CHAPTER 3
MATERIALS AND METHODS
3.1 EPC CULTURE
Peripheral blood samples were collected from healthy, young volunteers (males, age <40 years). Mononuclear cells (MNCs) were isolated from 30 ml of peripheral blood by a density gradient centrifugation method and cultured on fibronectin-coated dishes at 106 cells/cm2 for 5 days in complete endothelial cell growth medium (EGM-2-MV, Lonza, Switzerland) containing 20% fetal bovine serum (FBS) to obtain EPC in accordance with literature. For cell viability experiments cells were seeded in 96 wells plates respectively.
3.2 CELL VIABILITY ASSAY
A colorimetric assay based on the cleavage of the tetrazolium salt WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolium]-1,3-benzene disulfonate, Roche Applied Science, Mannheim, Germany) was used to evaluate cell viability. Briefly, cells cultured on 96 well plates in quadruplicate, in presence of different concentrations of S1P (0.1-1-5 µM), were incubated with WST-1 (10 µL/well) for 4 hours at 37°C, 5% CO2. The formazan dye was quantified by measuring
the optical density at 450/655 nm by use of a multiplate reader (Titertek Multiscan Plus). The optical density of control wells containing growth medium was subtracted from that of the samples with cells.
3.3 RNA ISOLATION AND REVERSE TRANCRIPTION POLYMERASE CHAIN REACTION
5-days cultured on fibronectin EPC in presence or absence of S1P ( at different doses or times of incubation) or VEGF were harvested, and total RNA was isolated by using RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. Huvec were used as cells reference. The RNA concentration and purity were calculated by measuring the absorbance at 260 and 280 nm by spectrophotometer. Quality of the RNA was assessed by 1% agarose gel electrophoresis. Reverse transcription was performed using 1µg of total RNA in a final volume of 20 µl, using iScript First Strand synthesis kit (Bio-rad).
3.4 REAL TIME PCR
Gene–specific primer pairs were designed by using a software program (Beacon Designer 7.0, mFold, Bio-Rad). Primers were designed for the following genes: S1P1-5 (Table 2). All PCRs were
performed with SYBR Green I chemistry in a MiniOpticon Real-Time PCR System (Bio-Rad). For PCRs, the final reaction mixture contained 1 µL of cDNA, 300 nmol/L of each primer, 7.5 µL of iQ SYBR green Supermix (Bio-Rad), and RNase-free water to complete the reaction mixture volume up to 15 µL. All reactions were run in duplicates. The PCR was performed with a “hot-start” denaturation step at 95° C for 3 min, and then carried out for 41 cycles at 95° C for 5 s and 58° C for 20 s. The SYBR green fluorescence was read throughout the reaction, allowing a continuous monitoring of the amount of PCR product amplified. Specifity of the amplification was confirmed by melting-curve analysis from a subsequent temperature ramp from 60° C to 95° C. The amplification efficiencies were close to 100% for all primer pairs. The comparative Ct (threshold cycle) method normalized to RPL11 and RPL13, two stable RNAs in our experimental conditions, were used to analyze relative changes in gene expression (amount of target = 2-∆∆Ct). Data were reported as means ± SD and resulted from 5 independent experiments .
Table 2
Genes Sense primer (5’-3’) Antisense primer (5’-3’)
S1P1 tggtgggtagagttagttcctgtg tgctagacctttggctcagtgc S1P2 tgctcaagacggtcaccatcg ctttgtagaggatcgggcaggag S1P3 tgatcctctacgcacgcatc atgaacacgctcaccacaatc S1P4 cgcagcctcgcctgtatgg gggtggttgcctccttgtcc S1P5 aaatctgtgccctcgtggaattg tctctgtcgttgtcactggaatc RPL11 acttcgcatccgcaaactct tgtgagctgctccaacacctt RPL13 cctggaggagaagaggaaagaga ttgaggacctctggtgtatttgtcaa 3.5 WESTERN BLOTTING
EPC were incubated with 100 nM S1P (2h) or 50 ng/ml VEGF (30 minutes) in serum free medium. Cells were washed with ice-cold PBS and lysed for 30 min on ice in 200 µl lysis buffer containing 20 mM Tris/HCl pH 7.5, 137 mM NaCl, 10% glycerol, 1% triton X 100, 10 mM EDTA and protease inhibitors cocktail (1mM PMSF, 1µg/ml leupeptin, 1µg/ml aprotinin, 1µg/ml pepstatin A) (Aldrich-Sigma, St Louis, MO).The lysates were centrifuge for 30 min at 14000g, at 4° C. Proteins (20 µg) from lysates were subjected to 10% sodium dodecyl sulfate-polyacrilamide gel electrophoresis (SDS-PAGE) for 2h at 100 Volts before transfer of proteins to nitrocellulose membranes, which were blocked overnight at 4°C with 20mM Tris, pH 7.5,137mM NaCl containing 0.05 % tween 20 and 5% nonfat dry milk (Bio-Rad). After rinsing, membranes were immunoblotted overnight with anti S1P3 polyclonal antibody (Novus Biologicals, USA) and anti
alpha tubulin ( Santa Cruz biotechnologies, Santa Cruz, CA, USA ) at 4°C and then with specific secondary antibodies for 1h and 30 min at 37°C. Bound antibodies were detected using an enhanced chemiluminiscence (ECL) detection system (Millipore Corporation, Billerica, MA, USA). Densitometric analysis of the bands was performed using Imaging and Analysis Software by Bio-Rad (Quantity One).
3.6 MIGRATION ASSAY
The migratory function of EPC was evaluated by a modified Boyden chamber (Costar Transwell assay, 5 µm pore size, Corning, NY) assay. In brief, isolated EPC were detached with trypsin/EDTA, then 4x104 cells were resuspended in 100 µl EBM-2 medium, placed in the upper chamber of 24-well transwell plates and 600 µl of EBM-2 medium containing VEGF (50 ng/ml ) or S1P at various concentrations ( 0.1-1-5.µM) or medium alone, were added to the lower chamber. After incubation for 24 h at 37 °C in 5% CO2 transmigrated cells to lower chamber were counted. In
another set of experiments 4x104 EPC cultured in presence of S1P at the same concentrations (see above) or VEGF (50 ng/ml), were added to the upper chamber and 600 µl of EBM-2 medium containing S1P (100nM) or medium alone, were added to the lower chamber.
Finally in additional experiments EPC were pre-incubated with an inhibitor of S1P2 (JTE-013) alone
and in presence of S1P or VEGF.
3.7 MATRIGEL TUBULE ASSAY
10 mg/ml Matrigel (BD, Bioscience, San Jose, CA) was added to a precooled 24 well-plate (300 µl/well) and incubate at 37°C for 30 minutes.
EPC previously incubated with S1P (0.1, 5, 10 µM) for 2 hours were harvested and seeded on Matrigel at a density of 95 103 and 19 104 cells/well. Matrigel cultures were incubated at 37°C and monitored regularly after 2, 4, 6, 24 hours using an inverted microscope (Hund Wetzlar, Germany). A cell suspension of 7 104 HUVEC/well was used as positive control. In another experiment EPC were directly plated onto a layer of Matrigel and then incubated with S1P at the three doses described, VEGF (50 ng/ml) alone or pretreated with VEGF and then S1P. Cells were monitored regularly after 2, 4, 6, 24 hours.
