Chapter 2:
Materials and Methods
2.1 DNA constructs
pCS2+-GFP (a kind gift of Dr. Federico Cremisi): The cDNA encoding the green fluorescent protein was cloned into EcoRI/HincII sites of pCS2+ plasmid.
pBluescript (-/+)-Hermes: The cDNA encoding the Hermes protein was cloned into this plasmid. To transcribe the RNA antisense we used the T7 polymerase after enzymatic restriction with BamHI (REF).
pBLuescript (-/+)-Xnot2: Xnot2 cDNA was cloned into this plasmid in order to obtain antisense RNA to use for the in situ hybridization experiments. To transcribe we used the T7 polymerase after enzymatic restriction with EcoRI (REF).
pBluescriptt (-/+)-Xotx5b: This plasmid contains a 1600 bp insert corresponding to Xotx5b cDNA. It was cloned into NotI/EcorI sites of pBluescript (-/+) plasmid (REF). pGEM3-Xrx1: The cDNA encoding the homeodomain containing protein Xrx1 was cloned into EcoRI site of pGEM3 plasmid. To transcribe the antisense RNA, it is necessary to use the T7 Polymerase after enzymatic restriction with BamHI (REF). pBluescript (-/+)- Tph (a kind gift of Dr. Carla Green): The cDNA encoding the tryptophane hydroxilase enzyme was cloned into EcoRI/XhoI sites of pBluescript (-/+) plasmid. To transcribe the Tph antisense mRNA we used the T7 polymerase (REF). pBluescript (-/+)-Xbsx: Xbsx cDNA cloned into this plasmid was used to hybridization experiments. To transcribe, we used the T3 polymerase after enzymatic restriction with HindIII.
pCS2+-Xbsx: This plasmid allows to perform over-expression assays in embryos. To transcribe, we used the SP6 polymerase after enzymatic restriction with XhoI.
pCS2+MT: this vector is used to produce fusion proteins and contains 6 copies of Myc epitope recognised by monoclonal antibody 9E10. Myc-tag was cloned into pCS2+ vector between sites ClaI and EcoRI.
pCS2+GR: this vector is used to produce fusion proteins and contains the Glucocorticoid receptor LBD (approximately 800bp) cloned into pCS2+ vector between sites BamHI and XhoI.
Wild type CS2-XbsxMT: This construct was generated for the present work by in frame PCR cloning of fragments encoding wild type “Morpholino against Xbsx (MoXbsx)” target sequence (5’gatatttgttctactctggacaatg 3’) plus Xbsx full coding sequence into the pCS+MT vector
Mutated CS2-XbsxMT: This construct was generated for the present work by in frame PCR cloning of fragments encoding mutated “Morpholino against Xbsx (MoXbsx)” target sequence (that contains five single mutations with respect the wild type target sequence: 5’gatatAtgttAtactGtggTcCatg 3’) plus Xbsx full coding sequence into the pCS2+MT vector.
pCS2+GR-Xbsx: This construct was generated for the present work. The cDNA encoding for the Xbsx full coding sequence was cloned into pCS2+ GR plasmid.
2.2 Xenopus laevis embryos
In order to obtain embryos, Xenopus females were pre-injected with 100 units of pregnant mare serum gonadotrophin (Folligon, Intervet) 4-11 days prior to egg collection, and with 800-1000 units of human chorionic gonadotrophin (Gonasi HP 5000, Serono) the night before collection.
The next day, eggs are obtained by gently squeezing the frogs and then fertilized with testis homogenates. The embryos are cultured in 0.1X MMR. After half an hour from fertilization, jelly coats are removed keeping the embryos for several minutes in dejelling solution. Embryos were staged according to Nieuwkoop and Faber (Nieuwkoop and Faber, 1967). Moreover the, embryos were kept to grow in cyclic light conditions (12 hours light:12 hours dark,) from the fertilization to the right embryonic stage using a cool daylight (PHILIPS 20W, 230-240V).
For whole-mount in situ hybridization procedure, staged embryos were fixed in MEMFA for 1 hour at room temperature, gradually dehydrated and stored in ethanol at -20 °C. On the contrary, for in situ hybridization procedure on sections, embryos were fixed over night in 4% paraformaldehyde at 4C°, dehydrated in 20% Sucrose (Sigma) for 3-4 hours at room temperature and included in OCT Tissue-Teck (Sakura) and stored at -80C°.
2.3 Brain dissection
Embryos at later stages of development (stage 46-stage 49) were fixed in MEMFA 1X for 30 minutes at room temperature. Following, brains were dissected in PBS 1X using Dumond n° 5 tweezers, post-fixed in MEMFA 1X for 30 minutes at room temperature and finally stored in ETOH 100% at -20 C°.
2.4 Transformation of Competent E. coli
To obtain a large amount of plasmid DNA we added the DNA to the competent cells (E. coli, DH5) basically following protocols provided by the “ Molecular cloning” manual (Sambrook J.).
2.5 Purification of plasmid DNA
Plasmid DNA was extracted from bacterial cells (E. coli, DH5) by alkaline lysis and purified by chromatography over Nucleobond columns (Macherey-Nagel). The plasmids were linearized and used as templates for antisense probe or capped mRNA transcription.
2.6 Capped mRNA in vitro synthesis
The capped mRNA were obtained using the mMessage mMachineTM Sp6 kit (AMBION), following the instructions provided by the manufacturer. After DNAse digestion to remove template DNA, the RNAs were purified in phenol-chloroform and ethanol precipitated. The concentration of the RNA was estimated by agarose gel electrophoresis and spectrophotometry. Aliquots were then stored at -80 °C.
2.7 Antisense labelled probes synthesis
Standard RNA synthesis from linearized plasmids using Sp6, T7 or T3 RNA polymerases were carried out incorporating a digoxigenin or fluorescein conjugated ribonucleotide. In particular, transcription reactions were carried out in the presence of 1mM each of ATP, CTP and GTP, 350 M UTP and 650 M DIG-11 UTP or Fluo-12 UTP for 2 hrs at 37 °C. After DNAase digestion to remove template DNA, the RNAs were purified in phenol-chloroform and ethanol precipitated. The concentration of the RNA was estimated by agarose gel electrophoresis and spectrophotometry.
2.8. Whole-mount in situ hybridization
By means of this technique, it is possible to detect gene expression domains onto the whole embryo. Niehrs’ protocol was preferred because it is more sensitive than others
and gives little or no background. Staged embryos were fixed in MEMFA for 1 hour at room temperature, gradually dehydrated and stored in ethanol at -20 °C. On the first day of the whole mount protocol, the embryos were gradually rehydrated in PTw (PBS containing 0,1% Tween-20), treated with 10g/ml Proteinase K for 5’ and refixed in 4% paraformaldehyde for 20’. After washing in PTw, the embryos were prehybridased for at least two hours in hybridisation mix at 60-65°C. Then, embryos were incubated overnight in probe mix (50 ng of antisense labelled RNA probe diluted in 600 µl of hybridisation mix was the working concentration).
The next day, the embryos were washed at growing stringency to eliminate the unbound probe which may lead to background. After recovering the probe (it can be recycled over time), the embryos were washed twice for 30’ in SSC 2X, CHAPS 0,1 % at 37 °C and then twice for 30’ in SSC 0,2X, CHAPS 0,1 % at 60 C°. After two washes, 10’ each, in TBSTX (TBS containing 0,1% Triton-X 100) the embryos were incubated for two hrs at 4 °C in blocking solution; in the meantime, also the antibody (diluted in blocking solution; 1:2500 anti-DIG or 1:10000 anti-fluo) was incubating at 4°C on a rocker. After this time, the embryos were incubated in antibody solution for four hours at room temperature or overnight at 4 °C.
The unbound antibody must be removed with 5 washes in TBSTX. One should be done overnight at 4 °C, the others are 1 hr each at room temperature.
To reveal the probe, the embryos were washed twice for 10’ in Alkaline Phosphatase Buffer (APB), pH 9.5 supplemented with 2mM Levamisole (SIGMA), an inhibitor of endogenous phosphatases. For the chromogenic reaction, embryos were incubated in BM-Purle AP substrate (Roche) until the staining reached the desired intensity (from some hours to several days, depending on the “strength” of the probe and the expression levels of the gene under analysis).
2.9 Bleaching of embryos
This protocol allows to clear pigmented embryos. Specifically the pigmentation can be reduced by exposing dehydrated embryos to a strong light source in “bleaching solution” until adequately depigmented. To stop the reaction, the embryos are transfered back in Ethanol 100% and stored at -20C°.
2.10 In situ hybridisation on sections
Embryos were cryostat-sectioned to be further processed for in situ hybridisation. Cryostat sections were thawn and dried at room temperature. In situ hybridisation was performed as follows. On the first day, sections were incubated overnight in probe mix (1g/ml hybridisation mix) at 65 °C in a humified chamber (50% formamide, 1X salts). The next day, sections were washed 30’ for 3 times at increasing stringency in washing solution to eliminate the unbound probe which may lead to background. After two washes, 30’ each, in MABT, the sections were incubated for two hrs at RT in blocking solution. After this time, they can be incubated in antibody solution overnight at RT. The unbound antibody must be removed with 5 washes, 30’ each, in MABT. To reveal the hybridized probe, sections were washed twice for 10’ in Alkaline Phosphatase Buffer (APB), pH 9.5 supplemented with 2mM Levamisole (SIGMA), an inhibitor of endogenous phosphatases. For the chromogenic reaction, sections are incubated in NBT-BCIP AP substrate (Roche), whereas for the fluorescence reaction, sections are incubated in FAST-RED substrate (Roche), in both cases until the staining reaches the desired intensity.
2.11 Immunostaining
By means of this technique, it is possible to detect protein localization onto the embryo cryostat sections, previously thawn and dried at room temperature.
It is necessary to block unoccupied protein binding sites on tissue by placing slides in Blocking Buffer. Incubate at room temperature for 1hours. Afterwards, pour off the blocking solution and add 150 µl per slide of 1° antibody, diluted according to manufacturer's recommendations in Diluent Buffer. Incubate at room temperature for 1-2 hours or over-night at 4 C°. To identify pineal photoreceptors an anti-RECOVERIN antibody (CHEMICON INTERNATIONAL) was used, with a final work dilution of 1:100.
After several washes to discard the unbound 1° antibody, the slides were incubated with 150 µL of 2° antibody diluted according to manufacturer's instructions in Diluent Buffer. Incubate at room temperature for 1 hour.
Finally, slides are washed two or three times to discard the unbound 2°antibody and stained with 15 mg/ml Hoechst solution for 5 minutes at room temperature, to visualize nuclei. After three final washes, sections were mounted in Aqua Polymount .
2.12 BrdU experiments
Bromodeoxyuridine (BrdU) is an analogous of the nucleotide deoxy-thymidine that can be incorporated into the DNA during S-phase of mitosis, therefore marking proliferating cells. Embryos were injected with BrdU (Roche) in the gut, fixed 2 hour later and cryostat sectioned. Following in situ hybridization reaction, sections were stained for BrdU. To do this, sections were washed with 2N HCl for 45 minutes then neutralized with several PBST washes. The anti-BrdU antibody (Molecular Probes) was added at 1:500 dilution and incubated at 4C° over/night. After three changes of PBST, Cy2 goat anti-mouse (Oregon green, Molecular Probes) secondary antibody was added at 1:500 dilution and incubated for 1 hour at 37°C. The samples were washed three times with PBST and stained with 15 mg/ml Hoechst solution for 5 minutes at room temperature, to visualize nuclei. After three final washes in PBST, sections were mounted in Aqua Polymount .
2.13 Microinjection of in vitro transcribed mRNA
Constructs were injected into the animal region of 2-cell and 4-cell stage embryos, using a Drummond ‘Nanoject’ apparatus. Embryos were injected in 0.1X MMR and 4% Ficoll-400 (Sigma), and cultured overnight at 14°C in the same solution.
2.14 Western blotting
Protein samples were loaded onto a 12% polyacrylamide gel for size separation. Subsequently, proteins were transferred to Immobilon-P Tranfer membrane (Millipore) by electroblotting for 1-2 hours.
Blots were blocked for 1 hour using 5% nonfat dry milk in TBS-T [10 mM Tris/HCl, pH 8.0; 150 mM NaCl; 0.05% (v/v) Tween-20 (Sigma)].
Monoclonal primary MYC antibody (Sigma) (dilution 1:500) and secondary anti-mouse IgG (peroxidase conjugate) were used to detect MYC-tagged proteins.
Filters were incubated for 1 hour at room temperature for each antibody, and then washed three times with TBS-T to remove excess antibody. The SuperSignal West Pico Chemiluminescent Substrate (Pierce) was used to visualize immunoreactive bands by exposure to Amersham Hyperfilm.
2.15 Tunel assay: Peroxidase Staining of Tissue Cryosections
The TUNEL method identifies apoptotic cells in situ by using terminal deoxynucleotidyl transferase (TdT) to transfer biotin-dUTP to the strand breaks of cleaved DNA. The biotin-labelled cleavage sites are then detected by reaction with HRP conjugated streptavidin and visualized by DAB showing brown colour. The “ApopTag Peroxidase In Situ Apoptosis Detection Kit” (Chemicon) detects apoptotic cells in situ by the TUNEL method. We performed this assay according to the manufacterer’protocol on tissue cryosections.
2.16. RNA extraction and RT-PCR analysis
10ng of each DNA plasmid was used for each PCR reaction. Primers used were as follows:
ODC primers were from Bouwmeester et al., (1996). PCR conditions were as described by Lupo et al., 2002. wild type CS2-XbsxMT cgGGATCCGATATTTGTTCTACTCTG GACAATGAATTTAAATTTTACTTCC CCTGG (forward cgGGATCCTAGCAAATGCTGCGATGGACAA (reverse) mutated CS2-XbsxMT cgGGATCCGATATATGTTATACTGTG GTCCATGAATTTAAATTTTACTTCCC CTGG (forward) cgGGATCCTAGCAAATGCTGCGATGGACAA (reverse) GRXbsx gcAGATATCATGAATTTAAATTTT ACTTCCCCTGGG (forward) GTCCTCGAGCTATAGCAAATGCTGCG (reverse)
PCR conditions used in this study were as follows:
1) PCR condition for “wt Xbsx MT” and “mutated Xbsx MT":
98 °C x 30” 94°C x 20” 60°C x 20” 68°C x 2’ 94°C x 20” 67°C x 20” 68°C x 2’ 68°C x 10’ 2) PCR condition for “GRXbsx” 98 °C x 30” 94°C x 20” 70°C x 20” 68°C x 2’ 94°C x 20” 73°C x 20” 68°C x 2’ 68°C x 10’
The wild-type and mutated Xbsx forward and reverse primer contain an additional BamHI site. Thus, the resulting PCR fragment was BamHI digested and cloned into pCS2+MT linearized with the same enzyme, thereby restoring the complete opening reading frame (ORF). Finally, The GRBsx forward primer contains a EcoRV site whereas its reverse primer contains an XhoI site. After incubation of the PCR fragment with these two enzymes, they were cloned into into pCS2GR linearized with EcoRV and XhoI, thereby restoring the ORF.
Appendix:
Solutions: 10X MMR: 10M NaCl 200mM KCl 100mM MgSO4 200 mM CaCl2 500mM HEPES 10mM EDTA Dejelling solution: 0.2 mM Tris- HCl (pH 8.8) 3.2 mM DTT MEMFA 1X:1X MEM salts (100 mM MOPS (pH 7.4), 2 mM EGTA, 1 mM MgSO4) 3.7% formaldehyde
Hybridisation buffer (Niehrs’ protocol): 50% formamide 5X SSC 1 mg/ml Torula RNA 0,1 mg/ml Heparin 0,1% Tween-20 0,1% CHAPS 10 mM EDTA pH 8.0
10 mg/ml Boeringer Blocking reagent
APB:
100mM Tris- HCl pH 9.5 50 mM MgCl2
100 mM NaCl
0,1% Tween-20
Hybridization buffer (in situ on sections): 50% formamide 10% dextran-sulphate 1 mg/ml Torula RNA 1X Denhart’s 1X salts 10X salts: 114 g NaCl 14.04 gr Tris HCl 1.34 gr Tris base 7.8 gr NaH2PO4. 2H2O 7.1 gr NaH2PO
