ET
B
Receptor in Renal Medulla Is Enhanced by Local
Sodium During Low Salt Intake
Simone Vanni, Gianluca Polidori, Ilaria Cecioni, Sergio Serni, Marco Carini, Pietro Amedeo Modesti
Abstract—Renal endothelin-1 participates in sodium and water handling, and its urinary excretion is increased insodium-retentive states. We compared the cortical and medullary renal expression of prepro-1, endothelin-converting enzyme-1, and endothelin type A and type B receptors in patients who underwent nephrectomy after normal (108 mmol/d NaCl; n⫽6) or low (20 mmol/d NaCl; n⫽6) sodium diet and investigated whether sodium exerts a direct role on endothelin receptor binding in vitro. With normal sodium diet prepro-endothelin-1 mRNA was 3-fold higher in renal medulla than in cortex (P⬍0.01), whereas endothelin-converting enzyme-1 mRNA was equally distributed. Endothelin-1 receptor density was 2-fold higher in renal medulla than in cortex (P⬍0.05). Type B was the main receptor subtype in both regions. In the renal cortex, low sodium diet caused a 194% increase in prepro-endothelin-1 mRNA (P⬍0.05), whereas endothelin-converting enzyme-1 type B and type A receptors remained unchanged. In contrast, in the renal medulla the increase in prepro-endothelin-1 mRNA (⫹30%, P⬍0.05) was associated with a selective increase in type B receptor for both mRNA expression (⫹37%, P⬍0.05) and binding density (⫹55%, P⬍0.05). Increasing in vitro sodium concentrations between 154 and 308 mmol/L significantly enhanced type B receptor density (P⬍0.05) and affinity (P⬍0.05). In conclusion, during low sodium diet, renal prepro-endothelin-1 synthesis increases mainly in the renal cortex (where no changes in receptors occur), whereas type B receptor is selectively enhanced in the renal medulla. The range of sodium concentrations that are physiologically present in vivo in the renal medulla selectively modulate type B receptor density and affinity. (Hypertension. 2002;40:179-185.)
Key Words: endothelin 䡲 receptors, endothelin 䡲 sodium 䡲 kidney 䡲 water-electrolyte balance 䡲 diet, sodium-restricted
R
enal endothelin (ET)-1 is produced by vascular endothe-lium in the cortex, including glomerular capillaries, arterioles, and peritubular capillaries, and by tubular epithe-lial cells in the inner medulla.1,2 These 2 compartments represent 2 distinct systems, both involved in volume ho-meostasis. ET-1 produced in the vasculature by endothelial cells is able to reduce blood flow at the renal cortex by acting on endothelin type A (ETA) receptor subtype.3This vascular ETA-mediated effect results in increased sodium reabsorption in both humans3,4 and experimental animals.5 Conversely, ET-1 produced by tubular epithelial cells inhibits arginine vasopressin (AVP)-stimulated osmotic water permeability in inner medullary collecting ducts6 – 8 via endothelin type B (ETB) receptor subtype,5,9 thus increasing free water clearance.2There is in vitro evidence that the increased osmolality increases preproET-1 (ppET-1) mRNA expression and ET-1 synthesis in epithelial tubular cells.10,11In vivo, an increased renal ET-1 production has been found in pathophysiological and clinical conditions characterized by increased medulla osmolarity, such as dehydrated physical exercise,12low so-dium diet,2and heart failure.13
However, although cortical and medullary ET-1 systems participate differently in sodium and water handling, no studies exist comparing the activation of the ET-1 system in the 2 renal regions in the sodium-retentive states. Moreover, despite the fact that the use of ET-1 receptor antagonist has been proposed in heart failure,14 –16no information is avail-able as to whether the increased local ET-1 synthesis is associated with a consensual increase in receptor synthesis or whether it may cause downregulation of its specific receptors. Therefore, the aims of this study are to compare the effects of low sodium diet on the expression of the various ET-1 system components (ppET-1, endothelin-converting enzyme [ECE]-1, ETA, and ETB) in the cortex and in renal medulla and to investigate whether sodium might play a direct role on endothelin receptor binding density and affinity.
Methods
Subjects Investigated and Experimental Protocol
Twelve patients affected by polar tumor and listed for elective nephrectomy were investigated. No subject was a smoker or had taken any drug for at least 4 weeks. Patients with hypertension, ischemic heart disease, heart failure, renal failure, abnormal liver
Received February 4, 2002; first decision February 25, 2002; revision accepted June 6, 2002.
From the Clinica Medica e Cardiologia (S.V., G.P., I.C., P.A.M.), and the Division of Urology (S.S., M.C.), University of Florence, Italy. Correspondence to Prof Pietro Amedeo Modesti, MD, PhD, Clinica Medica Generale e Cardiologia, University of Florence, Viale Morgagni, 85, 50134 Florence, Italy. E-mail pa.modesti@dfc.unifi.it
© 2002 American Heart Association, Inc.
Hypertension is available at http://www.hypertensionaha.org DOI: 10.1161/01.HYP.0000026809.68674.F9
function tests or diabetes were excluded. The study was approved by the local review committee of the University of Florence, and all subjects gave their informed, written consent.
During the week preceding surgery, patients were randomized to receive a 7-day period of the same basic diet, with either normal (108 mmol/d NaCl; n⫽6) or low (20 mmol/d NaCl; n⫽6) sodium intake. Urine and plasma samples for the determination of sodium, creatinine, and plasma renin activity (PRA) were taken daily during the last 3 days of each diet regimen (Table 1).
Transmural kidney specimens, containing both cortex and me-dulla, were cut from the pole opposite the tumor and fixed in 4% paraformaldehyde for in situ hybridization studies. In addition, separated specimens of whole medulla (containing both inner and outer medulla) and cortex were dissected immediately after nephrec-tomy and frozen in liquid nitrogen for binding and RT-PCR studies.
Receptor Binding Studies
Cell membranes were obtained from homogenated tissue as previ-ously described.17Competition and kinetic studies were performed
in the presence of increasing concentrations of NaCl or NaH2PO4(0,
77, 154, 231, and 308 mmol/L). Experiments were carried out in triplicate, and separate curves for renal cortex and medulla were obtained in each patient.
Equilibrium Binding Studies
Cell membranes (250g/mL) were incubated with125I-ET-1 (100
pmol/L, 2000 Ci/mmol) (Amersham) and increasing concentrations of unlabeled ET-1 (0 to 1mol/L) or selective ETA(BQ123, 0 to 100 mol/L) and ETB (BQ788, 0 to 100mol/L) antagonists for 120
minutes at 22°C in a final volume of 0.2 mL.17The content was then
Kinetic Analysis
The kinetics of association of 125I-ET-1 (100 pmol/L) to cell
membranes (250g/mL) were evaluated as previously described.19
RT-PCR Analysis
Levels of ppET-1, ECE-1, ETA, and ETBtranscripts were quantified
with reverse transcription-polymerase chain reaction (RT-PCR) us-ing specific primers (Table 2) with GAPDH as the internal standard as previously described.17The efficiency of amplification of each
primer pair was calculated beforehand from the slope of the semilogarithmic relationship between cycles of amplification (26 to 44) and amplification products (23% for GAPDH, 23% for ppET-1, 22% for ECE-1, and 22% for both ETAand ETBreceptors) (Figure
1). All RT-PCR studies were performed in triplicate in all subjects investigated.
In Situ Hybridization Studies
In situ hybridization studies were performed as previously described2
using specific cDNA probes for ETA and ETB receptor subtypes
(ETA, American Type Culture Collection, ATCC 105194, and ETB,
ATCC 1250426) and for GAPDH (ATCC 57090).
Statistical Analysis
Data are presented as mean⫾SD. Comparisons of a single observa-tion between groups were made with ANOVA and 2-tailed t tests. All statistical analyses were performed with BMDP statistical software (BMDP Statistical Software, Inc).
Results
Renal ET-1 SystemRT-PCR showed that the ppET-1/GAPDH ratio was 3-fold higher in renal medulla than in cortex (1.01⫾0.1 versus 0.31⫾0.24, respectively; P⬍0.01), whereas there was a comparable presence of ECE-1 mRNA in the 2 regions (ECE-1/GAPDH ratios of 0.85⫾0.45 and 0.78⫾0.44, respec-tively) (Figure 2A).
ETBmRNA was the prevalent receptor transcript in both medulla (1.21⫾0.08 and 0.39⫾0.12 for ETB/GAPDH and ETA/GAPDH ratios, respectively) and renal cortex (0.95⫾0.33 and 0.45⫾0.14, respectively) (Figure 2A). In situ hybridization studies showed that mRNA for ETB receptor was mainly expressed by tubular epithelial cells in renal medulla, whereas the ETA subtype was almost exclusively
TABLE 2. GAPDH, ppET-1, ECE-1, ETA, and ETBPrimers for RT-PCR
Primer Sequence 5⬘—3⬘ cDNA Sizes (bp) T Annealing (°C) Cycles (n) GAPDH 5⬘ TGAAGGTCGGAGTCAACGGA 987 58 32 3⬘ CATGTGGGCCATGAGGTCCA ppET-1 5⬘ GTCAACACTCCCGAGCACGTT 304 60 32 3⬘ CTGGTTTGTCTTAGGTGTTCCTC ECE-1 5⬘ TGCCATCTACAACATGATAG 572 52 32 3⬘ GTCTTGACCCACTTCTTC ETA 5⬘ TATCAATGTATTTAAGCTGCTGG 252 56 35 3⬘ GGAATGGCCAGGATAAAGG ETB 5⬘ TTGGAGCTGAGATGTGTAAGC 626 56 35 3⬘ CCATAGTTGTACCGAAGTGAC Intake (n⫽6) Intake (n⫽6) Age, y 53⫾3 55⫾7 Gender, M/F 4/2 3/3
Systolic arterial pressure, mm Hg 125⫾7 128⫾8 Diastolic arterial pressure, mm Hg 82⫾3 83⫾3
Plasma glucose, mg/dL 80⫾6 81⫾7
Plasma sodium, mEq/L 139⫾4 137⫾5 Plasma creatinine, mg/dL 0.97⫾0.25 0.93⫾0.32 Creatinine clearance, mL/min 93⫾7 94⫾9 Sodium clearance, mL/min 0.6⫾0.04 0.09⫾0.03* Plasma renin activity, ng Ang I/mL per hour 1.58⫾0.32 4.34⫾0.24*
Ang I indicates angiotensin I. *P⬍0.05 vs normal sodium intake.
localized in the endothelial cells of peritubular vessels (Fig-ure 2B).
With binding studies, ET-1 receptor density was 2-fold higher in renal medulla than in cortex (127⫾13 versus 59⫾9 fmol/mg protein, P⬍0.05) (Table 3). Again with binding studies, receptor population was almost exclusively repre-sented by the ETBsubtype in both districts (⬎80%) (Figure 3), with a 2.3-fold higher maximum binding (Bmax) in renal medulla than in renal cortex (Table 3). No differences in receptor affinity were observed between renal medulla and renal cortex.
Effect of Low Sodium Diet
In renal cortex, only mRNA for ppET-1 was markedly increased (⫹194% versus normal sodium diet) whereas mRNAs for ECE-1 and receptor subtypes remained un-changed (Figure 4). No changes in receptor binding were found in renal cortex (Table 3).
Conversely, in renal medulla, both ppET-1 and ETBgenes were significantly enhanced (⫹30% and ⫹37%, respectively;
P⬍0.05 for both) without any changes in ECE-1 and ETA transcripts. Binding studies confirmed the selective increase
in ETBreceptor density in renal medulla during low sodium diet (⫹55% versus normal sodium diet) with no modifica-tions in the ETAsubtype (Table 3, Figure 5).
Effect of Sodium In Vitro
ETBreceptor density and affinity showed a sodium-dependent increase in renal medullary membranes obtained from pa-tients on normal sodium diet (Table 3, Figure 6). The increase was significant for NaCl concentrations greater than 154 mmol/L because, at 154 mmol/L, ETBreceptor density was increased by 15% versus NaCl-free buffer (NS), whereas at 231 and 308 mmol/L increased by 28% (P⬍0.05 versus NaCl-free buffer) and 49% (P⬍0.05 versus both NaCl-free buffer and 154 mmol/L NaCl).
Likewise, the binding affinity remained almost unchanged versus NaCl-free buffer up to 154 mmol/L NaCl (1.5-fold, NS), and was 3.2-fold and 3.8-fold enhanced at 231 and 308 mmol/L NaCl, respectively (P⬍0.05 versus NaCl-free and 154 mmol/L NaCl for both) (Table 3).
In addition, the same effect was observed with membranes isolated from renal cortex. The relationship between the K⫻R product of ET-1 binding (a unitless measure of the amount of
Figure 1. A, Amplification of GAPDH, endothelin type A (ETA) and type B (ETB)
receptors, prepro-endothelin (ppET)-1, and endothelin-converting enzyme (ECE)-1 in human renal medulla at increasing numbers of cycles (26 to 44). B, Semilogarithmic representation of the relative extent of amplification (Y) of GAPDH, ETAand ETBreceptors, ppET-1,
and ECE-1.
Figure 2. Expression of the components of the ET-1 system in human kidney. A, Representative RT-PCR of mRNA expression for ppET-1, ECE-1, and GAPDH (upper panel) and for ETAand
ETBreceptors and GAPDH (lower panel)
in human kidney at normal sodium diet (n⫽6). Ratio to GAPDH mRNA expres-sion is reported. *P⬍0.01 versus medulla. B, In situ hybridization studies for ETAand ETBreceptor mRNAs in renal
medulla and renal cortex. Prevalent ETB
expression on tubular epithelial cells in renal medulla. Localization of ETA
sub-type in interstitial and endothelial cells of peritubular vessels.
ligand-receptor binding) and sodium concentration in the incubation medium showed a sigmoid pattern with a maxi-mum rate of increase for sodium concentrations ranging between 154 and 308 mmol/L, which corresponded to a 4-fold increase in ET-1 binding efficiency (Figure 7). The enhancement of binding efficiency was not attributable to chloride because similar results were obtained when NaH2PO4was used instead of NaCl (Figure 7).
Discussion
The present study shows that during low sodium diet (1) the synthesis of renal ppET-1 is increased mainly in the cortex, where no changes in endothelin receptors occur, whereas (2) ETBreceptor density selectively increases in renal medulla,
and, moreover, that (3) sodium in vitro directly enhance ETB receptor density and affinity.
Increased ppET-1 mRNA expression in the endothelial cells of the peritubular capillary network and in epithelial cells of the medullary collecting tubules during low sodium diet was previously reported by our group.2In the same study, the increased ppET-1 mRNA expression was associated with an increased renal ET-1 production and urinary ET-1 excre-tion linearly related to sodium retenexcre-tion.2The present study extends these results and offers new insights into the role of ET-1 in sodium retentive states in humans. The comparison between cortex and renal medulla of ppET-1 mRNA expres-sion at RT-PCR shows that, during low sodium diet, the ppET-1 gene is enhanced to a greater extent in renal cortex, where the vascular component is highly represented, than in renal medulla. Moreover, mRNA studies performed in corti-cal tissue have revealed that the ETA receptor, previously found in homogenates from renal cortex,20,21 is mainly localized in the vasculature (in situ hybridization) and is not downregulated during low sodium diet (RT-PCR studies). Sodium reabsorption mainly occurs at the proximal tubule with an active process. In addition, when extracellular vol-ume is contracted, as during low sodium diet, and postglo-merular resistances are increased to maintain the glopostglo-merular filtration rate, the decreased hydrostatic pressure and the increased colloid osmotic pressure in peritubular capillaries further enhance the rate of sodium reabsorption at the proximal tubule. The wide range of increase in ppET-1 expression in renal cortex (⫹194%) might contribute to
Normal Sodium Intake (108 mmol/d NaCl)
Low Sodium Intake (20 mmol/d NaCl) Tris Buffer Tris Buffer⫹NaCla Tris Buffer Tris Buffer⫹NaCla
Cortex
Bmax total, fmol/mg 59⫾9 121⫾12* 61⫾11 130⫾16*
ETA⬊ETB 18⬊82 11⬊89 16⬊84 9⬊91 ETA, fmol/mg 11⫾2 13⫾1 10⫾2 12⫾1 ETB, fmol/mg 49⫾7 107⫾10* 51⫾9 118⫾14* Kd ET-1, pmol/L 55⫾14 13⫾2* 47⫾6 15⫾5* Kobs, min⫺1 0.064⫾0.012 0.106⫾0.010* 0.065⫾0.015 0.103⫾0.018* K-1, min⫺1 0.0076⫾0.0019 0.0034⫾0.0005* 0.0066⫾0.0008 0.0038⫾0.0005* Medulla
Bmax total, fmol/mg 127⫾13† 182⫾18*† 184⫾26‡† 279⫾17*‡†
ETA⬊ETB 12⬊88 8⬊92 6⬊94 5⬊95 ETA, fmol/mg 15⫾2 15⫾1 11⫾3 14⫾1 ETB, fmol/mg 112⫾12† 167⫾17*† 173⫾24‡† 265⫾17*‡† Kd ET-1, pmol/L 38⫾17 10⫾3* 32⫾11 12⫾4* Kobs, min⫺1 0.043⫾0.010 0.097⫾0.032* 0.060⫾0.007 0.095⫾0.023* K-1, min⫺1 0.0063⫾0.0019 0.0029⫾0.0008* 0.0060⫾0.0011 0.0033⫾0.0007* Bmax indicates maximum binding; Kd ET-1, dissociation constant of ET-1; Kobs, kinetically derived observed association rate constant; K-1, kinetically derived dissociation rate constant.
aThe effect of local sodium concentration on ET-1 binding is investigated in vitro in the presence
of 308 mmol/L NaCl.
*P⬍0.05 vs Tris-buffer; †P⬍0.05 vs cortex; ‡P⬍0.05 vs normal sodium intake.
Figure 3. Competition experiments in human renal cortex (A) and medulla (B) of patients on normal sodium diet (n⫽6). ET-1 (filled circles), BQ123 (empty circles). Experiments are per-formed in triplicate.
reducing cortical blood flow through ETA receptors,4,5,22 enhancing sodium and water reabsorption at the proximal tubule. The reduction in cortical blood flow also attenuates the flow in the vasa recta, so that the reduced washout of osmolytes in renal medulla increases intratubular sodium concentration and passive sodium reabsorption at the thin ascending limb of Henle’s loop.23,24
Therefore, the high ppET-1 overexpression in the cortex at low sodium diet, without changes in vascular ETAreceptor, indicate that, at normal sodium diet, the ETAreceptor popu-lation exceeds the physiological requirement and that, during low sodium diet, ET-1 contributes to sodium reabsorption mainly via the ETA-mediated reduction of cortical blood flow and, finally, that ET-1 does not downregulate the ETA receptor.
Unlike in the cortex, in renal medulla the increased ppET-1 transcript (30%) is paralleled by selective ETBreceptor gene overexpression (37%) with selective increase in the number of ETBbinding sites (55%). The mechanisms responsible for the increased medullary de novo synthesis of ETBreceptors during low sodium diet remain to be investigated, and a
possible role for medulla hyperosmolarity can only be pos-tulated. In situ hybridization indicates that the ETBreceptor gene in the renal medulla is expressed by epithelial cells of distal tubules and collecting ducts, where previous autoradio-graphic studies had localized the receptor protein.19 ET
B receptors in inner medullary collecting ducts mediate the ET-1 inhibitory effect on AVP-stimulated osmotic water permeability.6,25,26 In addition, ET
Bstimulation also inhibits sodium reabsorption along the thick ascending limb.5,27ET
B -selective overexpression in the renal medulla during low sodium diet may modulate ETA-mediated sodium retention, at the same time contrasting AVP-mediated water reabsorption and possible hyponatremia in clinical conditions character-ized by nonosmotic AVP secretion, such as heart failure.
During a low sodium diet, the efficiency of ETBreceptor binding in renal medulla also appears to be magnified, in addition to increased ETBreceptor synthesis. In vitro studies have indeed shown a direct effect of increased local sodium concentration on ETBreceptor density and affinity in medul-lary membranes. The maximum effect of sodium on ETB receptors in vitro is evident between 154 and 308 mmol/L
Figure 5. Binding of ET-1 at equilibrium to cortical (upper part) or medullary (lower part) membranes of kidneys obtained after normal (filled circles, n⫽6) or low sodium diet (empty circles, n⫽6). Experiments were performed in triplicate.
Figure 6. Effect of increasing sodium concentration on the association and dissociation phases of the ET-1 binding to membranes from renal medulla of patients on normal sodium diet (n⫽6). Experiments were performed in triplicate.
Figure 4. Representative mRNA expres-sion of the components of the ET-1 sys-tem (ppET-1, ECE-1, and ETAand ETB
receptors) after normal (108 mmol/d NaCl) and low sodium diet (20 mmol/d NaCl) in renal cortex (upper panels) and in renal medulla (lower panels). The right graphs represent the increase in mRNAs (expressed as ratio to GAPDH) during low sodium diet (n⫽6) compared with normal sodium diet (n⫽6). All RT-PCR studies were performed in triplicate in all subjects investigated.
(Figure 7), ie, within the range of sodium concentration in renal medulla.28 This effect is observed in membranes ob-tained from patients at both low and normal sodium diet and is not due to chloride in itself because the same pattern of response is observed when sodium phosphate is used.
The adaptation of ETBreceptors to different sodium intake is not an isolated result. Type I angiotensin (Ang) II receptors in the kidney also exhibit physiological adaptation during chronic changes in sodium intake because sodium restriction increased renal Ang II receptor density and AT1 mRNA levels in the 2 main sites of sodium reabsorption, proximal tubules29,30and the medullary thick ascending limb of loop of Henle.31 Conversely, a high salt diet was associated with a downregulation of AT1 receptors.32 Therefore, during low sodium diet the upregulation of angiotensin II receptors cooperates with angiotensin II formation to enhance sodium retention. In the same condition, the endothelin-1 system seems to operate as a modulating system because it selec-tively activates the ETB receptor subtype, which causes natriuresis and increases free water clearance.
Experiments performed in rats indicated that AT1 receptor upregulation during low sodium diet is Ang II– dependent because it was prevented by losartan treatment.31At variance with Ang II, endothelin-1 seems not responsible for receptor upregulation because, according to the present findings, ETB receptor is not enhanced in the cortex where ET-1 is overex-pressed to a greater extent than in medulla. Moreover, the in vivo increase in ETBreceptor binding efficiency during low sodium diet is reproduced in vitro by sodium concentrations expected to be present in renal medulla. Sodium was reported to interact at the level of the second transmembrane domain of the other 7 membrane domain receptors, such as the D2 receptor33 and the bradykinin B2 receptor,34 resulting in enhanced stability of the agonist-receptor complex and en-hanced binding efficiency.35 The present study does not clarify the responsible mechanism at the molecular level but, for the first time, indicates that only the type B of the 2 endothelin receptors dynamically adapts its binding effi-ciency in a range of sodium concentration that is physiolog-ical for renal medulla.
In conclusion, present findings indicate that the endothelin system in the kidney is regulated by sodium intake and that the local levels of sodium directly modulate ETB receptor density and affinity, resulting in a different adaptations of the cortex and renal medulla to low sodium diet.
shows a dynamic modulation of the renal ET-1 system in a physiological condition of sodium retention. ETB enhances free water clearance so that medullary ETBreceptor adapta-tion might indeed play a key role in counteracting cortical ETA-mediated sodium retention and AVP-mediated water reabsorption in sodium retentive states.
These results might also bear implications for the proposed therapeutic use of endothelin receptor antagonist in heart failure. Notwithstanding the fact that acute nonselective ET-1 antagonism showed hemodynamic benefits in heart failure patients,36,37the ET
Bblockade might be responsible for the early and sustained increase in body weight and frequency of edema caused by fluid retention, recently observed during chronic mixed ETA/ETB receptor blockade.38 It is worth recalling that, in experimental heart failure, only the use of selective ETA antagonists was shown to improve diuresis, whereas no effects were observed following the administra-tion of nonselective ET-1 antagonists.39,40 Therefore, the enhanced ETB efficiency might play a relevant role, espe-cially under conditions of marked sodium retention.
References
1. Pupilli C, Brunori M, Misciglia N, Selli C, Ianni L, Yanagisawa M, Mannelli M, Serio M. Presence and distribution of endothelin-1 gene expression in human kidney. Am J Physiol. 1994;267:F679 –F687. 2. Modesti PA, Cecioni I, Migliorini A, Naldoni A, Costoli A, Vanni S, Neri
Serneri GG. Increased renal endothelin formation is associated with sodium retention and increased free water clearance. Am J Physiol. 1998;275:H1070 –H1077.
3. Honing ML, Hijmering ML, Ballard DE, Yang YP, Padley RJ, Morrison PJ, Rabelink TJ. Selective ET(A) receptor antagonism with ABT-627 attenuates all renal effects of endothelin in humans. J Am Soc Nephrol. 2000;11:1498 –1504.
4. Rabelink TJ, Kaasjager KAH, Boer P, Stroes EJ, Braam B, Koomans HA. Effects of endothelin-1 on renal function in humans: implications for physiology and pathophysiology. Kidney Int. 1994;46:376 –381. 5. Clavell AL, Stingo AJ, Margulies KB, Brandt RB, Burnett JC. Role of
endothelin receptor subtypes in the in vivo regulation of renal function. Am J Physiol. 1995;268:F455–F460.
6. Oishi R, Nonoguchi H, Tomita K, Marumo F. Endothelin-1 inhibits AVP-stimulated osmotic water permeability in rat inner medullary col-lecting duct. Am J Physiol. 1991;261:F951–F956.
7. Zeidel ML, Brady HR, Kone BC, Gullans SR, Brenner BM. Endothelin, a peptide inhibitor of Na(⫹)-K(⫹)-ATPase in intact renal tubular epi-thelial cells. Am J Physiol. 1989;257:C1101–C1107.
8. Tomita K, Nonoguchi H, Terada Y, Marumo F. Effects of ET-1 on water and chloride transport in cortical collecting ducts of the rat. Am J Physiol. 1993;264:F690 –F696.
9. Hoffman A, Abassi ZA, Brodsky S, Ramadan R, Winaver J. Mechanisms of big endothelin-1-induced diuresis and natriuresis: role of ET(B) receptors. Hypertension. 2000;35:732–739.
10. Yang T, Terada Y, Nonoguchi H, Ujiie K, Tomita K, Marumo F. Effect of hyperosmolality on production and mRNA expression of ET-1 in inner medullary collecting duct. Am J Physiol. 1993;264:F684 –F689. 11. Migas I, Backer A, Meyer-Lehnert H, Kramer HJ. Endothelin synthesis
by porcine inner medullary collecting duct cells. Effects of hormonal and osmotic stimuli. Am J Hypertens. 1995;8:748 –752.
12. Neri Serneri GG, Cecioni I, Migliorini A, Vanni S, Galanti G, Modesti PA. Both plasma and renal endothelin-1 participate in the acute cardio-vascular response to exercise. Eur J Clin Invest. 1997;27:761–766. 13. Modesti PA, Cecioni I, Costoli A, Poggesi L, Galanti G, Neri Serneri GG.
Renal endothelin in heart failure and its relation to sodium excretion. Am Heart J. 2000;140:617– 622.
Figure 7. Effect of increasing NaCl and NaH2PO4concentration
in the incubation buffer on the ET-1 binding efficiency as expressed by the K⫻R product (affinity constant ⫻ receptor binding concentration). *P⬍0.05 versus NaCl-free buffer and versus NaCl 154 mmol/L.
14. Spieker LE, Noll G, Ruschitzka FT, Luscher TF. Endothelin receptor antagonists in congestive heart failure: a new therapeutic principle for the future? J Am Coll Cardiol. 2001;37:1493–1505.
15. Suresh DP, Lamba S, Abraham WT. New developments in heart failure: role of endothelin and the use of endothelin receptor antagonists. J Card Fail. 2000;6:359 –368.
16. Sutsch G, Kiowski W. Endothelin and endothelin receptor antagonism in heart failure. J Cardiovasc Pharmacol. 2000;35(4 suppl 2):S69 –S73. 17. Neri Serneri GG, Cecioni I, Vanni S, Paniccia R, Bandinelli B, Vetere A,
Janming X, Bertolozzi I, Boddi M, Lisi GF, Sani G, Modesti PA. Selective upregulation of cardiac endothelin system in patients with ischemic but not idiopathic dilated cardiomyopathy: endothelin-1 system in the human failing heart. Circ Res. 2000;86:377–385.
18. Munson PJ, Rodbard D. Ligand, a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem. 1980;107: 220 –239.
19. Modesti PA, Vanni S, Paniccia R, Bandinelli B, Bertolozzi I, Polidori G, Sani G, Neri Semeri GG. Characterization of endothelin-1 receptor subtypes in isolated human cardiomyocytes. J Cardiovasc Pharmacol. 1999;34:333–339.
20. Karet FE, Davenport AP. Comparative quantification of endothelin receptor mRNA in human kidney: new tools for direct investigation of human tissue. J Cardiovasc Pharmacol. 1995;26(suppl 3):S268 –S271. 21. Backer A, Bokemeyer D, Kramer HJ. Endothelin synthesis and receptors
in porcine kidney. Acta Physiol Scand. 2001;171:105–112.
22. Kaasjager KA, Shaw S, Koomans HA, Rabelink TJ. Role of endothelin receptor subtypes in the systemic and renal responses to endothelin-1 in humans. J Am Soc Nephrol. 1997;8:32–39.
23. Navar LG, Inscho EW, Majid SA, Imig JD, Harrison-Bernard LM, Mitchell KD. Paracrine regulation of the renal microcirculation. Physiol Rev. 1996;76:425–536.
24. Webb D. Physiological role of the endothelin system in human cardio-vascular and renal haemodynamics. Curr Opin Nephrol Hypertens. 1997; 6:69 –73.
25. Tomita K, Nonoguchi H, Marumo F. Effects of endothelin on peptide-dependent cyclic adenosine monophosphate accumulation along the nephron segments of the rat. J Clin Invest. 1990;85:2014 –2018. 26. Kohan DE, Hughes AK. Autocrine role of endothelin in rat IMCD:
inhibition of AVP-induced cAMP accumulation. Am J Physiol. 1993;265: F126 –F129.
27. Plato CF, Pollock DM, Garvin JL. Endothelin inhibits thick ascending limb chloride flux via ET(B) receptor-mediated NO release. Am J Physiol Renal Physiol. 2000;279:F326 –F333.
28. Selkurt EE. The renal circulation. In: Shepherd JT, Abboud FM, eds. Peripheral Circulation and Organ Blood Flow, sect 2, vol 3. The Handbook of Physiology. Bethesda, MD: American Physiological Society; 1983:1457–1516.
29. Douglas JG. Angiotensin receptor subtypes of the kidney cortex. Am J Physiol. 1987;253:F1–F7.
30. Cheng HF, Becker BN, Burns KD, Harris RC. Angiotensin II upregulates type-1 angiotensin II receptors in renal proximal tubule. J Clin Invest. 1995;95:2012–2019.
31. Wang DH, Li J. Regulation of angiotensin II receptors in the medullary thick ascending limb. Mol Cell Biochem. 2000;212:211–217.
32. Strehlow K, Nickenig G, Roeling J, Wassmann S, Zolk O, Knorr A, Bohm M. AT(1) receptor regulation in salt-sensitive hypertension. Am J Physiol. 1999;277:H1701–H1707.
33. Neve KA. Regulation of dopamine D2 receptors by sodium and pH. Mol Pharmacol. 1991;39:570 –578.
34. Quitterer U, Abdalla S, Jarnagin K, Muller-Esterl W. Na⫹ ions binding to the bradykinin B2 receptor suppress agonist-independent receptor activation. Biochemistry. 1996;35:13368 –13377.
35. Lepiku M, Jarv J, Rinken A, Fuxe K. Mechanism of modulation of [3H]raclopride binding to dopaminergic receptors in rat striatal mem-branes by sodium ions. Neurochem Int. 1997;30:575–581.
36. Kiowski W, Sutsch G, Hunziker P, Muller P, Kim J, Oechslin E, Schmitt R, Jones R, Bertel O. Evidence for endothelin-1-mediated vasocon-striction in severe chronic heart failure. Lancet. 1995;346:732–736. 37. Sutsch G, Kiowski W, Yan XW, Hunziker P, Christen S, Strobel W, Kim
JH, Rickenbacher P, Bertel O. Short-term oral endothelin-receptor antag-onist therapy in conventionally treated patients with symptomatic severe chronic heart failure. Circulation. 1998;98:2262–2268.
38. ENABLE Results Show Pitfalls of Endothelin Antagonists in Treating CHF. Available at http://www.acc.org/2002ann%5Fmeeting/ssnews/ enable.htm. Accessed March 20, 2002.
39. Wada A, Tsutamoto T, Fukai D, Ohnishi M, Maeda K, Hisanaga T, Maeda Y, Matsuda Y, Kinoshita M. Comparison of the effects of selective endothelin ETA and ETB receptor antagonists in congestive heart failure. J Am Coll Cardiol. 1997;30:1385–1392.
40. Borgeson DD, Grantham JA, Williamson EE, Luchner A, Redfield MM, Opgenorth TJ, Burnett JC Jr. Chronic oral endothelin type A receptor antagonism in experimental heart failure. Hypertension. 1998;31: 766 –770.
