1
Department of Agriculture, Food and Environment
MSc: Plant and Microbial Biotechnology
Molecular analysis of cyp51 mutations associated with azole
fungicide tolerance in septoria blotch fungus Zymoseptoria tritici
Candidate:
Emiliano Delli Compagni
Supervisors: Co-supervisor:
Prof. Giovanni Vannacci Prof. Marco Mazzoncini
Prof. Dan Funck Jensen
Dott. Mukesh Dubey
3
Summary
Zymoseptoria tritici is the causal agent of STB (Septoria Tritici Blotch), a devastating wheat
disease. Application of azole fungicides is one of the major practices to control STB. The repeated use of fungicides has led to the development of azole resistance in Z. tritici especially due to mutations in the cyp51 gene. Until today, more than 30 resistant haplotypes have been discovered. The aim of the present work was to investigate the occurrence of mutations in the cyp51 gene associated with azole resistance in Z. tritici populations from leaves sampled in wheat field experiments testing fungicide effects. Analysis of cyp51 gene sequences using HiPlex PCR and PacBio sequencing identified 9 cyp51 different mutations (D134G, V136A, S188N, A379G, I381V, Y459del, G460del, Y461H and N513K), which were shown to be associated with the azole tolerance. In addition, we discovered the presence of an 867bp insertion in the promoter region in the cyp51 gene of certain Z. tritici strains. In silico analysis of the insertion sequences showed the presence of TFBP (Transcription Factor Binding Proteins) motifs and several stress-related motifs, especially osmotic-stress. Then, gene expression of cyp51 gene from two pure culture isolates was investigated with qPCR. Strains with insertion in cyp51 gene promoter region showed a significant overexpression of the cyp51 gene compared with strains without insertion. Furthermore, analysis of fungicide tolerance showed that the strain with insertion had significantly higher tolerance toward the azole fungicide compared with the strains with no insertion. So far, most of the studies have been focused on investigating new haplotypes; however, overexpression of cyp51 is one of the mechanisms that can lead to fungicide resistance. This study highlights how the control of STB represents a growing challenge.
4
Riassunto
Zymoseptoria tritici è l’agente causale di una malattia che sta devastando le coltivazioni di
grano: STB (Septoria Tritici Blotch). L’applicazione di fungicidi a base di azoli è una delle pratiche più comuni per il controllo di STB. L’uso ripetuto di fungicidi ha portato allo sviluppo di resistenza in Z. tritici soprattutto dovuto a mutazioni a carico del gene cyp51. Ad oggi, sono stati scoperti più di 30 aplotipi resistenti. Lo scopo del presente lavoro era quello di valutare la frequenza di mutazioni nel gene cyp51 associate a resistenza ad azoli in popolazioni di Z. tritici da foglie campionate in un campo sperimentale di grano. L’analisi delle sequenze del gene cyp51, attraverso HiPlex PCR e sequenziamento PacBio, ha rivelato 9 aplotipi (D134G, V136A, S188N, A379G, I381V, Y459del, G460del, Y461H and N513K) noti per essere associati a resistenza a fungicidi. Inoltre, abbiamo scoperto la presenza di un inserzione di 867bp nel promotore del gene cyp51 di alcuni ceppi di Z. tritici. L’analisi in silico di questa inserzione ha mostrato la presenza di motivi per TFBP (Transcription Factor Binding Proteins), soprattutto motivi correlati a stress-osmotico. È stata quindi esaminata l’espressione del gene cyp51 di due isolati in coltura pura con qPCR. L’isolato con l’inserzione nel promotore ha mostrato una significativa overespressione del gene cyp51 rispetto all’isolato senza inserzione. Infine, l’analisi di tolleranza ai fungicidi ha mostrato come l’isolato con l’inserzione nel promotore abbia una tolleranza significativamente più alta rispetto all’altro isolato senza l’inserzione. Finora, la maggior parte degli studi si è focalizzata sulla ricerca di nuovi aplotipi; tuttavia, l’overespressione del gene cyp51 è uno dei meccanismi che può portare allo sviluppo di resistenza. Questo studio evidenzia come il controllo dell’STB rappresenti una sfida sempre più ardua.
5
INDEX
1. Aim of the work………....……….(7)
2. Introduction……….……...…...(8)
2.1 Biology and epidemics of STB...(8)
2.2 The “genome plasticity” of the pathogen...(14)
2.3 Chemical control has led to fungicide resistance...(16)
2.4 Azole fungicides target the ergosterol biosynthetic pathway...(19)
2.5 HiPlex PCR, a novel method for MPS...(23)
2.6 PacBio sequencing: the third generation sequencing technology...(25)
3. Materials and Methods...(27)
3.1 Leaf sample...(27)
3.2 DNA extraction and amplification of cyp51 gene...(28)
3.3 HiPlex PCR...(30)
3.4 Population study...(30)
3.5 Zymoseptoria tritici strains growth conditions...(33)
3.6 RNA extraction, DNase treatment and cDNA synthesis...(33)
3.7 Gene expression analysis...(34)
3.8 Statistical analysis...(36)
3.9 Fungicide tolerance test...(36)
4. Results...(37)
6
4.2 HiPlex PCR...(40)
4.3 Promoter analysis...(44)
4.4 Population study...(47)
4.5 Validation of primer for RT-qPCR...(48)
4.6 Gene expression analysis...(52)
4.7 Statistical analysis...(54)
5. Discussion...(55)
6. Conclusions...(58)
7
1. Aim of the work
This work is part of a 3-year project (started in 2018), carried out by SLU (Swedish University of Agricultural Sciences, Uppsala, Sweden), AU (Aarhus University, Aarhus, Denmark) and KU (University of Copenhagen, Copenhagen, Denmark), whose aim is to investigate the potential application of biocontrol agents (BCAs) either alone or in combination with low dosages of fungicides for control of STB (Septoria Tritici Blotch). Thus, the project will explore if BCAs can replace some of the traditional sprayings and be able of reducing problems related to fungicide resistance.
Our goal at SLU was to set up a multiplexing approach (HiPlex PCR, Nguyen-Dumont et al., 2013) in order to evaluate effects of BCAs application strategies on azole fungicides selection pressure in the population of Zymoseptoria tritici. Therefore, a gene known to be harboring mutations leading to fungicide resistance was analyzed (i. e. cyp51) and prepared with tags for PacBio sequencing.
The analysis of cyp51 gene will allow us to evaluate the frequency of mutations comparing the proportions of resistance mutations between the treatments especially between the fungicide and BCA treatment.
Keywords: Azole fungicide, cyp51, fungicide resistance, HiPlex PCR, real-time PCR, Zymoseptoria tritici.
8
2. Introduction
2.1 Biology and Epidemics of STB
Zymoseptoria tritici (Desm.) Quaedvlieg and Crous, is a fungal pathogen and the causal
agent of one of the most severe foliar disease of wheat: STB, Septoria tritici blotch. Wheat is the third most widely-grown crop in the world with global harvests that reached about 750 million tons in 2016; the EU leads the global production with 142 million tons in 2016 (more than China 131 million tons, India 93 million tons and USA 62 million tons) (Fig. 2.1.1; FAOSTAT, 2018). This highlights the huge economic importance of this crop and consequently how losses due to pests are considerable concern. Z. tritici is a worldwide pathogen: outbreaks have been reported in France, Netherlands, Germany, Denmark, UK, USA, Canada, Australia, New Zealand and South Africa (Palmer and Skinner, 2002, Shipton et al., 1971, Suffert et al., 2011) and infections are capable of reducing yields by 30-40% (Eyal et al., 1987). The most serious yield losses occur when the flag (top), second and third leaves, which are responsible for providing the photosynthetic products for grain filling, become severely infected (Palmer and Skinner, 2002). STB also accounts for approximately 70% of annual fungicide usage in the EU (Fones and Gurr, 2015) and is one the most economically damaging wheat disease in USA (Ponomarenko et al., 2011).
9
Fig. 2.1.1 Wheat production of the four main growing nations in the world in the years
1985-2016 (FAOSTAT, 2018).
Zymoseptoria is a novel genus of ascomycete fungi; belonging to the order of Capnodiales
and to the family of Mycosphaerellaceae, is used since 2011 to accommodate Septoria-like species. Before that, the fungus was designed as Septoria tritici (anamorph) and
Mycosphaerella graminicola (telomorph); in fact, it consists of both a sexual and an asexual
stage (Quaedvlieg and Crous, 2011). Z. tritici (Fig. 2.1.2) has an heterogenic morphology; the asexual stage is carried out by pycnidiospores, which can exist in two different forms: multicellular macropycnidiospores consisting of 4-8 elongate cells (divided by septa) and unicellular micropycnidiospores. They are produced within asexual fruit bodies, pycnidia, and dispersed by rain splash. Both forms are equally able to infect and cause the disease (Eyal et al., 1987).
10
Fig. 2.1.2 Zymoseptoria tritici on a PDA plate.
Sexual reproduction is controlled by a bipolar heterotallic mating system. Thus, ascospores result from the encounter between strains leading differ mating type alleles (MAT1-1 and MAT1-2) (Kema et al., 1996). However, in STB, most lesions are apparently initiated by a single genotype, making it necessary for the lesions to coalesce for the two mating type to meet. Ascospores of Z. tritici are held in asci produced in sexual fruit bodies called pseudothecia. Each ascus (24-60 µm x 7-25 µm) contains 8 ascospores and each pseudothecium can contain 19-45 asci, with an average of 26. Assuming that all asci reach maturity and hold eight ascospores each, this gives a potential number of 200 ascospores per pseudothecium (Eriksen and Munk, 2003). Sexual spores are distributed by air and can spread the STB over hundreds of kilometers, whereas rain splashed macropycnidiospores dispersed more locally (Sanderson et al., 1985). Depending on the environmental conditions and agricultural practice, either asco- or pycnidiospores can be the primary source of inoculum in STB.
The primary inoculum is defined as “the overwintering or oversummering pathogen, or its spores that cause primary infection’’ (Agrios, 2005). In conventional winter wheat cropping
11
systems, the crop is harvested in early summer and the next crop emerges as seedlings in mid-autumn. The epidemic stage of STB, as it is usually observed, occurs between March and July. To develop epidemics, the pathogen has to produce primary inoculum at seedling emergence and thus has to survive the preceding intercrop period. Moreover, the pathogen has to remain present during winter either on the plants or in the form of survival structures. Inoculum build-up and overseasoning potentially involve various fungal structures (ascospores, pycnidiospores, mycelium) and various plant material (wheat seeds, wheat stubble and debris, wheat volunteers, grass species) (Suffert et al., 2011). Fig. 2.1.3. shows the life cycle of the pathogen. Infection begins with the germination of either asco- or pycnidiospores, both of which are pathogenic. They switch to hyphal growth upon contact with the leaf (Duncan and Howard, 2000; Kema et al., 1996a). Penetration into the host seems to occur exclusively through stomata and takes place from germ tubes that are often branched and developed into clusters of hyphae aggregated in stomatal depression of the leaves (Duncan and Howard, 2000). After successful stomatal penetration, after 12-24 h, hyphae spread intercellularly in the substomatal cavity from where they colonize the mesophyll tissue of the plant. Mycelial growth remains strictly intercellular but gradually increases in quantity and, within the first 9-15 days, hyphae branch and form an increasingly denser network. Mesophyll cell walls start to collapse whereas hyphal growth remains intercellular until cell death. Thus, a rapid and massive host cell death occurs, with the mycelium largely attached to the degenerated cell walls. This is followed by mycelial proliferation, apparently resulting from the release of nutrients from the mesophyll cells after their collapse (Kema et al., 1996a). About 3–11 days after infection, hyphae begin to fill the substomatal space and pre-pycnidia appear in these cavities. The development of a young pycnidium into a conidium-producing mature pycnidium is completed in 2 to 3 days. During this course of leaf colonization, the infection remains asymptomatic and the leaves appear
12
healthy (Cohen and Eyal, 1993; Duncan and Howard, 2000; Kema et al., 1996a; Shetty et al., 2003). This symptom-less ‘‘latent phase’’ (also named biotrophic phase) is unusually extended, and varies between 6 and 36 days, depending on wheat genotype-fungal isolate combination and, in the field, upon weather conditions (Shipton et al., 1971). Pycnidia formation seems to be restricted solely to the substomatal cavities with the ostiole located beneath the guard cells (Fig. 2.1.4) (Cohen and Eyal, 1993). As these asexual fruiting bodies develop, chlorotic lesions appear, usually followed by necrotic areas that appear at 10–12 days post infection. The release of plant nutrients, such as amino acids and sugars, is thought to provide the basis of massive fungal proliferation and increased biomass, found during the necrotrophic phase (Shetty et al., 2007). Finally, mature pycnidia filled with conidia are formed; they appear macroscopically as black dots within a sharply defined necrotic lesion on the plant leaf. (Fig. 2.1.5) (Duncan and Howard, 2000). Pycnidiospores are disseminated through the leaf canopy and to other plants by rain-splash (Suffert et al., 2011).
13
Fig 2.1.4 Pycnidium of Z. tritici in the substomatal cavity. The ostiole is located under the
stomal slit (Kema et al.1996).
14
2.2 The “genome plasticity” of the pathogen.
Z. tritici is the first species of the Dothideomycetes to have the genome of a representative
isolate (IPO323) sequenced. The finished genome of Z. tritici isolate IPO323 consists of 21 complete chromosomes resulting in 39.7 Mb genome size. A striking aspect of the pathogen genetics is the presence of many dispensable chromosomes that can be lost readily in sexual progeny with no apparent effect on fitness. Thus, Z. tritici chromosomes have been designed as core chromosomes (CCs, numbered 1-13) and dispensable or accessory chromosomes (ACs or dispensome, numbered 14-21). There are significant differences in structure and gene content between the 13 core and the 8 dispensable chromosomes. The dispensome constitutes about 12% of the genomic DNA but contains only 6% of the genes. In contrast, the 13 core chromosomes have twice as many genes per Mb of DNA, about half as much repetitive DNA, a significantly higher G+C content, and much higher numbers of unique genes. Genes in the ACs are significantly shorter, usually truncated relative to those on the CCs and have dramatic differences in codon usage. Some unique genes in the dispensome with intact, presumably functional reading frames have possible paralogs on the core chromosomes that appeared to be inactivated by mutations. Each ACs contains genes and repetitive sequences from all or most of the CCs with additional unique genes of unknown origin. The origin of the dispensome of Z. tritici is not clear. The two most likely origins would be degeneration of copies of the core chromosomes or by horizontal transfer. In addition, no genes for pathogenicity or fitness of Z. tritici have been mapped to the dispensome. The genome of the pathogen is also particularly lacking in enzymes degrading cellulose, xylan and xyloglucan; that is very atypical for a cereal pathogen. The greatly reduced number of cell wall-degrading enzymes (CWDEs) in the genome, compared with other sequenced fungal genomes, might be an evolutionary adaptation to avoid detection by the host during its extended, biotrophic latent phase and thus evade plant defences long
15
enough to cause disease. Therefore, a novel, biphasic mechanism of stealth pathogenesis has been proposed: during penetration and early colonization, the fungus produces a reduced set of proteins that facilitate pathogenicity and function as effectors in other fungi. Instead of the usual carbohydrate metabolism, nutrition during the extended biotrophic phase may be by degradation of proteins rather than carbohydrates in the apoplastic fluid and intercellular spaces. In fact, during the early stages of the infection process a large number of proteases expressed have been reported. The biotrophic phase terminates by a switch to necrotrophic growth, production of specific cell wall-degrading enzymes and possibly by triggering programmed cell death. ACs have been described as a ‘‘cradle for adaptive evolution’’. This refers to their potential for retention of higher levels of mutation over time, due to low impact on fitness and correspondingly lower selective pressures. A two-speed rate of evolution across CCs and ACs allows pathogens like Z. tritici to retain its core gene content governing its viability and metabolism, whilst at the same time innovating and mutating genes rapidly in response to host defences and control strategies. (Goodwin et al., 2011; Croll and McDonald, 2012; Testa et al., 2015). Because of the extremely high levels of genetic variability within the populations, the fungus is difficult to control. In north-western Europe, two to four fungicide sprays are commonly applied to winter wheat for the control of STB. For disease management of STB in winter wheat, compounds belonging to four fungicide classes are available in Europe: quinone outside inhibitors (QoIs); sterol 14α-demethylation inhibitors (DMIs); succinate dehydrogenase inhibitors (SDHIs) and multi-site inhibitors.
16
2.3 Chemical control has led to fungicide resistance.
For many years, DMI fungicides epoxiconazole and prothioconazole have been the most widely used fungicides for STB control throughout Europe. In recent years, declining field efficacies have been observed for both fungicides which raise major concern of a total loss of efficacy of this important fungicide class. Van den Bosch et al. (2011) defined three phases of fungicide resistance evolution: an initial ‘emergence phase’, in which a resistant strain arises for the first time by spontaneous mutation or invasion from another population. Followed by a ‘selection phase’, in which the resistant strain is present in the population and increases in frequency over time due to selection pressure imposed by fungicide applications. In the final ‘adjustment phase’, the resistant strain has established itself and accounts for a large proportion of the population. According to the authors, anti-resistance strategy can only be successful when employed in the ‘selection phase’; a prevention of the rise of a resistant strain is impossible and once established in a population, resistant strains can only be managed to some degree by agronomical practices. Fungicide resistance to DMIs has been associated with three molecular mechanisms: mutations in the DMI target gene cyp51 causing amino acid alterations in the cyp51 enzyme; overexpression of the target gene cyp51 and an enhanced efflux of the cell (Fig 2.3.1).
17
Fig. 2.3.1 Azole resistance mechanism (Parker et al. 2014, modified).
In the northern European Z. tritici population, alterations of the cyp51 contribute the most to reduced sensitivity to DMIs, whereas overexpression and enhanced efflux are rare (Heick et al., 2017). cyp51 is a nuclear gene that codes for the sterol 14α-demethylase, an integral membrane protein that catalyzes the C14-demethylation of lanosterol, which is critical for ergosterol biosynthesis, an essential component of the fungal cell membrane (UniProtKB). Leroux et al. (2007) first described cyp51 haplotypes (i.e. resistant genotypes) in Z. tritici; where an haplotype is defined as a set of DNA variation, or polymorphism, that tend to be inherited together and can refer to a combination of alleles or to a set of SNPs (single nucleotide polymorphisms) found on the same chromosome (NHGRI). These haplotypes were classified into different resistant types (R-types) with respect to their reduced sensitivity to azole fungicides. Each R-type was associated with amino acid alterations (substitutions and/or deletions) in the cyp51 protein. The first observed mutations were single site alterations and substitutions or deletions at nucleotides coding for amino acids 459–461 (Zhan et al., 2006; Leroux et al., 2007). Over time, more and more mutations and combinations of mutations were identified and described (Fraaije et al., 2007; Leroux et al.,
18
2007; Stammler et al., 2008; Leroux & Walker, 2011). Deletions or mutations at nucleotides coding for amino acids 459–461 are currently claimed to have the highest effect on the sensitivity to DMIs (Leroux et al., 2007; Stammler et al., 2008; Cools et al., 2011; Leroux & Walker, 2011). More recently, Huf et al. (2018), proposed a new nomenclature for cyp51 haplotypes in Z. tritici consisting on a combined letter and number code. This study also highlights the heterogeneous distribution of the different haplotypes across the European countries (Fig 2.3.2).
Fig. 2.3.2 Distribution and frequency of the nine most frequent cyp51 haplotypes of Z. tritici
collected in 2016 across different European countries (Huf et al., 2018).
From the 331 isolates of Z. tritici collected in 2016, authors identified 33 different cyp51 haplotypes. Nine of these cyp51 haplotypes were found to represent 84.8% of the complete isolate collection. The most frequent haplotype of all isolates was the E4 haplotype (L50S, D134G, V136A, I381V, Y461H), representing 32.9% of the population. The study confirms how new cyp51 haplotypes continue to occur, mainly in intensive wheat-growing areas, and indicates that cyp51 is still evolving as a result of high and continued selection pressure.
19
2.4 Azole fungicides target the ergosterol biosynthetic pathway.
Plasma membrane of eukaryotes contains sterols that are essential for the organization and functions of this structure. The main sterols found in eukaryotes are represented by three predominant forms: cholesterol in vertebrates, phytosterols (sitosterol, stigmasterol, campesterol) in plants, and ergosterol in fungi. Each of these sterols is the end‐product of a long multistep biosynthetic pathway that derives from a common initial pathway (acetyl CoA to squalene epoxide). Sterol 14α-demethylation is a crucial step of sterol biosynthetic pathways in eukaryotes. The enzyme catalyzing this reaction was first purified from yeast in 1984 (in Saccharomyces cerevisiae) (Yoshida and Aoyama, 1984) and following determination of its primary structure the cytochrome P450 sterol 14α-demethylases were placed into the cyp51 family (Fig. 2.3.1).
Currently the cyp51 family joins proteins found in 82 organisms from all biological kingdoms, with several plant and fungal species containing multiple cyp51 genes. Though the cut off for the level of identity within a P450 family is accepted to be >40%, sterol 14α-demethylases from all phyla are assigned to the same family because they appear to retain
Fig 2.4.1 Crystal structure of S.
cerevisiae cyp51, red is
transmembrane domain. Tyndall et al. (2016). PDB ID: 5EAE.
20
strict catalytic function. All forms studied catalyze one regio- and stereospecific reaction of oxidative removal of the 14α-methyl group from sterol precursors formed in the sterol biosynthetic pathway downstream from cyclization of squalene 2,3-epoxide (Lepesheva and Waterman, 2006) (Fig 2.4.2).
Fig 2.4.2 Simplified generalized synthetic pathway of sterols in plants, animals, and fungi.
The three kingdoms have a common early synthetic pathway (from acetyl-CoA to squalene 2,3-epoxide). After this compound, cycloartenol is produced in plants whereas lanosterol is produced in animals and fungi (Dupont et al. 2012, modified).
The cyp51 reaction occurs in three steps (Fig. 2.4.3), each requiring one molecule of oxygen and two NADPH-derived reducing equivalents. During the first two cycles, which are typical
21
P450-monooxygenations, the methyl group is converted successively into the carboxyalcohol (a) and then into the carboxyaldehyde (b). In the final step, the 14α-aldehyde group is released as formic acid with concomitant introduction of the Δ 14, 15 double bond into the sterol core (c) (Waterman and Lepesheva, 2005). The eukaryotic forms of cyp51 require cytochrome P450 reductase as an electron donor partner; whereas bacterial
cyp51 can be enzymatically reduced by flavodoxin/ flavodoxin reductase (Jackson et al.
2003).
Fig. 2.4.3 The 3-step reaction catalyzed by cyp51 protein.
De novo sterol biosynthesis takes place in the majority of eukaryotic cells (except for insects
and nematodes, which consume sterols from the diet). Generally, the pathway occurs in the endoplasmic reticulum. Contrary to drug metabolizing P450s, which can accommodate a vast variety of structures, cyp51 has very narrow substrate specificity. The set of substrates is limited to the five naturally occurring 14α-methylsterols (lanosterol; 24, 25-dihydrolanosterol; eburicol; obtusifoliol and norlanosterol) (Lepesheva et al. 2006).
22
Ergosterol is the main component of the fungal plasma membrane. Here it plays an important structural role to regulate membrane fluidity and permeability and indirectly modulate the activity and distribution of integral membrane proteins, including enzymes, ion channels and components of signal transduction pathways (Nes and McKean, 1977). In addition, ergosterol is also known to increase the mechanical resistance of cell plasma membrane to osmotic treatments when compared to its biochemical precursors (Dupont et al. 2011) and to be involved in the resistance of membrane lipids to peroxidation (Wiseman 1993). Eburicol is the principal substrate of cyp51 in most filamentous fungi (including Z. tritici), a tretacyclic triterpenoid that is a 24, 25-dihydrolanosterol carrying an additional methylene substituent at position 24 (ChEBI). The enzyme, catalyzing the removal of C-14 methyl group, leads to the formation of 4,4-dimethylcholesta-8,14,24-trienol (Fig. 2.4.4):
Fig 2.4.4 Formation of 4,4-dymethylcholesta-8,14,24-trienol, an intermediated product of
ergosterol biosynthetic pathway.
Azole (imidazoles and triazoles) fungicides, the most broadly known cyp51 inhibitors, coordinate to the heme iron through a basic nitrogen and inhibit activity preventing substrate binding and metabolism. These fungicides interrupt biosynthesis of ergosterol preventing demethylation of eburicol. This inhibition results in a depletion of ergosterol and a concomitant accumulation of nonfunctional 14α-methyl sterols (Bean et al. 2009).
23
2.5 HiPlex PCR, a new method for target MPS.
Current methods for targeted massively parallel sequencing (MPS) have several drawbacks, including limited design flexibility, expense, and protocol complexity, which restrict their application to settings involving modest target size and requiring low cost and high throughput. To address this, Nguyen-Dumont et al. (2013) have developed Hi-Plex, a PCR-MPS strategy intended for high-throughput screening of multiple genomic target regions. Featuring permissive thermocycling conditions and clamp bias reduction, the protocol proves to be simple, cost- and time-effective. It uses readily available reagents, does not require expensive instrumentation, and requires minimal optimization.
Hi-Plex chemistry employs: a small target size; a highly-processive, high-fidelity polymerase and permissive cycling conditions, spanning a gradient of annealing and extension temperatures at each cycle. This allows successful amplification across a range of primers and amplicon sequence contexts with different GC content. With Hi-Plex, the PCR reaction does not rely on priming from gene-specific primers, which are only used to seed the reaction. Hi-Plex primers include a 5’ heel which have adapter sequences to allow abridged universal adapter primers then full-length adapter primers added at later PCR cycles to drive the majority of the reaction. The adapters are hybrids containing 5’ Illumina TruSeq and 3’ Life Technologies Ion Torrent compatible sequences.
In a single reaction, 5’ heeled (heel clamp) gene-specific primers (GSP-F and GSP-R) representing all targeted amplicons (n-plex) are combined with adapter primers for PCR-based thermocycling (Fig. 2.5.1). A highly processive and high-fidelity thermostable DNA polymerase (e.g. Phusion high-fidelity polymerase) is used, along with permissive reaction conditions for annealing and extension.
24
Fig 2.5.1 Schematic overview of Hi-Plex PCR (Nguyen-Dumont et al. 2013).
Hi-Plex represents a powerful new approach for screening panels of genomic target regions. However, PCR-based MPS in its current form also has limitations relating to cost, throughput, and the ability to multiplex to a useful degree. Simultaneous production of many amplicons can lead to differential production of amplicons or nonspecific or failed amplification.
25
2.6 PacBio sequencing: the third generation sequencing technology
The second-generation sequencing (SGS) technologies have offered vast improvements over Sanger sequencing, but their limitations, especially their short read lengths, make them poorly suited for some particular biological problems. Single-molecule real-time (SMRT) sequencing, developed by Pacific BioSciences (PacBio), offers an alternative approach to overcome many of these limitations (Rhoads and Au, 2015). Unlike SGS, PacBio sequencing is a method for real-time sequencing and does not require a pause between read steps. This feature distinguishes PacBio sequencing from SGS, so it is classified as the third-generation sequencing (TGS) (Shadt et al. 2010). This new sequencing method captures sequence information during the replication process of the target DNA molecule. The template, called a SMRTbell, is a closed, single-stranded circular DNA that is created by ligating hairpin adaptors to both ends of a target double-stranded DNA (dsDNA) molecule (Fig. 2.6.1) (Travers et al. 2010).
Fig 2.6.1 SMRTbell template. Green: hairpin adaptors. Yellow and purple: dsDNA. Grey:
polymerase incorporating bases (orange) into the read strand (Travers et al. 2010).
When a sample of SMRTbell is loaded to a chip called a SMRT cell, a SMRTbell diffuses into a sequencing unit called a zero-mode waveguide (ZMW), which provides the smallest available volume for light detection. There are 150,000 ZMWs on a single SMRT cell. In each ZMW, a single polymerase is immobilized at the bottom, which can bind to either hairpin adaptor of the SMRTbell and start the replication. Four fluorescent-labeled nucleotides, which generate distinct emission spectrums, are added to the SMRT cell. As a base is held by the polymerase, a light pulse is produced that identifies the base (Fig. 2.6.2).
26
The replication processes in all ZMWs of a SMRT cell are recorded by a ‘‘movie” of light pulses (Pacific Biosciences, Media Kit; Eid et al. 2009).
Fig 2.6.2 Sequencing via light pulses. Each time a fluorescent-labelled nucleotide is held by
the polymerase, a light pulse is generated (Eid et al. 2009).
Because the SMRTbell forms a closed circle, once the polymerase replicated one strand of the target dsDNA, it can continue incorporating bases of the adapter and then the other strand. If the lifetime of the polymerase is long enough, both strands can be sequenced multiple times (called ‘‘passes”) in a single CLR (continuous long read). In this scenario, the CLR can be split to multiple reads (called subreads) by recognizing and cutting out the adaptor sequences. The consensus sequence of multiple subreads in a single ZMW yields a circular consensus sequence (CCS) read with higher accuracy. The entire workflow takes less than one day (Rhoads and Au, 2015).
An important advantage of PacBio sequencing is the read length: PacBio RS II system generates average read length over 10kb, with an N50 of more than 20 kb (i. e. over half of all data are in reads longer than 20kb) (AllSeq, Pacific BioSciences).
PacBio sequencing is faster but more costly than other methods; it provides very long reads but with an error rate relatively high that can be reduced by generating CCS reads with sufficient sequencing passes (Rhoads and Au, 2015).
27
3. Materials and Methods
3.1 Leaf samples
The winter wheat cv. Torp (Nordic Seed A/S, Kornmarken 1
DK-8464 Galten) experimental field is located in AU Flakkebjerg, Forsøgsvej 1, DK-4200 Slagelse (55°19'34.9''N 11°23'4.8''E). Leaf samples were picked on 25th of June (GS 75) and stored at -20°C. Normally the most relevant leaf layers would have been collected according to the treatments; however, due to the hot summer and lack of rain occured during 2018, STB development/disease pressure was very low. Thus, only leaves with symptoms have been colected; in most cases it is leaf layer 3 and 4. The field trial follows GEP (Good Experimental Protocol) and includes 15 treatments in four replicates: (table 3.1.1)
Products GS 37-39 GS 61
1 UNTREATED - -
2 Proline EC 250 0.4 l/ha
3 Proline EC 250 0.4 l/ha
4 Proline EC 250 0.4 l/ha 0.4 l/ha
5 Proline EC 250 0.8 l/ha 0.8 l/ha
6 Proline EC 250 0.8 l/ha 7 C. rosea 1,6 x 107 conidia/m2 8 C. rosea + P. chlororaphis 1,6 x 107 conidia/m2 + 1 x 109 cells/m2 9 C. rosea + P. chlororaphis + Proline EC 250 1,6 x 107 conidia/m2 + 1 x 109 cells/m2 + 0.4 l/ha
10 C. rosea 1,6 x 107 conidia/m2 1,6 x 107 conidia/m2
11 P. chlororaphis 1 x 109 cells/m2 1 x 109 cells/m2
12 C. rosea + P. chlororaphis 1,6 x 107 conidia/m2 + 1 x 109 cells/m2 1,6 x 107 conidia/m2 + 1 x 109 cells/m2 13 C. rosea + Proline EC 250 1,6 x 107 conidia/m2 + 0.4 l/ha 1,6 x 107 conidia/m2 + 0.4 l/ha
28
14 Tween 0,1% Tween 0,1%
15 Propulse 1,0 l/ha 1,0 l/ha
Tab 3.1.1 Treatments applied to wheat leaves.
3.2 DNA extraction and amplification of cyp51 gene
The DNA of Zymoseptoria tritici was extracted directly from the leaves cutting only the areas with symptoms and collecting the fragments into a 15mL tube. The samples have been dried in the freezer-dryer for one week and then ground in liquid nitrogen with mortar and pestle. A 0.5mg fraction of the sample was collected in a 2mL tube. The DNA extraction was performed using the DNeasy® Plant Mini Kit (QIAGEN) according to the manufacturer’s recommendations; quality and concentration of DNA were checked using NanoDrop ™ (Thermo Scientific, USA).
Amplification of the eburicol 14α-demethylase (cyp51) gene was performed in a single PCR reaction; the primers, used by Leroux et al. (2007) in a previous work, are listed in Table 3.2.1.
ID SEQUENCE (5’ to 3’) LENGHT
CYP51 (F) GAAACAGCGTGTGTGAGAGC 20-mer
CYP51 (R) CTGCTGTAATCCGTACCCACCAC 23-mer
29
In order to assess which annealing temperature would have been the best a gradient PCR was carried out. Thermocycling parameters were set as follows:
98°C for 30’’
98°C for 15’’
52-54-56-58-60-62 °C for 30’’
72°C for 1’
72 °C for 7’
PCR was performed in a 20µL reaction volume containing 5X Phusion Green HF Buffer (Thermo Scientific, USA) 4µL, dNTPs 2mM 2µL, 0.5µL of each primer (10 pmol/µL), Phusion Hot Start II DNA polymerase (Thermo Scientific, USA) 0.2µL and 1µL of template. All the PCR have been conducted using the Veriti™ 96-Well Thermal Cycler (Applied Biosystem, USA). The result of the amplification was checked on a 0.8% (w/v) agarose gel and, to ensure there were no aspecific amplifications, a gel purification was conducted using the GenJET Gel Extraction Kit (Thermo Scientific, USA) and the sequences were subsequently sequenced with Sanger sequencing.
Ensured the lack of any aspecific amplicon; new PCR was performed in a 20µL reaction volume, as described above, and the parameters set as follow:
98°C for 30’’
98°C for 15’’
60°C for 30’’
72°C for 1’
72°C for 7’
The result of the amplification was checked on a 0.8% (w/v) agarose gel.
32 cycles
30
3.3 HiPlex PCR
Amplicons were subsequently purified using Sera-Mag ™ (Sigma-Aldrich, USA) following the manufacturer’s instruction; concentration was checked using Qubit™ (Invitrogen, USA) and the samples diluted up to 3ng/µL. Several PCR were performed to get the sequences tagged, in order to optimize both amplification conditions and reaction. Therefore, the tagging reaction was conducted in a 20µL reaction volume containing 5X Phusion Green HF Buffer (Thermo Scientific, USA) 5µL, dNTPs 2mM 2µL, 0.5µL of each primer (10 pmol/µL), Phusion Hot Start II DNA polymerase (Thermo Scientific, USA) 0.2µL, 1µL of template (i. e. 3ng) and 0.5µL of tag (Eurofins Genomics, Germany). Parameters were set as follow: 98°C for 30’’ 98°C for 10’’ 62°C for 20’’ 72°C for 1’ 72°C for 5’
Once checked the result on a 0.8% (w/v) agarose gel, the amplicons were purified using the Agencourt AMPure XP (Beckman Coulter, USA). Purified amplicons were pooled in a single reaction, purified again using the E.Z.N.A.® Cycle Pure Kit (Omega Bio-tek, USA) and sent to the SciLifeLab (Uppsala, Sweden) to carry out a PacBio sequencing. After every purification step, concentration was checked using Qubit™ (Invitrogen, USA).
3.4 Population study
With the aim of investigate the distribution of the gene among the population of the pathogen, amplification of the cyp51 gene was performed on Zymoseptoria tritici pure culture isolates. These isolates, kindly provided by Aarhus University, have been collected
31
from the same experimental field where the leaf samples come from. Thus, liquid cultures have been set up, as shown in figure 3.4.1. The eight isolates were grown in PDB medium (Potato Dextrose Broth, 24g/L, Acumedia Manufacturers Inc. USA) in flasks containing 10mL of medium and incubated at 25°C in the dark on a rotary shaker for 20 days in constant shaking at 150 rpm to obtain enough mycelium.
Fig. 3.4.1 How to set up fungal liquid cultures.
Mycelium was harvested and the DNA was extracted according to the following protocol (Mukesh Dubey, SLU):
Take a small amount (100-200 mg) of sample and place in a 2mL tube;
Add glass beads in each tube;
Add 600µL 3% CTAB-buffer to each tube;
Homogenize the samples using homogenizer;
Incubate the samples at 65°C for 2 hours. Vortex the samples several times during incubation;
32 Centrifuge at 13000 rpm for 10 minutes;
Transfer the upper phase (approximately 600µL) into new1.5mL Eppendorf tubes;
Add 1 volume of chloroform and mix by vortex the tubes;
Centrifuge at 13000 rpm for 10 minutes;
Transfer the upper phase (approximately 500µL) to new Eppendorf tubes;
Precipitate the DNA by adding 2 volumes (1000µL) of isopropanol -mix properly- and incubate the samples at -20°C for 30 minutes;
Centrifuge the samples at 13000 rpm for 15 minutes;
Pour out the supernatant, carefully;
Wash the pellet by adding 200µL of 70% ethanol;
Centrifuge at 13000 rpm for 5 minutes;
Pour out the supernatant and let the pellet dry for 5 minutes;
Suspend the pellet in 50µL of milliQ water;
Check the concentration using NanoDrop.
Before proceeding with PCR, the DNA was diluted up to 20 ng/µL. Amplification of cyp51 was performed in a 25µL reaction volume containing 10X Dream Taq Green Buffer (Thermo Scientific, USA) 2.5µL, dNTPs 2mM 2.5µL, 0.5µL of each primer (10 pmol/µL), Dream Taq DNA polymerase (Thermo Scientific, USA) 0.3µL and 2.5µL of template (i. e. 50 ng). The parameters were set as follow:
95°C for 3’
95°C for 30’’
60°C for 30’’
72°C for 2’
72°C for 7’
The result was then checked on a 0.8% (w/v) agarose gel.
33
3.5 Zymoseptoria tritici strains growth conditions
In order to investigate the expression of cyp51 gene among the population a qPCR experiment has been set up. Two Z. tritici isolates 68-01 (insertion in promoter region of
cyp51) and 68-02 (without insertion) were chosen for gene expression of cyp51 gene. The
isolates were grown first in PDA medium (Potato Dextrose Agar, 39 g/L, Oxoid LTD, England) for 10 days in Petri dishes at 25°C in the dark to produce enough inoculum. The fresh grown cultures were used as inoculum. Liquid PDB medium (Potato Dextrose Broth, 24 g/L, Acumedia Manufaturers, Inc. USA) was inoculated with fresh Z. tritici in flaks containing 20 mL of medium and incubated at 25°C in the dark on a rotary shaker for a month in constant shaking at 150 rpm to get enough fungal biomass for the RNA extraction. The culture was then amended with prothioconazole (final concentration 50 µg/mL). In control treatment prothioconazole was replaced with equal volume of sterile distilled water. After 18 h of incubation, fungal biomass was harvested by vacuum filtration, washed several times in distilled water to remove the fungicides, frozen in liquid nitrogen and stored at -70°C. The experiment was performed in five replicates. In total 20 samples (two strains x two treatment x five replicates) were used for the experiment.
3.6 RNA extraction, DNase treatment and cDNA synthesis
To extract total RNA from each treatment, samples were grounded in liquid nitrogen with sterilized pre-chilled mortar and pestle until a fine powder. RNeasy® Plant Mini Kit (QIAGEN) was used to extract the total RNA following the procedure described by the manufacturer. The concentration of total RNA was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific). 1000 ng (1µg) of total RNA was used for DNase (Fermentas) treatment to remove the residual DNA contamination according to the following protocol:
34
Add to an RNase-free tube: RNA 1µg; 10X reaction buffer with MgCl2 1µl; DNase I, RNase-free 1µl (1U); DEPC-treated water up to 10µl;
Incubate at 37°C for 30 minutes;
Add 1µl of 50mM EDTA;
Incubate at 65°C for 10 minutes (RNA hydrolyzes during heating with divalent cations in the absence of chelating agent);
Use the prepared RNA as template for reverse transcriptase.
DNase treated RNA samples were used for cDNA synthesis using iScriptTM cDNA Synthesis Kit (Bio-Rad, CA, USA), following the procedure described by the manufacturer. After this, cDNA samples were diluted in 180μl of RNase-free water and stored at -20°C.
3.7 Gene expression analysis
Gene expression analysis was performed by real-time quantitative polymerase chain reaction (RT-qPCR) using cyp51 specific primer pairs CYP51_qpcr_F1 and CYP51_qpcr_R1 (Table 3.7.1) in a Bio-Rad 96-well reaction plates. qPCR primers CYP51_qpcr_F1 and CYP51_qpcr_R1 were designed using PrimerSelect (DNASTAR, USA) and amplify a 148 bp region: ID SEQUENCE (5’ to 3’) LENGHT Tm CYP51_qpcr_F1 GCCCCGACATCCAAGACG AACTC 23-mer 62.6 °C CYP51_qpcr_R1 GATGGGCATGGGAGACTT GACCTT 24-mer 61.2°C
35
As reference gene, β-tubulin gene was chosen according to Motteram et al. (2009) work:
ID SEQUENCE (5’ to 3’) LENGHT
Mg beta-tubulin fwd ATCACCAGCCCGCAAAGCT
T
20-mer
Mg beta-tubulin rev ACGATCTTGTGTCCGAGTA
CCAGC
24-mer
Tab 3.7.2 Primers for β-tubulin gene (Motteram et al. 2009).
Each reaction was performed in a 20µL reaction mix with 10µL of 2X SsoFast EvaGreen Super mix (Bio-Rad, Hercules, CA, USA.), 0.375 µL each of forward and reverse primer (10 pmol/µl), 5 µL of cDNA, and 4.25 µL of milli-Q water. Initial denaturation was carried out at 98 °C for 2 min followed by 40 cycles of denaturation at 98 °C for 5 sec, annealing at 60 °C for 10 sec, and the final extension at 60°C for 10 sec in an iQ5 qPCR system (Bio-Rad, Hercules, CA, USA). After the 40 cycles, melting curve was generated by collecting the fluorescence data by increasing the temperature from 55°C up to 95 °C with 0.5 °C per second, whereas the temperature was maintained for 10 s. The output of RT-qPCR is represented by ‘Ct’ (threshold cycle) values. Ct values is determined from a log–linear plot of the PCR signal versus the cycle number and indicates the cycle number at which the amount of amplified target reaches a fixed threshold. Primer amplification efficiency was determined by amplifying serial dilutions of cyp51 amplicon using PCR conditions described above. The standard curve was made using log10 copy number versus corresponding Ct value. The efficiency of each primer was calculated by using the formula E = 10(-1/slope). Relative expression of cyp51 was analysed from Ct values using 2-ΔΔCt method (Livak and Schmittgen, 2001). This method directly uses the Ct information generated from a qPCR
36
reference gene as normalizer. The result of this method is presented as the fold change (2 -ΔΔCq) of target gene expression in a target sample relative to a reference sample, normalized
to a reference gene.
3.8 Statistical analysis
Relative expression of β-tubulin was used for standardization of cyp51 relative expression data. To validate data, the one-way analysis of variance (ANOVA) was carried out. This statistical analysis compares the means between independent groups and determines whether any of these means are statistically significantly different. Results are assessed to be significant for p ≤ 0,05. To address which specific groups significantly differ from each other a Post-Hoc Fisher LSD test was carried out.
3.9 Fungicide tolerance assay
Fungicide sensitivity of strains 68-01 and 68-02 was carried out assessing the EC50 values to prothioconazole. EC50 is defined as the concentration of a fungicidal compound at which growth in vitro in inhibited by 50% by non-linear regression.
37
4. RESULTS
4.1 Amplification of cyp51 gene
Gel in Fig 4.1.1 shows the result of the gradient PCR. Two samples were randomly chosen to perform the gradient PCR (sample 1-9 and sample 1-10).
Fig. 4.1.1 Gradient PCR. Lane 2-7 sample 1-9 (lane 2: 52°C; lane 3: 54°C; lane 4: 56°C;
lane 5: 58°C; lane 6: 60°C; lane 7: 62°C); lane 8-13 sample 1-10 (lane 8: 52°C; lane 9: 54°C; lane 10: 56°C; lane 11: 58°C; lane 12: 60°C; lane 13: 62°C); lane 14 negative control; lane 1 and lane 15 marker (100 bp).
In each lane (except for lane 2 and 3), although with different annealing temperatures, two different bands can be clearly seen around 2 kb and 3 kb in size. It is also important to notice how, increasing the annealing temperature, the aspecific bands with lower size disappear. The two bands, subsequently named upper band (UB) and lower band (LB) to identify respectively the 3 kb band and 2 kb band, after a new PCR, were cut from the gel, purified and sequenced. Fig 4.1.2 a and b show the partial electropherogram of the reverse sequence of both the UB and LB. Because of their better quality, only the reverse sequences were used
38
as query to feed BLAST choosing the region with best score for both of them (around 800 nt).
Fig. 4.1.2 Reverse sequences partial electropherogram (around 100 nt); UB (a), LB (b).
The best match for LB (identity 99%, E value 0.0) was Zymoseptoria Tritici eburicol 14 alpha-demethylase (CYP51) gene (Accession Number KM051989), whereas for UB (identity 99%, E value 0.0) the best match was Mycosphearella graminicola eburicol 14 alpha-demethylase (CYP51) gene (Accession Number KX356102).
Then, cyp51 gene was successfully amplified as shown in Fig. 4.1.3. Out of 60 samples, each of them, except for sample 1-1 (i. e. first replicate, first treatment), shows both UB and LB.
a
39
Fig. 4.1.3a Amplification of cyp51, from sample 1-1 to sample 2-5.
Fig. 4.1.3b Amplification of cyp51, from sample 2-6 to sample 3-10.
Fig. 4.1.3c Amplification of cyp51, from sample 3-11 to sample 4-15. Last lane before the
40
4.2 HiPlex PCR
The tagging reaction was tough to carry out. Firstly, several combinations of annealing temperature, template concentration and PCR conditions were tested on few samples in order to optimize the reaction. Finally, one of these was tested on all the samples. However, the amplification did not result homogeneous. (Fig 4.2.1)
In many samples aspecific amplification bands are visible, all of them with a lower molecular weight. In two cases, the intensity of the aspecific band is comparable to the target (samples 2-3, 4-6). In at least 20 samples, there is no amplification of UB and in three samples the amplification was not successful. The tagging reaction failed.
Fig. 4.2.1a Samples from 1-1 to 2-5.
41 Fig. 4.2.1c Samples from 3-11 to 4-15.
Despite this, the SMRT Sequencing was successful with 372.977 CCS reads sequenced. Fig 4.2.2 shows the number of reads per read length. Most of the reads are around 2000 in length, the mean value is 1.987. Many shorter reads are present, corresponding to the aspecific bands on the gel and, because of a low rate of amplification, only few reads are around 3000 in length.
42
Read mean score is 0,996, suggesting high quality of the sequences (Fig 4.2.3). Therefore, erasing the shorter aspecific reads, sequences have been investigated for SNP in the coding sequence and, thus, for amino acidic changes in the translated protein. Twenty sequences have been randomly chosen, 10 around 2000 in size and 10 around 3000. The sequences have been aligned with Mycosphearella graminicola isolate K1562 eburicol 14 alpha-demethylase (CYP51) gene (Accession Number EF418622) defined as wild type by Leroux et al. (2007). In order to get the coding sequences, firstly, the cds of the reference was used to make the alignment. This alignment resulted in long gap areas in the reference cds, representing introns in the other sequences. Once removed those part, the cds of all the sequences is obtained. Tab 3.1 shows the amino acid polymorphism in the cyp51 gene.
43 L OW E R 10 L OW E R 9 L OW E R 8 L OW E R 7 L OW E R 6 L OW E R 5 L OW E R 4 L OW E R 3 L OW E R 2 L OW E R 1 UPP E R 10 UPP E R 9 UPP E R 8 UPP E R 7 UPP E R 6 UPP E R 5 UPP E R 4 UPP E R 3 UPP E R 2 UPP E R 1 W IL D T Y P E S E QUE NC E D G D D D G D D D D G D G D G G G D G G D 134 A A V V V A C V V A A V A C A A A V A A V 136 N S N N N S N N N S S N N N S S S N S S S 188 G A A A A A G A A A A G A A A A G A A A A 379 V V V V V V V V V V V V V V V V V V V V I 381 De l Y Y De l De l Y De l De l De l Y Y De l De l Y Y Y De l De l De l Y Y 459 De l G G De l De l G De l De l De l G G De l De l G G G De l De l De l G G 460 Y H H Y Y H Y Y Y H H Y Y H H H Y Y Y H Y 461 K N N K K N N K K K N K K N N N N K K N N 513
Tab. 4.2.1 cyp51 amino acid polymorphism. Numbers on the right column represent the
44
Overall, modifications in nine position have been found (i. e. 134, 136, 188, 379, 381, 459, 460, 461, and 513). Each sequence shows changes compared to the wild type in at least three positions. The change I381V (i. e. valine (V) instead of isoleucine (I)) is detected in all the sequences. Sequence lower8 is the less mutated with three changes (i. e. S188N, I381V, Y461H). Sequences upper8 and lower10 are the most mutated with seven changes (i. e. for sequence upper8: D134G, V136A, S188N, I381V, double deletion ΔY459/G460, N513K; for sequence lower10: V136A, S188N, A379G, I381V, double deletion ΔY459/G460, N513K). In positions 459 and 460 there are no changes and a double deletion is observed. The double deletion ΔY459/G460 is detected in 11 sequences out of 20 (i. e. upper2, upper3, upper4, upper8, upper9, lower2, lower3, lower4, lower7, lower8 and lower10). Each of them show no change in position 461 whereas all the sequences in which the double deletion lacks, and thus have no change in these positions, show the change Y461H (i. e. histidine (H) instead of tyrosine (Y)). Position 136 is the only position in which two different changes can be observed: V136A and V136C.
No differences in the mutation frequency between the upper and the lower sequence were found. Moreover, no specific or exclusive mutation were observed.
4.3 Promoter analysis
Mutation analysis was useful in the understanding of where the difference between upper and lower sequences is. Analyzing the coding sequences, was found that this difference does not occur neither in the cds nor in the introns and that it should be found somewhere else. Forward primer is designed to anneal upstream the gene, 207bp before the start coding (ATG) (Leroux et al. 2007), thus it is designed on the promoter sequence. Therefore, alignment of the 20 promoter sequences was performed. Shown below is the promoter sequence alignment of upper1 and lower1:
45
Majority GAAACAGCGTGTGTGAGAGCGGAGCGGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
UPPER band.seq GAAACAGCGTGTGTGAGAGCGGAGCGGGAGACGGCCGAACAGACTGCACCTTCACGCGGTGGCCGTCGTAAGTACCTTCC 80 LOWER band.seq GAAACAGCGTGTGTGAGAGCGGAGCGG--- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq TCGGAAGGGAAACCAAGACAGTCTGGAAGAAACCTCCTCGAAAACCTCTCGAAATCCGCCCGAAATCCTTCTCGAAATCC 160 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq GCCTCGAAATACAAGCTACAGAACAACAGCACGATTCGAACAAACAGCCCTACGTTACGAACGAGAAGAAGCAGTCCACT 240 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq CTATCCTATACGCGCACCTCCTCGAAATCCGAATCGAAATCGCATGTCCCTTCTCTAGTAGAGACGTCGTTGCCCTCGAA 320 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq AGGAAGCATACATGCACTTCAAAGAGCTGGAACTCGGTGGAATCCACAACTCTGCGATCAACCTGCGTAGCTGTATGCGT 400 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq TTGGAAGCGGCATACAGTTCCACAAAGGCATATTGAGGACAAGAGAAGACAGCGAGTTGGACAGCTGCTTTTGCAGTGCT 480 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq TTTGCACGGCATTTTGCACTGCTTTTGCACTGCATTTCGAATTTGCAGCGTGCGTGCGAAGCGGAAGGATCCGCTGAAAA 560 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq TTCTGCAAAAAGCTTGGCGCAAAAAAATTCTGCAGCCCTAGCTGCAGACAACGAAAATTCTGCAGCCCCAGCTGCAGACA 640 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq ACGAAAATTCTGCAGCCCCAGCTGCAGACAACAGACAACGACACTCGTTCGATTTCCTTTGTCTTGCATTTGTTTAAAGT 720 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq CCTTTGGCACTGCCTTAGGCACGGGGTTTCCCCTAAGGTCAAAGAATACTGAAAGAATTTGATTGTAAATAGATCTACTG 800 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX UPPER band.seq CCTTGCTTGCAAGGCCGTCCTACATAGTCATAGACTCCTACAGGACGTAAATGGAACAAACAAACAAACAAACAAAACAA 880 LOWER band.seq --- 27 Majority XXXXXXXXXXXXXXGGGCCCGCCGGGACCTGCAGGCAGAACTAAGCCCGTTTGGCTCAGGGCGATTGATTTATCGAACGA UPPER band.seq ACAGAGCGGAGCGGGGGCCCGCCGGGACCTGCAGGCAGAACTAAGCCCGTTTGGCTCAGGGCGATTGATTTATCGAACGA 960 LOWER band.seq ---GGGCCCGCCGGGACCTGCAGGCAGAACTAAGCCCGTTTGGCTCAGGGCGATTGATTTATCGAACGA 93 Majority TAATTTGGTCTGGGGAAGAAGGTTGGAAGGGTCGACTTTCATAACGCGACCTCAACATCTCTCCCCCTCGACAACATCCT UPPER band.seq TAATTTGGTCTGGGGAAGAAGGTTGGAAGGGTCGACTTTCATAACGCGACCTCAACATCTCTCCCCCTCGACAACATCCT 1040 LOWER band.seq TAATTTGGTCTGGGGAAGAAGGTTGGAAGGGTCGACTTTCATAACGCGACCTCAACATCTCTCCCCCTCGACAACATCCT 173 Majority CTGTGCCAATTTCTCCCGGAACATTGACATCACAATG
UPPER band.seq CTGTGCCAATTTCTCCCGGAACATTGACATCACAATG 1077 LOWER band.seq CTGTGCCAATTTCTCCCGGAACATTGACATCACAATG 210
46
The analysis revealed a large 867bp insertion in all upper sequences missing in lower sequences. The 867bp insertion sequence from upper1 was analysed for transcription factor binding sites (TFBSs) using JASPAR, choosing a 95% cut off. Overall, 64 putative TFBSs were predicted. Most of them, 13 out of 64, are Xbp1 (XhoI site-Binding Protein 1) binding site. Xbp1 is a transcriptional repressor that regulates cell cycle and binds to 5’-YTCGAR-3’ motifs, where Y can be C or T and R can be A or G. Second class per number of putative binding sites is C2H2 Zinc Finger Factor class (12 out of 64) in which MOT3 (Modifier of Transcription 3) binding site is highly represented. MOT3, like Xbp1, is a transcriptional repressor that modulates a variety of processes, such as cyp51 expression. It binds 5’-HAGGYA-3’ motifs, where H can be A, C or T. Finally, the last two highly represented classes are C6 Zinc Cluster Factors and Heat Shock Factor class, respectively with nine and six putative TFBSs detected. C6 Zinc Cluster Factor class includes many binding sites for transcription factors involved in stress response, such as HAL9 (HALotolerance 9). Five out of six TFBSs belonging to Heat Shock Factor class are SKN7 (Suppressor of Kre Null 7) binding site. Overall, 15 out of 64 putative TFBSs are involved in stress response whereas 23 out of 64 putative binding sites are involved in cell cycle. The promoter alignment also revealed a smaller 122bp insertion carried by four lower sequences close to the ATG start codon (lower2, lower6, lower7 and lower8). The 122bp insertion of lower2 was analysed with JASPAR, choosing a 95% cut off, and 7 putative TFBSs were detected. Four of them are involved in cell cycle, two in metabolism and one in pH response.
47
4.4 Population study
cyp51 gene was amplified in order to assess the distribution of the gene among the pathogen
population, eight Zymoseptoria tritici pure culture isolates were tested (Fig 4.4.1). All samples were successfully amplified and the amplification pattern suggests a uniform distribution of the gene. Each sample shows only one band and thus the presence of different
cyp51 alleles in the same isolate can be excluded. UB and LB distribution is homogeneous:
four samples (66-02, 67-02, 68-01, 69-02) show the UB, around 3kb in size, and the other four (65-02, 66-01, 68-02, 69-01) show the LB, around 2kb in size. Although template concentration was the same in all eight samples (20 ng/µL), amplification rate is different, as different is the signal intensity of the bands. However, this is not due to a lower presence of the sequence in the isolates as, in the four samples showing the strongest signal intensity (66-02, 68-01, 68-02, 69-01), two samples (66-02 and 68-01) show the UB and two (68-02 and 69-01) show the LB.
Fig. 4.4.1 Distribution of cyp51 gene. Lane 1 and lane 10: marker (100bp). Lane 2 – lane 9:
48
4.5 Validation of primers for RT-qPCR
Samples 68-01 and 68-02 were chosen to run the RT-qPCR, as they show respectively UB and LB with highest signal intensity. Before proceeding with the qPCR, amplifications were performed in order to validate primers. For cyp51 gene two different pairs of primers were designed; however, only CYP51_qpcr_F1 and CYP51_qpcr_R1 pair was then chosen to perform qPCR experiment. Both primers pairs were tested on both the sample (Fig 4.5.1). For β-tubulin gene, chosen as reference gene, the primer pair used is the same used by Motteram et al. (2009) in a previous gene expression experiment on Z. tritici (Fig 4.5.2).
Fig. 4.5.1 Amplification of cyp51 gene using primers for qPCR. Lane 1 and lane 7: marker
(100bp). Lane 2: sample 68-01 CYP51_qpcr_F1/R1 primers. Lane 3: sample 68-02 CYP51_qpcr_F1/R1 primers. Lane 4: sample 68-01 CYP51_qpcr_F2/R2 primers. Lane 5: sample 68-02 CYP51_qpcr_F2/R2 primers. Lane 6: negative control.
Both primers pairs successfully amplified cyp51 gene of both isolates, showing no aspecific amplicons. CYP51_qpcr_F1/R1 primers pair amplifies a region around 150bp, as predicted.
49
Fig. 4.5.2 Amplification of β-tubulin gene. Lane 1: marker (100bp). Lane 2: sample 68-01
Mg beta-tubulin fwd/rev primers. Lane 3: sample 68-02 Mg beta-tubulin fwd/rev primers.
CYP51_qpcr_F1 and CYP51_qpcr_R1 primers were further validated observing melting curve generated after 40 cycles, as described:
Fig. 4.5.3 cyp51 melt curve peak chart. Rate of change of the relative fluorescence unit
(RFU) with time (T) (-d(RFU)/dT) is shown on Y-axis, temperature (T) is shown on the X-axis.
50
Melting curves shown a single-tight peak proving primers high specificity. This means that the melting curve analysis resulted in a single specific product and thus no primer dimers or aspecific products were generated.
Then, primer amplification efficiency was calculated by amplifying serial dilutions of cyp51 amplicon. The standard curve was made plotting log10 copy number versus corresponding Ct values. Primer amplification efficiency was calculated by applying the formula:
E = 10(-1/slope).
Copy nos. Log copy nos. Ct values
300000000 8.477121255 14.06
30000000 7.477121255 18.12
3000000 6.477121255 21.79
300000 5.477121255 25.32
3000 3.477121255 29.34
51 Fig 4.5.4 cyp51 standard curve.
Primer efficiency resulted to be E = 110%.
y = -3,0658x + 40,97 R² = 0,9751 0 5 10 15 20 25 30 35 0 1 2 3 4 5 6 7 8 9
52
4.6 Gene expression analysis
Relative expression of cyp51 gene was calculated as the fold change (2-ΔΔCt) using relative expression of β-tubulin gene for standardization. In Tab 4.6.1 mean values of 2-ΔΔCt and standard deviation are reported.
Mean 2-ΔΔCt values SD
68-01 C 6,711118 2,789291
68-01 F 9,984031 4,533382
68-02 C 1,728181 0,314534
68-02 F 1,023378 0,253114
Tab 4.6.1 Mean 2-ΔΔCt values and relative standard deviation. 68-01: upper band; 68-02: lower band; C: control; F: fungicide treatment. For samples 68-01C and 68-01F mean values are calculated on four biological replicates; for samples 68-02C and 68-02F mean values are calculated on five biological replicates.
53
Fig. 4.6.1 shows the synoptic graph of values listed in Tab 4.6.1:
Fig. 4.6.1 Relative expression of cyp51 gene. Letters a and b refers to significant differences.
Values are assessed to be significant for p ≤ 0,05.
Sample 68-01F was found to be the sample with highest expression of cyp51 gene (2-ΔΔCt = 9,98). Overall, expression of cyp51 gene in isolates 68-01 (both C and F) was found to be higher than in isolates 68-02.
54
4.7 Statistical analysis
In order to assess statistical significance of data, one-way ANOVA and Post-Hoc Fisher LSD test were carried out. Table 4.7.1 shows p values for all samples:
68-01 C
68-01 F
68-02 C
68-02 F
68-01 C
0,082340
0,009491
0,004079
68-01 F
0,082340
0,000203
0,000094
68-02 C
0,009491
0,000203
0,659211
68-02 F
0,004079
0,000094
0,659211
Tab 4.7.1 In each box, p values obtained comparing samples in the left column with samples
in the upper row. Blank boxes are self-comparison. Red marked are statistically significant values. Values are assessed to be significant for p ≤ 0,05.
Although relative expression of sample 68-01F was found to be higher than sample 68-01C (9,98 and 6,71 respectively) and relative expression of sample 68-02F was found to be lower than sample 68-02C (1,02 and 1,72 respectively), fungicide treatment does not induce changes in the expression of cyp51 gene as p > 0,05 (0,082 for 68-01F 68-01C comparison and 0,659 for 68-02F 68-02C comparison). However, there is a significant overexpression of cyp51 gene in isolates 68-01 (both control and fungicide treated) compared to 68-02 (both control and fungicide treated) as p ≤ 0,05. In particular, values are significant for p ≤ 0,0094. For fungicide tolerance assay, EC50 for sample 68-01 was 0,12 ppm, whereas EC50 for sample 68-02 was 0,08.
55
5. Discussion
Massive parallel sequencing (MPS) established a turning point in the scenario of biological research. This new technology enabled the development of an inexpensive, rapid and widespread analysis of genomes, transcriptomes as well as mutations, polymorphism and noncoding RNA discovery (Mardis 2008, Shendure and Ji, 2008). The use on genomic regions selectively captured from a DNA sample before sequencing is one of the several applications of MPS (referred as targeted MPS). Targeted MPS is an attractive approach for screening of large panels of genes or genomic regions (Nguyen-Dumont et al. 2013). Here, an attempt to develop a HiPlex PCR protocol suitable for phytopathological purposes was presented.
The protocol used in this work has some modifications compared to the protocol presented in Nguyen-Dumont et al. (2013) and Nguyen-Dumont et al. (2015) works. Whilst our purpose was to amplify the whole gene, authors used a large set of gene specific primers in order to amplify, simultaneously, different small regions of the same gene and carried out a single PCR reaction. Despite any sequence resulted tagged, Zymoseptoria tritici cyp51 gene was successfully amplified and sequenced. The analysis of 20 cds identified 9 different haplotypes (D134G, V136A, S188N, A379G, I381V, Y459del, G460del, Y461H and N513K) known to be related to azole fungicide resistance. All of them have been previously reported in literature (Fraaije et al, 2007; Leroux et al, 2007; Stammler et al, 2008; Leroux & Walker, 2011; Cools & Fraaije, 2013). Amplification of cyp51 gene resulted in two clear, distinct bands for each sample (except for sample 1-1), around 3kb and 2kb in size. UB best match (identity 99%, E value 0.0) was Mycosphearella graminicola eburicol 14 alpha-demethylase (CYP51) gene (Accession Number KX356102) whereas LB best match (identity 99%, E value 0.0) was Zymoseptoria tritici eburicol 14 alpha-demethylase (CYP51) gene (Accession Number KM051989). It is since 2011 that the taxonomic classification of
