tert-Butylbenzophenone 4 17 3.1 6 21 5.9 7.5 21 6.0 3.2 17 2.7 Phenylbenzylhydrazine 4.7 28 4.7 Indole 87 70 20 58 15.3 86 60 20 58 16.8 Methyl cinnamate 67 Butyl cinnamate 60 57 o-Hydroxybenzaldehyde 58 p-tert-butyl benzaldehyde 88 57 N-p-isopropylphenyl-p-hydroxybenzimine 8 34 6.1 4-Hydroxy-4’-isopropylazobenzene 2.5 6 1.9 1.1 1 1.1 5.2 28 4.2 1.4 5 1.2 2-Pyrrolyl-p-methyl-azobenzene 2 2.5 2.0 3.5 15 2.8 5 16 4.2 N,N-diethyl-m-toluamide (DEET) 85 69 85 85 Others (E)-b-Farnesene 73 3,7-Dimethyloctyl acetate 108 12 45 9.7 Icaridin 65
Solutions of protein and fluorescent probe 1-NPN, both at the concentration of 2 lM, were titrated with 1 mM solution of each ligand in methanol to final concentrations of 2–16 lM. For each protein, we report the fluorescence intensity (Int) measured at the maximal ligand concentration (16 lM) as percent of the initial fluorescence, the concentration of ligand halving the initial fluorescence intensity (IC50), where
applicable, and the relative dissociation constant (Ki) calculated as described in ‘‘Materials and methods’’
Fig. 5 Binding of selected ligands to recombinant OBPs of A. gam-biae. A mixture of the protein and 1-NPN in Tris-buffer, both at a concentration of 2 lM, was titrated with 1 mM solutions of each competing ligand to final concentrations of 2–16 lM. Fluorescence
intensities are reported as percent of the values in the absence of competitor. The calculated dissociation constants and the binding data relative to all the ligands tested are reported in Table1
a similar way) and which can interact with the terpene skeleton of ligands, such as citronellal and menthol. The two tyrosine residues, conserved in OBP1 and OBP3 and present near the amino and carboxy termini, and at the entrance of the binding cavity, might establish hydrogen bonds with the terpenoids and related compounds. Two other OBPs 12 and 19 seem to be tuned to larger mole-cules. In particular, OBP12 seems to prefer aromatic compounds and OBP19 binds terpenoids of larger size with farnesol being its best natural ligand.
When analysing the results of our binding experiments, we were surprised that none of the OBPs showed signifi-cant affinity to indole. Only with OBP4 and OBP47 were
we able to calculate dissociation constants of around 16 lM, whilst with the other proteins indole could not displace the fluorescent probe more than 30% even at the highest concentration used. This is not consistent with the previously reported observation that silencing the gene for OBP1 suppresses response to indole in A. gambiae [19]. One possible explanation was that the OBPs can associate in heterodimers, with binding properties different from those of their components. Some such association between OBPs has been observed in A. gambiae. In particular, co-immunoprecipitation has indicated that there are interac-tions between OBP1 and OBP4 [22], although there is no evidence that the two proteins are expressed in the same
Fig. 6 Three-dimensional structure of OBP1 [39] and a model structure of OBP4. The model of OBP3 is very similar to the structure of OBP1, while the folding of OBP4 appears significantly different, particularly with reference to the residues lining the binding sites. The alignment of the three proteins shows high similarity between OBP1 and OBP3. Asterisks indicate amino acids present in the binding pockets. The sequence and folding differences between OBP1 and OBP4 provide structural support to the different spectra of binding observed with the two proteins
Fig. 7 Binding curves of 1-NPN and relative and Scatchard plot analyses measured with binary mixtures of OBPs 1, 3 and 4. A solution of two proteins in Tris-buffer, both at the concentration of 2 lM, was titrated with 1 mM solution of 1-NPN in methanol to final concentrations of 2–16 lM. The mixture of OBP1 and OBP3 shows a regular behaviour with a binding curve in agreement with that
predicted and a linear Scatchard plot. Mixtures containing OBP4 have binding curves with a maximum around 4 lM of free probe and Scatchard plots that cannot be analysed. Such behaviour indicates cooperative interactions between OBP1 and OBP4 and between OBP3 and OBP4, as predicted in previous reports [22]
