CHARACTERIZATION OF BACTERIOCIN PRODUCING LACTOCOCCUS LACTIS AND THEIR APPLICATION FOR DAIRY PRODUCTS SAFETY IMPROVEMENT

(1)

LITHUANIAN UNIVERSITY OF HEALTH SCIENCES VETERINARY ACADEMY

Kristina Kondrotienė

CHARACTERIZATION OF BACTERIOCIN

PRODUCING LACTOCOCCUS LACTIS AND

THEIR APPLICATION FOR DAIRY

PRODUCTS SAFETY IMPROVEMENT

Doctoral Dissertation Agricultural Sciences,

Veterinary (02A)

(2)

Dissertation has been prepared at the Department of Food Safety and Quality of Veterinary Academy of Lithuanian University of Health Sciences during the period of 2014–2018.

Scientific Supervisor

Prof. Dr. Mindaugas Malakauskas (Lithuanian University of Health Sciences, Agricultural Sciences, Veterinary – 02A).

Dissertation is defended at the Veterinary Research Council of the Lithuanian University of Health Sciences:

Chairperson

Prof. Dr. Rasa Želvytė (Lithuanian University of Health Sciences, Agri-cultural Sciences, Veterinary – 02A).

Members:

Prof. Dr. Valdas Jakštas (Lithuanian University of Health Sciences, Biomedical Sciences, Pharmacy – 08B);

Prof. Dr. Arūnas Stankevičius (Lithuanian University of Health Scien-ces, Agricultural ScienScien-ces, Veterinary – 02A);

Prof. Dr. Daiva Leskauskaitė (Kaunas University of Technology, Tech-nological Sciences, Chemical Engineering – 05T);

Assoc. Prof. Dr. Jørgen Leisner (University of Copenhagen, Agricultu-ral Sciences, Veterinary – 02A).

Dissertation will be defended at the open session of the Veterinary Research Council of Lithuanian University of Health Sciences on the 1st_{of February,} 2019 at 1 p.m. in Dr. St. Jankauskas Auditorium of the Veterinary Academy of Lithuanian University of Health Sciences.

(3)

LIETUVOS SVEIKATOS MOKSLŲ UNIVERSITETAS VETERINARIJOS AKADEMIJA

Kristina Kondrotienė

BAKTERIOCINUS GAMINANČIŲ

LACTOCOCCUS LACTIS

BAKTERIJŲ

CHARAKTERIZAVIMAS IR JŲ TAIKYMAS

SAUGESNIŲ PIENO PRODUKTŲ GAMYBAI

Daktaro disertacija Žemės ūkio mokslai,

veterinarija (02A)

(4)

Disertacija rengta 2014–2018 metais Lietuvos sveikatos mokslų universiteto Veterinarijos akademijos Maisto saugos ir kokybės katedroje.

Mokslinis vadovas

prof. dr. Mindaugas Malakauskas (Lietuvos sveikatos mokslų universi-tetas, žemės ūkio mokslai, veterinarija – 02A).

Disertacija ginama Lietuvos sveikatos mokslų universiteto Veterinair-jos akademiVeterinair-jos VeterinariVeterinair-jos mokslo krypties taryboje:

Pirmininkė

prof. dr. Rasa Želvytė (Lietuvos sveikatos mokslų universitetas, žemės ūkio mokslai, veterinarija – 02A).

Nariai:

prof. dr. Valdas Jakštas (Lietuvos sveikatos mokslų universitetas, bio-medicinos mokslai, farmacija – 08B);

prof. dr. Arūnas Stankevičius (Lietuvos sveikatos mokslų universitetas, žemės ūkio mokslai, veterinarija – 02A);

prof. dr. Daiva Leskauskaitė (Kauno technologijos universitetas, tech-nologijos mokslai, chemijos inžinerija – 05T);

doc. dr. Jørgen Leisner (Kopenhagos universitetas, žemės ūkio mokslai, veterinarija – 02A).

Disertacija bus ginama viešame Veterinarijos mokslo krypties tarybos posė-dyje 2019 m. vasario mėn. 1 d. 13 val. Lietuvos sveikatos mokslų universi-teto Veterinarijos akademijos Dr. St. Jankausko auditorijoje.

Disertacijos gynimo vietos adresas: Tilžės g. 18, LT-47181 Kaunas, Lietuva.

(5)

5

ABBREVIATIONS

ATCC – American Type Culture Collection BHI – Brain Heart Infusion

CFS – Cell-free Supernatants CFU – Colony-Forming Units DNA – Deoxyribonucleic Acid

EFSA – European Food Safety Authority ESI – Electrospray Ionization

EU – European Union

GRAS – Generally Recognized As Safe KOH – Potassium Hydroxide

LAB – Lactic Acid Bacteria LB – Luria-Bertani

LSMU VA – Lithuanian University of Health Sciences Veterinary Academy

MIC – Minimum Inhibitory Concentration MRS – De Man Rogosa Sharpe

MS – Mass spectrometry NaCl – Sodium Chloride NaOH – Sodium Hydroxide

NCBI – National Center for Biotechnology Information

NCTC – National Collection of Type Cultures, a Culture Collection of Public Health England

nis- _{– Nisin Negative} nis+ _{– Nisin Positive} PCA – Plate Count Agar

PCR – Polymerase Chain Reaction pH – Potential of Hydrogen

QPS – Qualified Presumption of Safety TTA – Total Titratable Acidity

UHT – Ultra High Temperature

UPLC – Ultra-Performance Liquid Chromatography VMU – Vytautas Magnus University

(8)

8

INTRODUCTION

In recent years, food safety and quality attracts special attention not only from scientists, but also from consumers. Nowadays consumers prefer food without chemical additives and require longer food shelf-life at the same time. This demand for less processed and preservative-free, such as “clean label” products, with natural alternatives is also supported by the public authorities [1]. Therefore, this request from consumers impacts the search for alternative food processing and preservation technologies and encourages food manufacturers not to rely only on chemical additives for the preservation of foodstuff.

Natural antimicrobial compounds represent an alternative for chemical additives. They are responsible for a defense of the host from pathogenic organisms and are present in animals, plants, insects and bacteria [2]. Natural antimicrobial compounds increase the shelf life of food due to bactericidal or bacteriostatic effect. Microbiota of food products may consist of commensal, spoilage and pathogenic bacteria and many of them can cause undesirable reactions that deteriorate flavor, odor, color, sensory, and textural properties of foods [3]. The effect on sensory food product quality like texture, taste and aroma is caused by microbial spoilage which is one of the main reasons for the food loss [1]. As it is stated by the Food and Agriculture Organization of the United Nations, 1.3 billion tons of food are lost or wasted. With regard to dairy industry, 29 million tonnes of dairy products are lost or wasted every year in Europe alone [4]. Moreover, one of the major concerns in public health is consumption of foods that are conta-minated by foodborne pathogens. This is a causative reason for foodborne illness, therefore control and prevention of food contamination with food-borne pathogens is one of the challanges for the food industry [5].

The growth of spoilage and pathogenic microorganisms in foods could be prevented by incorporation of bacteriocins or bacteriocin producing lactic acid bacteria (LAB). Bacteriocins are bacterial peptides that has strong antimicrobial activity against closely related bacteria [3]. This could be an alternative not only for chemical additives but also could contribute to better sensory characteristics of foods as metabolites produced by LAB also could enhance flavor development [6]. Growth of LAB itself determines inhibition of undesired microorganisms that causes food spoilage, though their ability to produce bacteriocins is of major importance in strategies of biopreser-vation [7, 8].

Biopreservation refers to the extension of food shelf-life and improve-ment of microbiological quality using controlled microbial cultures and/or

(9)

9

natural antimicrobial compounds [9, 10]. Among the natural antimicrobial compounds used for food biopreservation are antifungal compounds like natamycin, antimicrobials from animal sources like lysozyme, antimicrobial substances derived from bacterial cell metabolism like organic acids or hydrogen peroxide, antimicrobials derived from plants like essential oils [11]. In recent years one of the biggest considerations in biopreservation is dedicated to lactic acid bacteria [12]. Among the LAB group, Lactococcus

lactis is well known and often used in the food industry due to

well-expressed production of bacteriocin nisin. Nisin has suitable characteristics for food preservation like high activity, a broad spectrum of antibacterial activity, rapid action, high stability against high temperature and acid [13]. The incorporation of nisin producing L. lactis strain as starter, adjunct or protective culture provides an alternative not only to chemical additives but could also contribute to better sensory characteristics of foods [14]. Howe-ver, number of marketed cultures is limited due to the difficulty in finding strains possessing several important properties such as the ability to growth in the desired food under manufacturing condition without producing any harmful effect on the growth and functionality of the starter culture and without damaging the sensory attributes of the final product [15].

Within the species of L. lactis, L. lactis subsp. lactis and L. lactis subsp.

cremoris represent the main LAB strains used worldwide for the production

of numerous fermented dairy products, including cheeses, buttermilk and others [16].

Apart from the search of natural antimicrobial compounds for applica-tion as food preservatives, it is important to guarantee food safety by strictly regulating conditions, kind of food in which preservatives can be used and maximum quantities allowed, thus protecting the consumers. In order to assure the compliance with the laws and guidelines, different techniques may be used for determination and quantification of preservatives in food, though fast, sensitive, simultaneous methods are needed.

The aim of the study

The aim of the study was to isolate nisin producing L. lactis strains with exceptional technological characteristics in order to apply them for dairy products technological improvement and to develop short time analysis method for the simultaneous determination of antimicrobial preservatives used for the production of dairy products.

(10)

10

Objectives of the study

1. To isolate nisin producing L. lactis strains from local food sources. 2. To evaluate technological and safety features of newly isolated

nisin producing L. lactis strains.

3. To select nisin producing L. lactis strains with prominent technolo-gical characteristics and antibacterial activity in order to apply them for quality improvement and more effective control of

Liste-ria monocytogenes in fresh cheese manufacturing.

4. To develop rapid UPLC-ESI-MS analysis method for the simulta-neous determination of antimicrobial preservatives such as nisin, natamycin, lysozyme and sorbic acid used in cheese production. Scientific novelty and practical significance of the research

The widespread use of only few selected dairy lactococci with reprodu-cible technological properties has resulted in a decreased intensity of flavor and taste of commercial dairy products. Therefore, the search for newly isolated lactococci cultures with different technological properties became an industrial priority in order to increase product quality, diversification and value.

In this study, 181 Lactococcus spp. strains isolated from local goat and cow milk, fermented wheat and buckwheat samples were identified as

L. lactis of which twelve were harbouring nisin A, Z or novel nisin variant

GLc03 genes. For the first time technological characteristics of L. lactis strains harbouring nisin variant GLc03 were evaluated. Three strains were selected according to safety and technological criteria and were examined in fresh cheese production for control of Listeria monocytogenes growth.

Listeria numbers were significantly reduced (P<0.001) in model cheese

suggesting the application of these strains for fresh cheese safety improve-ment. Also, fermentation of fresh cheeses using selected nisin producing bacteria resulted in increase of volatile compounds which are responsible for a pleasant odour of fermented dairy products. These three selected nisin pro-ducing L. lactis strains are in the process of being deposited in the microbio-logical cultures collection.

Rapid UPLC-ESI-MS analysis method was developed in order to eva-luate antimicrobial preservatives commonly used in cheese production. This method allows not only to detect nisin, natamycin, sorbic acid and lysozyme in one analysis, but also to perform quantitation of these compounds and will be applied at Lithuanian University of Health Sciences (LSMU).

(11)

11

1. LITERATURE REVIEW

1.1. Bacteriocins or bacteriocin producing LAB as natural antimicrobial compounds

Consumer awareness and concern regarding chemical additives and demand for minimally processed, easily prepared food products raise chal-lenges for food safety and quality, also food manufacturers [17]. For food manufacturers most popular food preservation technique was the use of chemical preservatives which can cause several side-effects such as a chan-ge in the components of food, diminished nutritive quality, and potential toxic effect on the human health [18]. Therefore, natural additives have become very popular in order to prevent the growth of spoilage and patho-genic microorganisms in foods. A lot of food products are perishable by nature and require protection from spoilage in order to give them desired shelf life. Main natural compounds used for this reason are essential oils derived from plants like basil or rosemary, enzymes that are obtained from animal sources like lysozyme, compounds from microbial sources like nisin or natamycin, organic acids like sorbic or citric acid and naturally occurring polymers like chitosan [3]. Particular interest during the last years is dedicated to the use of bacteriocins or bacteriocin producing lactic acid bacteria (LAB) as natural antimicrobial compounds.

1.2. Lactic acid bacteria

Lactic acid bacteria constitute a group of Gram-positive organisms which are anaerobic, but can withstand and grow in the presence of oxygen, lack catalase, are rod or coccus shaped, non-sporulating bacteria and produce lactic acid as the principal end product of sugar fermentation [19– 24]. The value of LAB consumption emerged in the early 20th_{century when} one scientist suggested that the absorption of these living microorganisms, that are present in yogurt, increased the longevity of the consumer by providing positive effects on the host health and by reducing population of spoilage and toxins producing bacteria in the digestive tract [25]. Since the discovery, LAB have been extensively studied and impressive amount of data are available regarding their contribution to the organoleptic character-ristics and nutritional value of the final product, and the improvement of the shelf life of fermented foods, due to the production of a wide variety of compounds including organic acids, ethanol, hydrogen peroxide, bacterio-cins and others, that are acting synergistically to prevent or eliminate

(12)

micro-12

bial contamination [12, 26]. Bacteriocin production can be considered as an advantage and functional role of LAB strains to be used in the food industry to improve food safety and quality [12]. Also, production of metabolites by LAB are technologically interesting and explain the use of LAB in food to produce a broad variety of fermented products [27].

Food products like meat, milk and milk products, beverages, bakery products, fruits and vegetables, fish and sea products, wine are the source of LAB. Similarly fermented food products such as vegetables like green tomatoes, pepper, cucumbers, inhabit different types of LAB. Different micro flora dominates in these food products depending upon the type of food product, environment and handling procedures [28, 29]. Altogether, variety of LAB is interesting not only to a species level, but at strain level too as most properties are strain dependent [27].

Most of the LAB are granted Generally Recognized as Safe (GRAS) status by the American Food and Drug Agency (FDA). The European Food Safety Authority (EFSA) also granted the Qualified Presumption of Safety (QPS) status to most of the LAB genera, such as Lactococcus,

Lactoba-cillus, Leuconostoc, Pediococcus, and some Streptococcus [30]. Between

the most widely selected genera for industrial application are Oenococcus, which is used for wine, Lactobacillus, which is used for meat, vegetables, dairy and cereals, and Lactococcus, which is used in dairy [19].

Lactococcus lactis is one of the best known and characterized species of

LAB [31]. Taxonomically, L. lactis is mesophilic Gram-positive species related to the Streptococcaceae and subdivided into three subspecies inclu-ding L. lactis subsp. hordniae, L. lactis subsp. lactis (incluinclu-ding the biovar

diacetylactis) and L. lactis subsp. cremoris [16, 32]. L. lactis subsp. lactis

and L. lactis subsp. cremoris collectively are called as “dairy” lactococci and they represent the main LAB constituents of the dairy starter, costarter or flavoring adjunct culture systems for cheese manufacturing [19, 33]. “Wild” lactococci are defined as strains that are isolated from raw milk or even from non-dairy environments. There are studies conducted that high-lighted wild lactococci isolated from dairy and non-dairy origin to produce specific flavors that are distinct from those of industrial strains [16, 34].

L. lactis has a long history of use in milk fermentation including small-scale

traditional operations and well-controled industrial applications [35, 36]. Though the technological role of this species has been always related to the manufacturing phase, lactococci can also contribute to the final texture (moisture, softness) and flavor of dairy products through their proteolytic and amino acid conversion pathways [35, 37].

(13)

13

1.3. Bacteriocins produced by LAB

All living organisms produce antimicrobial proteins and majority of them are referred to as antimicrobial peptides due to their relatively small size. Bacteria produce two types of antimicrobial peptides including those that are ribosomally synthesized and also known as bacteriocins, and those that are non-ribosomally synthesized, with no structural genes coding for these antimicrobial proteins [38, 39].

For the first time bacteriocins were discovered in 1925 and after the discovery, they became an area of research [40]. They are generally low molecular weight peptides that gain entry into target cells by binding to cell surface receptors [41]. In general bacteriocins are believed to be membrane-acting peptides and kill target bacteria through membrane permeabilization and extensive pore formation [42, 43]. Bacteriocins from LAB are important for the food industry, whether they are used as a starter, co-cultures or bioprotective cultures that give advantages in food safety and quality [44]. Bacteriocins produced by LAB are attracting significant interest as food preservatives [13, 45, 46]. Production of bacteriocins enhances the ability of LAB to control the growth of pathogens and food spoilage bacteria in food products [47], and makes them of particular interest to food industry offering natural alternatives for chemical additives to improve the safety and quality of food products [14]. Some bacteriocins inhibit growth of closely related microbes, whereas others inhibit a much wider range of microor-ganisms like food-borne pathogens and spoilage microormicroor-ganisms, including

Listeria monocytogenes, Bacillus cereus and Staphylococcus aureus [48].

Bacteriocins are considered to be the most suitable alternatives to chemical preservatives because they are harmless to eukaryotic cells and are readily digested by proteolytic enzymes [49, 50]. Bacteriocins are colorless, odor-less and tasteodor-less – physical properties that further promote their acceptabi-lity for various applications [51]. Moreover, physical stabiacceptabi-lity and non-toxicity are one of the advantages displayed by bacteriocins [52, 53]. Fur-thermore, bacteriocins can exhibit heterogeneous characteristics like resi-stance to wide ranges of pH, stability to different temperatures, resiresi-stance to organic acids, salts and enzymes [54].

Bacteriocins are frequently confused with antibiotics, yet the main differences is that antibiotics are not ribosomally synthesized, they differ-rentiate from antibiotics on the basis mode of action, antimicrobial activity, toxicity and resistance mechanisms [55]. Bacteriocins have also shown therapeutic usage for infectious diseases, prevention of gastrointestinal diseases and maintaining human health [56, 57].

(14)

14

There have been multiple classifications for bacteriocins [58]. They can be classified on the basis of molecular mass, chemical structure, enzymatic and thermal stability, mode of action, antimicrobial activity, the presence of post-translationally modified amino acid residues [59]. Gram-positive bacte-riocins most commonly are devided into three groups based on structure and presence of post-translational modification [60, 61]. Class I and Class II include small (<10 kDa) heat-stable peptides. Class I bacteriocins are modi-fied, while Class II bacteriocins are unmodified. Class III comprises large (>10 kDa) thermos-labile bacteriocins [59, 62, 63]. This proposed classifica-tion scheme for bacteriocins and their structures is presented in Fig. 1.3.1.

(15)

15

Class I bacteriocins – lantibiotics – contain unusual amino acids such as lanthionine and dehydrated amino acids. The term “lantibiotic” was proposed by Schnell et al. in 1988 as an abbreviation for “lanthionine containing antibiotic” after identification of the first lantibiotic structural gene [64]. Class II bacteriocins consist only of unmodified peptides. Moreover, class II bacteriocins are classified into four subclasses – pediocin-like bacteriocins (class IIa), two-peptide bacteriocns (class IIb), cyclic bacteriocins (class IIc) and linear non-pediocin-like bacteriocins (class IId) [65]. The majority of bacteriocins produced by the food related bacteria belong to classes I and II [66]. Examples of class I bacteriocins are nisin A or Z, lacticin 481, lacto-cin S, lactilacto-cin 3147 [67]. Class IIa bacteriolacto-cins include pediolacto-cin-like bacterio-cins such as lactococcin MMFII, class IIb examples of bacteriobacterio-cins are lactococcin G and M, class IIc example of bacteriocins is lactococcin B, class IId include bacteriocins such as lactococcin A and lactococcin 972 [48]. Class III includes bacteriocins such as lysostaphin and helveticin J [68].

LAB can produce more than one bacteriocin [28, 69]. It has been esti-mated that many bacteria produce at least one bacteriocin, which may help them to influence the surrounding population dynamics as it is hypothesized that the production of bacteriocins is a strategy to control competing bacte-ria in the hunt for nutrients and space in an environmental niche [70].

Lacto-coccus spp. such as LactoLacto-coccus garvieae, LactoLacto-coccus lactis subsp. Hord-niae, Lactococcus lactis subsp. cremoris and Lactococcus lactis subsp. Lac-tis produce different types of bacteriocins [28, 71].

Success of food preservation using bacteriocin producing LAB is de-pendent on the ability of the strain used to grow and produce the antimic-robial compound in the food matrix as sometimes in vitro activity of bacte-riocins produced by LAB is not confirmed in situ. For this reason, the effec-tiviness of the application of a bacteriocinogenic LAB strain or its bacterio-cin in a food system for the control of a target bacteria demands careful testing and confirmation [72].

The primary application of bacteriocins has always been in food preser-vation, however antimicrobial resistance to conventional antibiotics presents new opportunities for the examination of bacteriocins’ application in a va-riety of healthcare products where is a need to control undesired and poten-tially resistant microorganisms [38].

The restrictive food legislation of the health regulatory authorities in-cluding FDA and EFSA limits the approval of new bacteriocins as food preservatives. As a consequence, only two bacteriocins (nisin and pediocin) are currently commercially available [73]. Nisin is the only bacteriocin widely used as a food preservative in many countries [74].

(16)

16

Nisin

Most widely known bacteriocin is nisin – lantibiotic with the longest history of safe use in the food industry [75, 76]. Nisin is the most charac-terized and commercially important bacteriocin [73] that was discovered in England by Rogers and Whittier in 1928 in fermented milk cultures [55, 77]. It is also the first bacteriocin, that was isolated from L. lactis [48, 78] by Mattick and Hirsch in 1947 [79] and is the first identified lantibiotic [80]. It is approved as a food additive since 1969 [81], licensed as a food preservative with a number of E234 since 1983 [82, 83] and is recognized to be safe by the Joint Food and Agriculture Organization/World Health Organization (FAO/ WHO) Expert Committee on Food Additives [84]. Nisin is being used as bio-preservative in more than 50 countries [28, 85]. The commercially available form of nisin for use as a food preservative is NisaplinTM_{, with the active} ingredient nisin A (2.5%) and other ingredients such as NaCl and non-fat dry milk [73]. Nisin is allowed for production of ripened and processed cheeses at a maximum concentration of 12.5 mg/kg [86, 87]. In European Union (EU) nisin is authorized as a food additive under Annex II of Regu-lation (EC) 1333/2008 [88] for use in several food categories including clotted cream, mascarpone, ripened and processed cheese and cheese pro-ducts, pasteurized liquid eggs and semolina and tapioca puddings and simi-lar products. Recently, the Panel on Food Additives and Nutrient Sources Added to Food upon request from European Commission provided a scientific opinion that the extension of use of nisin as a food additive in unripened cheese and heat-treated meat products would not be of safety concern in the light of new toxicological data [89].

The structure of nisin was elucidated by Gross and Morell [87]. The structural gene of nisin encodes a 57 amino acids prepeptides from which 23 amino acids form the leader part and the last 34 residues constitute the core peptide [80]. Nisin has different variants including nisin A, Z, F, Z and Q which are produced by L. lactis [28, 90]. Also, nisins U, U2, P and H are produced by some Streptococcus strains [91]. Nisin A is the originally isolated form of nisin [85]. The structure of some nisin variants is presented in Fig. 1.3.2. The differences between these variants are based on the chan-ges in the amino acid chain, that could interfere in their antimicrobial activity [92]. For example, nisin A from nisin Z differ by a single amino acid substituting histidine at position 27 in nisin A and asparagine in nisin Z. These two variants have similar properties but it was reported that nisin Z has better diffusion properties than nisin Z in agar [83]. Molar mass of nisin A is 3,500 Da [55, 93].

(17)

17

Fig. 1.3.2. Structure of some nisin variants [13]

The three lysine residues contributes to nisin’s positive charges that make nisin active against Gram-positive bacteria such as Listeria ans

Staphylococcus as well as the outgrowth of spores of Bacillus and Clostri-dium [55, 94]. The outer membrane of Gram-negative bacteria acts as a

permeability barrier for the cell and prevents nisin from reaching the cyto-plasmic membrane [95]. In the presence of compounds that can destabilize the outer membrane, nisin also inhibits Gram-negative bacteria [96].

Nisin is not toxic to animals and safe for human consumption [97]. About 0.6 mg of nisin are consumed per person per day as part of normal food consumption [98].

Nisin has suitable characteristics for food preservation like high acti-vity, a broad spectrum of antibacterial actiacti-vity, rapid action, high stability against high temperature and acid. Nisin alone is odorless, colorless, taste-less and has a low toxicity [79, 99]. While nisin A has been used as food preservative for several decades all around the world, no resistant bacteria against nisin A have been reported in practical use [13]. However, nisin A use is limited because its greatest antimicrobial activity occurs under acid conditions. In a pH rise from 3 to 7, the nisin A molecule becomes increa-singly vulnerable to heat. The effectiveness of nisin A is also often decree-sed by food-related factors, especially fat or protein, because nisin binds to fat or protein surfaces [100, 101]. Also, nisin production might be affected

(18)

18

by such factors as bacterial strains, growth medium, temperature, aeration, pH, total sugar, nitrogen, phosphorous and buffer concentrations [5, 99].

While nisin A is the best studied bacteriocin produced by LAB, newly isolated nisin producing bacteria or novel nisin variants with different anta-gonistic activity could help to control undesirable bacteria more efficiently [14].

1.4. Sources of bacteriocinogenic LAB isolation

Bacteriocins are produced by many microbial groups [48], but those produced by the lactic acid bacteria are of particular interest to the dairy industry [73].

LAB are widespread in nature and can be found in a variety of natural habitats, ranging from plants to the mammalian oral and gastrointestinal cavities [102, 103]. Also LAB can be localized in manure and wastewater [104]. LAB are usually found in nutrient-rich environments and are able to grow in most raw foods, however requires fermentable carbohydrates, ami-no acids, fatty acids, salts and vitamins for growth [105]. Most commonly bacteriocin producing L. lactis strains are isolated from dairy products like cheese [48, 106, 107] and milk [108], also from fermented foods like fermented vegetables [12] and meat products [72]. However, L. lactis is most widely known for its association with the milk environment and in the production of dairy products. Members of Lactococcus genus that are isolated from raw milk, raw milk cheeses and non-milk environments are collectively called “wild-type” [19].

The autochthonous microbiota of goat milk is also considered as potential source of bacteriocinogenic LAB, therefore is often studied for isolation and identification of strains able to produce different bacteriocins possessing different antimicrobial potential [92, 109, 110].

1.5. Characterization of LAB for food application

Selection of LAB for application in a food industry is a complex pro-cess that involves evaluation of some technological features of LAB strains, favorable and non favorable enzymatic activities and safety evaluation [111]. In dairy industry for cheese production most important character-ristics of L. lactis are the ability to produce acid rapidly, salt tolerance, proteolytic activity, diacetyl production and antibiotic resistance [14].

(19)

19

1.5.1. Safety assessment

Safety assessment with regard to virulence, antibiotic resistance and hemolytic activities remain essential in the selection of LAB for application in food production [14, 111].

Strains, isolated from food can present virulence factors and depending on the type and combination of virulence factors, they become crucial for the strain’s pathogenicity [112]. Even if microorganism is Generally Recog-nised as Safe (GRAS), the determination of potential virulence is required for ensuring safety [113]. Newly isolated strains demands caution due to their possible virulence potential as LAB can carry virulence genes and express them in food products presenting hazards for consumers [109].

Lactococcus spp. is not generally associated to virulence, although can carry

such genes and become a virulence reservoir in a food system, also receive genes from virulent strains [109, 114].

Hemolytic activity is a typical feature of pathogenic bacteria. This harmful effect may only happen if the ingested bacteria ends up in the blood, however, this is an unlikely situation. Nevertheless this test provides an important information about tested strain‘s pathogenicity [115].

1.5.2. Antibiotic resistance

Antibiotic resistance has become a serious public health concern and is drawing the interest all around the world, though antibiotic resistance is not new and is documented since the discovery of penicillin [58]. Antibiotics are widely used in human and veterinary medicine, and have been essential for ensuring human and animal health by being a defense against bacterial infections, but now these bacteria are developing resistance really rapidly. The biggest concern is that the increase in antibiotic resistance is going to grow and the resistance genes will potentially spread to pathogenic bacteria. With the spread of antibiotic resistance in microbial communities, big con-cerns have been raised about the existence of antibiotic resistance in benefi-cial bacterial species which includes LAB [116]. The common use of anti-biotics has caused a significant increase in the number of strains resistant to them, including LAB [31]. LAB, which are also an element of the gastro-intestinal microbiota, are potentially vulnerable to acquired antibiotic resi-stance [31]. The transmission potential of resiresi-stance genes depends on their genetic support as unlike resistance genes carried by plasmids, those carried by chromosomes have a much lower risk of transfer therefore, it is impor-tant to consider the genomic location of an antibiotic resistance gene when testing a strain for antibiotic resistance [115].

(20)

20

European Food Safety Authority (EFSA) requires that bacteria delibera-tely introduced in the food chain (fermented and probiotic foods, animal feeds) should not have antibiotic resistance genes [117].

1.5.3. Probiotic characteristics of LAB

Despite the interest to examine LAB in food as starter cultures or bio-preservatives for their technological properties, there is a growing tendency to evaluate them for probiotic properties [109]. Likewise, LAB are of special interest to the food industry due to the fact that they constitute part of the resident microbiota of many types of food [118]. Probiotics are defined as live microorganisms which, when administered in adequate amounts, provide a health benefit to the host [119, 120]. Products that contain probiotics are available for human nutrition, also as animal feed supplements [121]. For this reason, probiotics have been receiving special attention from farmers, that search for alternatives to the use of traditional antibiotics as growth promoters [122, 123] and from the food industry. This interest is reasonable as numerous studies conducted show that probiotics have increased milk yields and meat production [123, 124] also may have health benefits for humans [122]. Food products containing probiotics, also called functional foods (probiotic foods are the fastest growing area of functional food development) [125, 126], have several beneficial health effects like reduction of serum cholesterol levels, reduction of blood pressure [127, 128], improvement of lactose intolerance [129], stimulation of the growth of beneficial microorganisms and reduction of the amount of pathogens hence improving the intestinal microbial balance of the host and lowering the risk of gastro-intestinal diseases. Therefore isolation of new probiotic strains with health promoting benefits and ability to improve quality of existing food products is of big interest [130, 131]. The recommended dosage of probiotic bacteria that is most effective for the beneficial effect is 106_–109_{viable organisms daily [116, 132], though were} are studies conducted, showing beneficial immunological effects also derived from dead cells [131].

Large group of probiotic microorganisms belongs to the lactic acid bacteria (LAB) as Lactobacillus, Lactococcus, Bifidobacterium [133–136]. The Bifidobacterium genus is included to the LAB group by some of the authors due to the lactic acid production and presence in a similar environ-ment, though Bifidobacterium belongs to the Actinomycetes [137]. Because LAB is generally recognised as safe organisms, they are the most widely used probiotics for food production and medicine [138]. It is known that effectiveness of probiotic strain is species or strain dependent, consequently

(21)

21

it is necessary to evaluate each candidate for safety (isolation from suitable habitats, correct identification and antimicrobial susceptibility), functional (resistance to gastrointestinal environment) and beneficial (antagonism against pathogens) properties, so they could be effectively used [124, 139]. It is necessary to evaluate the presence of potential virulence and resistance factors, such as hemolytic activity [140]. Nowadays there are two most widely used in vitro tests to evaluate resistance to gastrointestinal environ-ment of the potential probiotic strains and these are resistance to gastric acidity and bile salts. These tests are based on both survival and growth studies [137]. Undoubtedly, the in vitro assays are rather different from the in vivo conditions as the human gut food matrix pays the protective role for the bacteria [141]. Nevertheless, the in vitro tests provides important infor-mation and are a helpful tolls for quick screening of the bacteria for pro-biotic activity [137].

Resistance to human gastric conditions is an important criterion for selection of probiotic microorganisms as to colonize the intestine and exert the probiotic effect, the strain first needs to resist the acid pH of a stomach. About 2.5 L of gastric juice at a pH of about 2.0 is secreted daily into the stomach, accordingly causing the destruction of many ingested microorga-nisms, as the most of them are sensitive to pH below 3.0. Usually, food in the stomach remains from 2 to 4 h, though fluids leave the stomach faster than the solids, taking only 20 min [120]. The pH value in human stomach ranges from 1.5 during fasting to 4.5 after a meal, thus it is necessary to use growing absorbance at pH of 3 for preliminary evaluation of probiotic LAB [134].

Bile salts are the main component of bile, which is capable of disrupt-ting the structure of cell membranes, thus being toxic to living cells [120]. Therefore, probiotic strains must survive exposure to bile to arrive alive to the small intestine or colon [134]. About 1 L of bile is secreted into the human digestive tract daily [141]. The relevant physiological concentration of human bile ranges from 0.3 to 0.5% [137]. 0.3 % is the concentration used to evaluate the growth lag time of LAB strains [138].

1.6. Application of L. lactis in the dairy industry

L. lactis strains are the majority of LAB components that are associated

with commercial starter cultures used in the dairy industry for the manu-facture and ripening of cheese of both artisanal and commercial origin, also fermented milks such as buttermilk, yoghurt and sour cream [16, 19, 48, 142]. The dominant role of L. lactis in dairy starter cultures is to produce

(22)

22

lactic acid at adequate rate and contribute to the breakdown of milk proteins during fermentation, thereby significantly contributing to the final product in terms of organoleptic properties and microbial quality [19]. Additionally, adjunct L. lactis cultures or the native microflora in raw milk cheeses can also develop the formation of flavor in dairy products [16]. Besides, the incorporation of bacteriocin producing lactococci in the manufacture of fermented foods provides an attractive and economic alternative to the addition of purified bacteriocins as metabolic compounds produced during fermentation are no longer considered as additives [48].

1.7. Other natural antimicrobial compounds used in the dairy industry

Apart from nisin, that is a natural antimicrobial agent derived from microbial sources, in the dairy industry commonly used preservatives are lysozyme, natamycin and sorbic acid. These preservatives are usually used in cheese manufacturing [86].

A large group of antimicrobial agents of animal origin is represented by antimicrobial peptides including lysozyme. This powerful antimicrobial enzyme is found in egg white, milk and blood. Lysozyme has bacteriolytic role and has been reported to act against food spoilage microorganisms [143]. Lysozyme (E1105) can be added in long-ripened hard cheeses “quan-tum satis”. This preservative is added to prevent the “late gas blowing” that is caused by the fermentation of lactate by butyric acid bacteria, primarily

Clostridium tyrobutyricum [86, 96].

Natamycin is produced by Streptomyces natalensis [67]. Natamycin acts against almost all foodborne yeasts and molds but is inactive on bacteria and viruses. Because natamycin interacts with ergosterol, fungi do not develop resistance [143]. Natamycin (E253) is a preservative added to prevent fungal outgrowth on cheese rind. It is allowed on cheese surface at a maximum level of 1 mg/dm2 _[86].

Sorbic acid or its Ca and K salts (E200-203) are used for antimicrobial preventing of mould, yeast and fungi growth. These preservatives are allowed in cheeses up to 1,000 mg/kg in many kind of non-ripened cheeses, up to 2,000 mg/kg in processed cheeses and “quantum satis” for only surface treatment of cheeses [86].

(23)

23

1.8. Methods used for the detection of bacteriocins

PCR amplification could be carried out to detect the genes coding for bacteriocins. After detection, genetic sequencing of baceriocins genes could be applied as a precise method for confirmation and identification of new bacteriocins or novel nisin variants [144]. As genomic data concerning bac-teriocins increases, bioinformatics analysis should be applied for the identi-fication of bacteriocins or their producing strains [145]. Bacteriocins could also be identified using chromatographic techniques, such as high-perfor-mance liquid chromatography, reverse phase high-perforhigh-perfor-mance liquid chro-matography and others [146]. Bacteriocins could also be detected effectively using mass spectrometry (MS). MS analysis allows not only to detect known bacteriocins, but also to identify novel ones by accurate mass deter-mination [147]. Liquid chromatography-mass spectrometry is considered one of the most selective and sensitive technique for the determination of bacteriocins like nisin and other antimicrobial compounds [87, 146]. Liquid chromategraphy-mass spectrometry enables molecular mass determination of targeted molecules in crude samples simultaneously with removal of impurities [147].

(24)

24

2. MATERIALS AND METHODS

2.1. Investigation venue and study design

The experiments were conducted between 2014 and 2018 at the Lithua-nian University of Health Sciences Veterinary Academy (LSMU VA) De-partment of Food Safety and Quality, Free University of Berlin, DeDe-partment of Veterinary Medicine, Institute of Food Safety and Hygiene, Vytautas Magnus University, Faculty of Natural Sciences, Instrumental Analysis Open Access Centre and Lithuanian University of Health Sciences, Medical Academy, Faculty of Pharmacy, Department of Pharmacognosy, Institute of Pharmaceutical Technologies.

The overall structure of the research is represented in Fig. 2.1.1.

Fig. 2.1.1. Study design

Materials

Raw goat and cow milk samples were collected from local markets and kept refrigerated (4°C) until analysis. Grain samples were collected from local farm and were fermented by traditional fermentation and also fermented wheat and buckwheat drinks were used for isolation of LAB. Fermented drinks were made by soaking grains with water for 12 h then washed and left to ferment with warm water. After 48 h of fermentation the grains were drained and liquid was used as fermented beverage.

(25)

25

Different Lithuanian and EU commercial types of cheese samples including fresh, semi-hard and hard ripened cheese used in chromatography studies were purchased from local supermarket. All the reference cheeses analyzed were declared as preservative-free by manufacturing process protocols. The absence of the investigated preservatives was confirmed by UPLC-MS analysis.

Microorganisms used in the antibacterial activity study following

Listeria monocytogenes ATCC 35152, Staphylococcus aureus ATCC 9144, Escherichia coli ATCC 8739, Pseudomonas aeruginosa NCTC 6750, Bacillus cereus ATCC 11778, Salmonella Typhimurium ATCC 13311, Pseudomonas florescens ATCC 13525, Brochothrix thermosphacta ATCC

11509, Lactobacillus delbruecki ATCC 12315 and Lactococcus lactis ATCC 11454 were obtained from Lithuanian University of Health Sciences Food Safety and Quality Department’s laboratory collection.

Nisin (2.5%), natamycin (96.4%), sorbic acid (99%) and lysozyme (90%) were obtained from Sigma-Aldrich (St. Louis, MO, USA). All sol-vents used in chromatography experiments were LC-MS grade. Methanol was supplied by Sigma-Aldrich (Steinheim, Germany), acetonitrile was supplied by Merck KGaA (Darmstadt, Germany), formic acid and water were supplied by Greyhound Chromatography and allied chemicals (Bio-solve, France).

Standard stock solutions of each preservative analyzed were prepared at 1,000 µg/mL in methanol and aqueous 0.1% formic acid except for nisin. Nisin stock solution was prepared at 25 µg/mL in acetonitrile and 0.1% aqueous formic acid due to its solubility properties [146]. Standard working solutions were prepared at the day of use by diluting each standard stock solution with methanol. Stock and working solutions were stored at 4°C.

2.2. Methods 2.2.1. Isolation and identification of LAB

Isolation of LAB. Cow and goat milk, fermented wheat and buckwheat samples were selected as possible Lactococcus lactis sources and were subjected to ten-fold dilution series using maximum recovery diluent (Oxoid, Basingstoke, UK). Selected dilutions were spread in duplicate on plate count agar (PCA) (Liofilchem, Roseto degli Abruzzi, Italy) supple-mented with 10% sterile skim milk (Oxoid), 20 mg/L bromcresol purple (Sigma Aldrich, St. Louis, U.S.), 40 mg/L nalidixic acid, 10 mg/L nata-mycin (both Sigma Aldrich) and incubated at 30°C for 48 h under aerobic conditions [148]. After incubation, representative colonies from each sample

(26)

26

were selected and purified on M17 agar plates (Merck, Darmstadt, Germa-ny) by several transfers. Incubation was done for 48 h at 37°C. Pure colo-nies were selected and subjected to Gram staining and catalase tests. LAB characteristic colonies (Gram positive, catalase negative) were stored at -80°C in M17 broth (Merck) in the presence of 30% glycerol until further analysis. Before conducting any experiments, strains were revitalized in MRS broth (Biolife, Milano, Italy) by growing for 18 h at 30°C.

DNA extraction. DNA extraction was performed using GenEluteBacterial Genomic DNA kit (Sigma-Aldrich) and following the manufacturer’s instruc-tions for gram positive bacteria.

Identification of L. lactis and nisin encoding genes. PCR amplifi-cation was carried out for species verifiamplifi-cation of L. lactis and to detect the presence of nisin genes. The primers used to identify L. lactis (G1, L1) and nisin genes (NISL, NISR) are summarized in Table 2.2.1.1. PCR conditions were the same as described previous by Moschetti and others [149].

PCR products were separated in 2% agarose gel using 100 bp DNA ladder (Thermo Fisher Scientific, Vilnius, Lithuania) as the molecular weight standard and visualized by ethidium bromide staining (Sigma-Aldrich). A 380 bp fragment verified L. lactis and 320 bp fragment repre-sented nisin structural gene (Fig. 2.2.1.1).

Fig. 2.2.1.1. Ethidium bromide-stained 2% agarose gel

electrophoresis of PCR products

M – DNA ladder from 100 bp to 1000 bp, K – positive control (L. lactis ATCC 11454), 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16 – L. lactis nis-, 15 – L. lactis nis+ (nisin gene fragment 320 bp).

Lactoccocins A, B and M identification. For identification of lacto-coccin A, B or M genes in L. lactis strains, primers LactABM-F, LactA-R, LactB-R, LactM-R (Table 2.2.1.1) and PCR conditions described by Pisano et al. [144] were used. Amplification products were visualized on ethidium bromide-stained (Sigma-Aldrich) 1.8% agarose gel using 100 bp DNA ladder (Thermo Fisher Scientific) as the molecular weight standard.

(27)

27

Sequencing of nisin positive isolates. From nis+ isolates the nisin gene was amplified by PCR using primers NisP5 and NisP3 (Table 2.2.1.2) and conditions described by Pisano et al. [144]. PCR products were subse-quently purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific) and sequenced. To determine nisin variants, the sequences of PCR products for the nisin gene were in silico translated to amino acid se-quences using BioNumerics 7.1 (Applied Maths, Sint-Maart, Belgium) and compared with the sequences of other nisin variants from GeneBank data-base (http://www.ncbi.nlm.nih.gov/).

Table 2.2.1.2. Primers used in this study for L. lactis and certain

bacterio-cins identification

Primer 5́-Seuence-3́ Size _(bp) Target Reference

G1 GAAGTCGTAACAAGG 380 Lactococcus _lactis Moschetti et al. [149] L1 CAAGGCATCCACCGT NISL CGAGCATAATAAACGGC 320 Nisin NISR GGATAGTATCCATGTCTGAAC NisP5 GGTTTGGTATCTGTTTCGAAG 598 Pisano et al. [144] NisP3 TCTTTCCCATTAACTTGTACTGTG LactABM-F GAAGAGGGCAATCAGTAGAG Lactoccocins A, B and M LactA-R GTGTTCTATTTATAGCTAATG 896 LactB-R CCAGGATTTTCTTGATTTACTTC 545 LactM-R GTGTACTGGTCTAGCATAAG 1100

2.2.2. Methods of evaluating technological characteristics of nisin producing L. lactis strains

Antibacterial activity of nisin positive L. lactis strains. Antibacterial activity of nisin producing L. lactis strains was evaluated using agar spot tests. Of each revitalized strain, 3 µl were spotted on the surface of MRS agar (Biolife) and incubated anaerobically in a jar with Anaerogen (Oxoid) for the generation of anaerobic conditions for 24 h at 30°C. Plates were then overlaid with 7 mL soft agar (0.7%) inoculated with 100 µl of the indicator strain and incubated for 24 h at optimal growth temperature and atmosphere for the indicator strain. Indicator strains used in the study are presented in Table 2.2.2.1. Antibacterial activity was evaluated by measuring clear inhibition zone diameter around the colony of the tested strain.

(28)

28

Table 2.2.2.1. Food spoilage or pathogenic bacteria used in the study

Strains Growth _media _{temperature (°C)}Incubation Incubation _conditions

Listeria monocytogenes ATCC 35152 BHI 37 Aerobic

Staphylococcus aureus ATCC 9144 BHI 37 Aerobic

Escherichia coli ATCC 8739 BHI 37 Aerobic

Pseudomonas aeruginosa NCTC 6750 BHI 37 Aerobic

Bacillus cereus ATCC 11778 BHI 30 Aerobic

Salmonella Typhimurium ATCC 13311 BHI 37 Aerobic

Pseudomonas florescens ATCC 13525 BHI 30 Aerobic

Brochotix thermosphacta ATCC 11509 BHI 25 Aerobic

Lactobacillus delbruecki1_{ATCC 12315} _MRS ₃₇ _Aerobic

*ATCC – American Type Culture Collection; NCTC – National Collection of Type Cultu-res, a Culture Collection of Public Health England; MRS – De Man Rogosa Sharpe medium; BHI – Brain Heart Infusion medium.

1_{– Non-pathogenic Lactobacillus delbruecki ATCC 12315 strain was used to test the}

antimicrobial effect of bacteriocins and combination of other antimicrobial compounds produced like organic acid, hydrogen peroxide and others.

Antibacterial activity of cell-free supernatant of nisin producing LAB strains. To test antibacterial activity of nisin producing LAB strain cell-free supernatants (CFS) against food-borne pathogenic and spoilage bacteria, the spot-on-the-lawn method was used. LAB isolates were revitali-zed and the cells were harvested by centrifugation at 14,000 rpm for 10 min and the pH of the CFS was adjusted to 6.0 with 1 M NaOH and heat treated for 10 min at 80°C. 10 µl of CFS was spotted on the surface of LB agar (Liofilchem) previously inoculated with the indicator strain. Plates were incubated at 30°C for 24 h and the presence of an inhibition zone around the spotted CFS indicated a positive result.

Extracellular proteolytic activity. Skim milk agar was used to test extracellular proteolytic activity of the strains. 2 µl of revitalized strains were spotted on the surface of skim milk agar composed of 20% sterile skim milk and 80% water agar. After incubation at 30°C for 4 days, clear zones around the colonies indicated proteolytic activity.

Caseinolytic and lipolytic activities. Caseinolytic and lipolytic activi-ties were determined according to the methods of Pisano et al. [144]. To evaluate caseinolytic activity, plates containing PCA (Liofilchem) supple-mented with 10% sterile reconstituted skim milk (Oxoid) were used. After 18 h incubation at 30°C in aerobic conditions, clear zones around the colony indicated caseinolytic activity. Lipolytic activity was tested on M17 agar

(29)

29

(Merck) supplemented with 0.01% calcium chloride and 0.1% Tween 80 (Liofilchem). Lipolytic colonies were surrounded with cloudy zones.

Diacetyl production. 10 mL of UHT milk was inoculated with 1% (v/v) of revitalized strains and incubated at 30°C for 24 h. 1 mL of each cell suspension was mixed with 0.5 mL of 1% (v/v) α-naphtol (Sigma-Aldrich) and 16% (w/v) KOH and incubated at 30°C for 10 min. Diacetyl production was indicated by the formation of a red ring at the top of the tubes [47].

Acidifying activity. For acidifying activity evaluation UHT low-fat milk (1.5%) was inoculated with 1% of revitalized strains and pH values were measured after 6 h and 24 h. Non-inoculated milk was used as control.

Growth in different salt concentrations. Strains were grown in M17 broth supplemented with 4% and 6.5% NaCl. Salt tolerance was evaluated after 48 h incubation at 30°C and evaluated by visual observation.

2.2.3. Methods of evaluating safety aspects of nisin producing

Lactococcus lactis strains

Antibiotic resistance evaluation. Antibiotic susceptibility was evalua-ted using MIC Test Strips (Liofilchem) and following the manufacturer’s instructions. The antibiotics tested were chloramphenicol, clindamycin, strep-tomycin, gentamicin, tetracycline, erythromycin and ampicillin. Minimum Inhibitory Concentrations (MIC) were determined from the MIC reading scale and expressed in µg/mL. Breakpoints according to EFSA recommend-dations were used as interpretative criteria.

Enzymatic activity evaluation. Enzymatic activity was evaluated using the API ZYM kit (bioMerieux, Marcy-l’Étoile, France). The API ZYM strips were inoculated, incubated, and interpreted according to the manufacturer’s instructions. Changes of color were scored from 0 to 5. Color reaction grade 0 was interpreted to correspond to a negative reaction, grades 1 and 2 corresponded to a weak reaction (5 to <20 nmol) and grades 3, 4, and 5 corresponded to a strong reaction (>20 nmol).

Hemolytic activity. Hemolytic activity was evaluated using plates con-taining sheep blood agar. After incubation for 48 h at 30°C hemolytic activity was recorded as β-hemolysis, α-hemolysis and γ-hemolysis repre-sented as clear zones, green zones or halos around the colonies respectively [150].

Characterization of virulence and antibiotic resistance factors of isolated L. lactis strains. Nisin producing L. lactis strains were tested for the presence of virulence genes esp (enterococcal surface protein), gelE (gelatinase), asa1 (aggregation substance), cylA (cytolisin), efaA (endocar-ditis antigen), ace (adhesion of collagen), antibiotic resistance genes vanA

(30)

30

and vanB (both related to vancomycin resistance), and genes for amino acid decarboxylases hdc (histidine decarboxylase), using primers and PCR con-ditions as previously described by Perin and others [109]. Amplification products were visualized under ultraviolet light on ethidium bromide-stai-ned (Sigma-Aldrich) 1.5% agarose gel using 100 bp DNA lader (Thermo Fisher Scientific) as the molecular weight standard.

2.2.4. Assessment of probiotic properties of L. lactis strains

Acid and bile salt resistance. Tested strains were incubated in MRS broth at 30°C for 18 h. 1 mL of culture was transferred into 9 mL of MRS broth containing 0.3% bile salt and incubated at 30°C for bile salt tolerance assay. The number of viable bacteria was counted on MRS agar plates after 0 h and 24 h of incubation periods. For acid tolerance assay 1 mL of culture was transferred into 9 mL of PBS adjusted to pH 2.5 with 5 M HCl and incubated at 30°C. The number of viable bacteria was counted on MRS agar plates after 0 h and 3 h of incubation periods [151].

2.2.5. Application of nisin producing L. lactis strains in cheese production

Manufacturing of fresh cheese inoculated with L. monocytogenes. Fresh cheeses were experimantally prepared with pasteurised cow‘s milk using strains 56, 59 and 63 respectively. Three individual batches of each cheese were prepared. After warming milk to 30°C, calcium chloride (0.2 g/L, Merck) was added to the milk. Milk was distributed in three 3.0 L vats and individually inoculated with 2% L. monocytogenes suspension for a final concentration of 104_–106 _{cfu/mL. 2% of each LAB culture was then} added to the milk and incubated for 2 h. After incubation rennet (Hansen Sticks, pure chymosin (EC 3.4.23.4), 1400 IMCU/stick (≥ 1.300 IMCU/S), 0.02 g/L) was added to the milk and incubated at 30°C for 6 h. Control cheese from pasteurised milk was made without any LAB culture, just with

L. monocytogenes inoculum. Once the coagulum was sufficiently firm, it

was cut into 1–2 cm cubes and agitated slowly for 30 min at 21°C. The curd was transferred to synthetic cheese bags and maintained at 21°C for 1 h for dripping. Fresh cheeses were unmoulded (emptied from the bags), packed into plastic bags, and stored at 4°C for 0, 6, 24, 48, 72 h (3 days) and 168 h (7 days).

Manufacturing of fresh cheese for quality determination. Fresh cheeses were experimentally prepared from raw and pasteurised cow’s milk as described previously using strains 56, 59 and 63 respectively. Control cheeses from raw and pasteurised milk were made with L. lactis ATCC 11454. Fresh

(31)

31

cheeses were unmoulded (emptied from the bags), packed into plastic bags, and stored at 4°C for 0, 24, 48, 72 h (3 days) and 96 h (4 days).

2.2.6. Analysis of manufactured experimental cheeses for safety and quality improvement studies

Analysis of milk before cheese preparation. Before cheese prepara-tion, milk was tested for presence of Listeria monocytogenes by plating on Agar Listeria Ottavany & Agosti (Biolife, Italy) with supplements and incubated at 37°C for 48 h, Staphylococcus aureus were enumerated on Baird Parker Agar Base (Biolife, Milano, Italy) at 37°C for 48 h under aerobic conditions.

Analysis of manufactured experimental cheese. The measurements of characteristics of cheese samples, such as pH, titratable acidity, LAB counts,

Listeria monocytogenes and Staphylococcus aureus counts and lactic acid

concentration were replicated three times in the beginning of storage (0 h) and after 24, 48, 72 and 96 h of storage at 4°C. For microbiological analysis, cheese samples were diluted (1:10, w/v) with buffered peptone water (Liofilchem, Italy) and mixed. The mixture was serially diluted and the quantification of microbiological counts was carried out using the pour plate technique. For enumeration of Listeria monocytogenes and Staphylococcus

aureus the same procedures and media were used as for milk analysis before

cheese preparation. LAB counts were enumerated on MRS agar (Biolife, Milano, Italy) and incubated under anaerobic conditions at 30°C for 72 h.

Cheese pH was measured directly with a pH meter (Sartorius Professio-nal meter for pH Measurement, Germany). Titratable acidity was determi-ned according to ISO/TS 11869:2012 [152]. Lactic acid concentrations (L+/D- lactates) were determined using Megazyme assay Kit (Megazyme International Ireland, Bray, Ireland) according to manufacturer’s instruct-tions.

Analysis of volatile compounds by gas chromatography-mass spec-trometry method. The analysis of volatiles of prepared fresh cheese samples was carried out using gas chromatography-mass spectrometry (GC-MS) system (Shimadzu, Tokyo, Japan), consisting of GC2010 gas chro-matograph and QP2010 single quadrupole mass spectrometer, and CTC Combi-Pal autosampler. Volatiles were extracted using solid phase micro extraction (SPME) device with Stableflex(TM)_{(pink colour) 65 µm layer} PDMS/DVB fiber (Supelco, USA). During extraction, 1 g of fresh cheese was incubated in 10 mL gas tight bottles with septum at 40°C for 10 minu-tes. Exposition of fiber was carried out at 40°C for 20 minuminu-tes. Thermal

(32)

32

desorption followed afterwards in the injection port of gas chromatograph at 280°C for 1 min.

Electron ionization of the compounds at 70 eV energy was used for their mass-spectrometric detection. For separation RTX-5MS (Restek, USA) column with dimensions of 30 m of length, film thickness 0.25 µm, inner diameter 0.25 mm was used. Injector temperature was set at 280°C. Injec-tion was performed using split mode 1:10. Ion source temperature was set at 220°C, and interface temperature was 260°C. Temperature gradient was set as follows: starting from 50°C and rising to 200°C at 5°C /min rate, and then up to 280°C at 20°C /min rate and then maintained at that temperature for 2 minutes.

The carrier gas helium (99.999% detector purity, AGA, Lithuania) pressure of 15 psi (10.3 kPa) at the column head was used, the column flow was of 1.5 mL/min. The compounds were identified according to the mass spectra library v.8.0 (NIST, USA). Positive identification was assumed when good matches (90% and above) of mass spectra were achieved.

The analysis for volatiles composition using solid phase micro extrac-tion – gas chromatography mass spectrometry was run three times on each sample of tested fresh cheese.

Sensory analysis. To evaluate the influence of nisin Z producing

L. lactis strains on the final sensorial characteristics of fresh cheese and

pasteurised fresh cheese, different cheese productions were subjected to a panel evaluation. Sensory analysis was performed on fresh (1 day old) cheese by a non-trained panel of tasters comprising 10 to 12 participants from both genders, with ages ranging from 19 to 50 years old. The attributes judged were acidity, flavour intensity, color intensity, bitterness and crumbliness. Cheese scoring was conducted on a one to ten scale (in which 1 stands for absence and 10 for presence at a strong level). Prior to assessment, cheese samples were coded with 3-digit randomized numbers and served at room temperature. Panelists were exposed to each sample in random order and were asked to assess the specific attributes. Two evaluation sessions were performed.

2.2.7. UPLC-ESI-MS analysis of nisin, natamycin, sorbic acid and lysozyme in cheese samples

Method of extraction for the preservatives studied. For extraction of nisin, natamycin, sorbic acid and lysozyme method previously described by Molognoni and others [146] was used. Briefly, 2.00±0.1 g of cheese sample was weighed into 50 mL polypropylene tube. 10 mL of formic acid 0.1% in water:methanol (1:9, v/v) was added to the tube and the suspension was

(33)

33

homogenized with a T18 basic Ultra Turrax (IKA, Staufen, Germany). The suspension was then mildly shaken on an orbital shaker for 20 min and then centrifuged at 3.488 g for 10 min at 4°C. The supernatant was transferred to another 15 mL polypropylene tube and kept at -18°C for 1 h. Centrifugation was then performed again at 3.488 g for 10 min at 4°C. Eventually, an aliquot of 200 µl of extract was diluted in 800 µl initial mobile phase and transferred to 1.5 mL polypropylene tube, centrifuged in centrifuge at 17.530 g for 10 min. The extract was transferred to an autosampler vial and then injected onto the LC-MS system.

UPLC-ESI-MS conditions. Nisin, natamycin, sorbic acid and lizocyme in cheese samples were separated using an Acquity H-class UPLC system (Waters, Milford, USA) equipped with a Xevo triple quadrupole tandem mass spectrometer (Waters, Milford, USA). An electrospray ionization (ESI) source was used to obtain MS and MS/MS data. An Acquity BEH C18 column (50×2.1 mm, 1.7 µm) (Waters, Milford, USA) was used for analysis. The column temperature was maintained at 40°C. Gradient elution was performed with a mobile phase consisting of 0.1% water solution of formic acid (solvent A) and acetonitrile (solvent B), with the flow rate set to 1 mL/min. A linear gradient profile was applied with the following propor-tions of solvent A: initial – 95%, 1.30 min – 55%, 2 min – 50%, 2.20 min – 0%, 3 min – 0%, 3.10 min – 95%, 4 min – 95%. Positive electrospray ionization (ESI+_{) was applied with the following settings: capillary voltage –} 3 kV, source temperature – 149°C, desolvation temperature – 500°C, desolvation gas flow – 1000 L/h, cone gas flow – 1 L/h.

Method validation. For each analyte, linearity was evaluated by analy-zing solutions at increasing concentration of the analytes. A standard cali-bration line was constructed by analyzing mix solutions at seven concentra-tion levels in the ranges of 0–25 µg/mL. Also, the validaconcentra-tion of method was performed for each analyte using three types of cheese as matrices. Linearity was evaluated using three replicates per level, in three different days. The acceptance criterion was that the average regression coefficient (R2_{) was} greater than 0.99.

The recovery and precision were also determined. Repeatability was evaluated in terms of intra-day and inter-day.

Matrix effect was evaluated by constructing three types of calibration curves. First curve type, called solvent, was prepared by diluting the stan-dard solution in the mobile phase initial composition. Second type of curve, called matrix matched, was prepared by fortifying blank sample (before extraction) with the determined amount of standard solution, which were extracted and analyzed. Third type of curve, called matrix extract, was

(34)

34

prepared by adding the standard solution to extracts of blank samples after all extraction procedures.

2.2.8. Statistical analysis

All the experiments where needed were performed in triplicate. Error bars on the graphs shows the standard deviation. The statistical analyses were performed using Microsoft Office Excel 2010, SPSS 22 software. In order to evaluate the influence of different factors and their interaction on the final parameters, the data were subjected to the analysis of variance (ANOVA).

CHARACTERIZATION OF BACTERIOCIN PRODUCING LACTOCOCCUS LACTIS AND THEIR APPLICATION FOR DAIRY PRODUCTS SAFETY IMPROVEMENT

Kristina Kondrotienė