UNIVERSITÀ DEGLI STUDI DI PISA
FACOLTÀ DI BIOLOGIA
CORSO DI LAUREA MAGISTRALE IN
BIOTECNOLOGIE MOLECOLARI E INDUSTRIALI
“Metabolic engineering of Saccharomyces cerevisiae for
cannabinoids production”
Relatore:
Prof. Pierdomenico Perata
Dott. Francesco Licausi
Correlatore:
Prof. Alvaro Galli
Prof. Roberto Scarpato
Candidato:
Marco Martinelli
Il presente documento è da considerarsi confidenziale in quanto le informazioni
in esso contenute potrebbero essere oggetto di una domanda di brevetto.
RIASSUNTO
Il mio progetto di ricerca di tesi magistrale si pone come obbettivo lo sfruttamento del microrganismo Saccharomyces cerevisiae per la produzione dei principi attivi della Cannabis sativa.
Cannabinoidi e Cannabis sativa sono oggetto di un lungo dibattito che negli ultimi mesi si è acuito sempre più. Da un lato abbiamo, in riferimento alla realtà italiana, una giurisprudenza non permissiva per la coltivazione della pianta ma che permette di consumare farmaci contenenti cannabinoidi come principio attivo, dall’altro lato abbiamo una realtà scientifica che evidenzia sempre più le proprietà terapeutiche dei principi attivi della pianta. I cannabinoidi ,infatti, sono una famiglia di composti terpenofenolici dalle spiccate attività farmacologiche a livello del sistema nervoso dove legano i recettori CB1 e CB2 esplicando
un’attività antidolorifica ed antiemetica particolarmente indicata per pazienti affetti da cancro o AIDS. A fronte di queste importanti applicazioni e dei problemi legati a questa pianta, la mia idea è quella di riuscire a produrre cannabinoidi in bioreattori utilizzando cellule di lievito (Saccharomyces spp) , opportunamenete trasformate con gli enzimi della via di sintesi di questi metaboliti. Questa strategia supera le limitazioni legali e quindi consentirebbe di produrre cannabinoidi in quantità elevate abbattendo inoltre i costi della coltivazione e mantenimento della pianta. Qualora si riuscisse a ricostruire l’intera via biosintetica, una prospettiva ancor più interessante sarebbe quella di poter ottenere nuove gamme di cannabinoidi andando a modificare gli enzimi che li producono, creando in questo modo nuovi composti caratterizzati da minori effetti collaterali e migliori effetti benefici. Il mio lavoro è cominciato dal clonaggio dei geni della Cannabis sativa deputati alla formazione degli enzimi biosintetici in plasmidi galattosio inducibili, inseriti successivamente in cellule di lievito (S. cerevisiae) per le quali è stato messo a punto un protocollo di coltura in mezzo liquido in condizioni induttive (Galattosio) e non induttive (Glucosio). E’ stata studiata l’espressione dei geni clonati attraverso realtime qPCR ed è stata verificata l’effettiva produzione di cannabinoidi nel microrganismo tramite cromatografia accoppiata a spettrometria di massa.
SUMMARY
My thesis project aims at exploiting the micro-organism Saccharomyces cerevisiae to produce secondry metabolity originally produced by Cannabis sativa. The debate around Cannabinoids and Cannabis sativais growing more and more. In Italy, on one hand the Law forbids de facto Cannabis cultivation, though admitting consumption of cannabinoid-containing drugs for medicinal purposes, on the other hand scientific reports highlight the therapeutic properties of this plant. Cannabinoids, in fact, are a family of terpenophenolic compounds with a marked pharmacological activities at the level of the nervous system where they bind to the CB1 and CB2 receptors providing an analgesic and antiemetic effect particularly suitable for patients suffering from multiple sclerosis, cancer or AIDS. Because of these important applications and problems associated with Cannabis cultivation and cannabinoid usage, my idea is to produce cannabinoids in bioreactors using yeast cells (Saccharomyces spp) transformed with genes codifying those enzymes taking part to the synthesis pathway of these metabolites. This strategy overcomes the legal limitations listed above and therefore would produce cannabinoids in large quantities, also reducing the cost of cultivation and maintenance of the plants. If it were possible to reconstruct the entire biosynthetic pathway in yeast, a even more interesting prospect would be to be able to create novel cannabinoid altering the structures of the biosynthetic enzymes, thus creating new compounds characterized by fewer side effects and better benefits. My job is started by cloning Cannabis sativa genes coding forbiosynthetic enzymes in galactose-inducible vectors, subsequently inserted in yeast cells (Sc. cerevisiae) for which has been developed a protocol culture in liquid medium in inductive and not inductive conditions. The expression of the transgenes in yeast was studied by realtime qPCR and the actual production of cannabinoids using gas-chromatography-Coupled to mass spectrometry.
Introduction
According to the European Monitoring center for Drugs and Drug addiction of all the illicit drugs, Cannabis is the one with which we are collectively most familiar. This is perhaps not surprising. It has a long history, with the earliest evidence of cannabis use by humans stemming from the Neolithic period. The cannabis leaf itself has at times been a symbol of youthful rebellion, and no other illicit drug has become so closely associated in the public imagination with some of the social changes that Europe has seen in the last half-century. References to cannabis use appear regularly across popular culture, and it is also the substance over which public and political sentiment is most conflicted. Today, cannabis is the most widely consumed illicit drug in Europe and the world. Estimates suggest that at some time during each year at least 22 million Europeans will use this drug. This use is not without cost, as illustrated by the fact that those with cannabis-related problems now represent a sizeable proportion of those receiving help from drug services in many countries. In parts of Europe, cannabis consumption is both visible and difficult to ignore.[1] Marijuana boasts somewhere between 119 million and 224 million users in the adult population of the world (18 or older) and there are no signs to indicate that the popularity of marijuana will fade anytime soon. Also the regime landscape is changing. Faced with particular challenges and democratic decisions, a number of jurisdictions are moving beyond merely tolerant approaches to the possession of cannabis for personal use to legally regulating markets for the drug. In November 2012 voters within the U.S. states of Colorado and Washington passed ballot initiatives to tax and regulate cannabis cultivation, distribution and consumption for non-medical purposes. Just over a year later, Uruguay legislated state regulation of the entire chain of the domestic cannabis market for medical, industrial and recreational use. These policy shifts go well beyond the permitted prohibitive boundaries of the UN drug control conventions. They represent a break with an historical trajectory founded on dubious science and political imperatives. And they have thrown the global regime into a state of crisis [2].
For example Uruguayan President José Mujica signed a new law that fully legalizes marijuana in his country. But Uruguay’s new law is very restrictive: Individuals can purchase no more than 40 grams of marijuana per month (and must register in a government database), and producers can cultivate no more than six plants unless they join growers’ clubs, which also face strict limits on production. Marijuana can only be sold in state-regulated pharmacies and cannot be exported or sold to tourists. A new Institute for the Regulation and Control of Cannabis will supervise all of this. So Uruguay’s approach attempts to eliminate the ills of prohibition while still controlling access to marijuana.
While States start to legalize the medical and recreational uses of Cannabis the related pharmaceutical market is groing bigger. Industrial interest is increasing and now in Europe and in USA several pharmaceutical industries sell cannabinoid-based drugs. The world leader in cannabinoid medicine is GW-Pharma selling one of the most popular cannabinoid based drug called Sativex®. Potential market of this kind of drugs is quite big due to their utilizations: cancer, AIDS and MS. We can estimate 2.359.629 potential users just in Italy.
In our Country there are no registered producers of cannabinoid-based medicines. Hospitals and pharmacies have to import them from abroad, on the sole responsibility of the requesting physician, with long waits (six months) and an increased cost of the product due to taxes and delivery expenses. A multiple sclerosis patient is likely to end up paying 500-600 euro per month to be provided with prescribed cannabis. The Veneto Region has set aside one hundred thousand euro to ensure the gratuitousness of drugs. A sum probably insufficient to ensure that, when fully implemented, the provision of free of cannabinoid drugs to all potential users is estimated, in fact, that the annual cost to treat multiple sclerosis percent hovers around 500 thousand euro. The mechanism to get medicines is also quite complicated: ASL must purchase these drugs from abroad, after having the permission of the Ministry of Health. The patient will have to pay in advance and can only repeat the procedure once it has completely finished the amount of medication received from the ASL.
The law in Italy allows just to consume drugs under selective permission, cultivation of the plant is not allowed neither its recreational consume. There are several political movements sharing the idea that Cannabis could be cultivated and transformed into a drug, Regions made some progress even if is not easy to achieve a change similar to Uruguay. Italy could be a great producer of medical Cannabis because of its climate and the absence of competitors. The benefits of the creation of an Italian pharmaceutical industry producing cannabis and cannabinoid-contaning drugs is two folds: it could reduce public expenses, create working places, providing the chance to lot of patients to get innovative medicines.
1.1 History of Cannabis use
Originating in Central Asia, the plants of the genus Cannabis spp. represent some of the oldest species known to mankind. It’s difficult to draw with precision the beginning of its use: it seems that was consumed as a stimulant even before the appearance of writing. According to archaeological sources, in fact, his first use is found from the Neolithic period [3]. A treatise on Chinese medicine dated 2800 B.C. describes the first medical uses of cannabis, and increasingly in China, more than 2000 years ago, it was used to produce the first sheet of paper. Continuing in time, since 1840, thanks to studies on its medicinal properties, hemp was counted in the British
Pharmacopoeia in the form of extract or tincture. Around 1937, with the threatening campaign carried out by American industrialists lobbies, who saw in biofuel made from hemp oil a possible competitor to seeds oil, a law was passed prohibiting the cultivation of any type of hemp, making no distinction between varieties high or low in tetrahydrocannabinol (THC) content.
In 1942, Cannabis was removed from the American pharmacopoeia, and in 1971, both England and most of Europe banned the use of hemp, adapting to the "Convenction of psychotropic substances" that took place in the USA.
The law forbade the cultivation of hemp in Italy in 1975, an historical moment when our State was classified as the second largest producer of Cannabis after Russia. Only after the 90s, restriction began to lose their straightness. Australia allowed the cultivation of hemp fiber, while Bill Clinton and Al Gore claimed to have smoked marijuana. The United Kingdom also loosened restrictions on the cultivation of hemp. In 1994, in fact,Europe doors were opened to Cannabis: France reconverted 12,500 hectares for hemp cultivation; Germany, Spain and Great Britain followed.
In Italy, in 1994 and 1995, hemp could be grown under the strict control of the police, only for research and educational purposes at ENEA (Italian National Agency for New Technologies and the Environment).
In 2012, Tuscany has approved the use of cannabinoid-based medicines, through a law governing its use within the regional health service: it introduces a simplification of paperwork and waiting times for patients which make use.
1.2 Cannabis sativa L.
Dicotyledonous angiosperms belonging to the order of Urticales, the Cannabaceae or Cannabidaceae include two genera: Cannabis and Humulus, including the three species Cannabis sativa, Humulus lupulus (Common hop) and Humulus japonica (Japanese hops) [4]. There are different species of Cannabis. The most relevant from the commercial point of view are: Cannabis sativa, Cannabis indica and Cannabis ruderalis; this distinction, however, is subject to debate. Cannabis sativa, utilized in this study, it is certainly the most commonly used species. It is an annual plant, with a ratio between male and female plants in equal relationship, although there are also monoecious varieties. The root is well developed: it can reach 2.5 m in depth, for a
radius of 60-80 cm. The root system is more developed in female specimens and accounts for 8-9% of the total mass. The barrel has a hexagonal structure and is covered with hair. The height can vary from 80 cm of Russian varieties to 4.5-5 m of some European and Central America varieties. The stem can reach 4 cm in diameter and contributes 65-70% of the total mass. The tendency to form branches, more pronounced in females, it is useful for the production of oil seeds or drugs; while, for the production of fiber, the plant is grown to have a very thick stem, avoiding branches and leaves, thus decreasing the internodes that may decrease the quality. Leaves are covered with glandular trichomes, of which only a small part secreting resin. Under ideal conditions, leaves contribute 25% to the total mass, decreasing toward the end of vegetative phase, up to 8%. Flowers are grouped in inflorescences. Male flowers are composed of a calyx with five petals yellow-green. Hemp is a cultivated plant that produces large quantities of pollen: up to 30-40 g per plant. It can be carried by the wind to a height of 30 meters and be moved for more than 10 km. The fruit is an achene, although it is commonly called seed. It has a spherical or oval with a diameter of 4 mm 2.5- of gray-brown color, with an effect "marbled" shiny [5]
1.3 Secondary Metabolism in Cannabis
Phytochemistry of Cannabis is very complex: were identified more than 480 compounds belonging to different chemical classes, in part resulting from the primary metabolism such as amino acids, fatty acids and steroids, and others as cannabinoids, flavonoids, stilbenoids, terpenoids, alkaloids, lignans belonging to the secondary metabolism [6]. The concentration of these compounds varies greatly depending on the type of tissues and in the same tissue, on: age, cultivar, growing conditions (nutrients, moisture, light levels, temperature), time of collection and storage conditions. Scientific evidence shows that there is an increase in the levels of cannabinoids if the plant is under stress [7].
Cannabinoids can carry out different functions. At cellular level, for example, they can act as antioxidants on free radicals. Miller et al. [8] have proposed a mechanism for the oxidation of the neutral or acid form of∆9-THC to the acid form of CBN or ∆8 -THC produced by ROS. Although these substances can oxidize and thus act as antioxidants, their specific accumulation within the glandular trichomes move our
attention towards the ecological interactions of these components with the environment. In general, Cannabinoids are cytotoxic compounds and can therefore act as defense substances against predators such as insects. Considering that the THCA synthase enzyme (last step of the biosynthetic pathway) catalyzes a reaction that produces hydrogen peroxide [9], it follows that plant trichomes accumulate large amounts of cannabinoids and hydrogen peroxide, which result to be a toxic mix for the possible pathogens. Morimoto et al. [10], have shown that cannabinoids may induce cell death interfering on mitochondrial membrane permeability, explaining why they are compartmentalized in trichomes and why they are involved in the defense system of the plant.
1.3.1 Cannabinoids and their biosynthetic pathway
Cannabinoids are the most studied chemical species in Cannabis. Research continues to isolate new kinds, by the moment seventy different compounds were found out (Fig.). With the term "cannabinoids" we group a group of substances consisting of twenty-two or twenty-terpenophenolic carbonii, depending on whether the acid group is decarboxylated or less, which have been joined into ten structurally similar groups. Prevalent cannabinoids in Cannabis are Δ9-Tetrahydrocannabinol (Δ9-THC), Cannabidiol (CBD) and cannabinol (CBN), followed by cannabigerol (CBG), cannabichromene (CBC), and finally Cannabinodiol (CBND). Based on the absolute concentration detected by HPLC or gas chromatography, plants are classified as [11]:
• Plant for drugs (chemotype I): [Δ9-THC] greater than 2% and [CBD] is less than 0.5%.
• Plant for fiber (chemotype III): [Δ9-THC] less than 0.3% and [CBD] is greater than 0.5%.
• Type defined as intermediate (chemotype II), in which the concentrations of the two components mentioned above are similar and generally greater than 0.5%.
• Type C3 (chemotype IV): this chemotype differs from the dominant type because the molecule is characteristic of the Δ9-THCV, Tetrahydrocannabivarinic acid, which has a propyl side chain.
The pharmacological activity of cannabinoids is well documented and has many uses. The effect caused by these compounds are mainly due to their behavior as agonist against endogenous cannabinoid [12] receptors CB1 and CB2.
“Glandular trichomes (Fig.) are the main site of cannabinoid production and accumulation [13] The biosynthetic pathway has been extensively studied but Figura 2 Different kinds of Cannabinoids [11]
Figura 3 THCV (Wikipedia)
there are still some points that need further characterizations. The common
Figura 4 Representation of hemp trichomes [24] A: female inflorescence 8 weeks after germination. B: leaves associated with the inflorescence. C: glandular trichomes on bracts of the flowers. D: Scanning electronmicroscope imageof glandular trichomes. E: Image of trichomeswithoutgland. F: Image of the glands
cannabinoid precursor is cannabigerolic acid (CBGA), which is derived from the prenylation of olivetolic acid (OA) with geranyl pyrophosphate (GPP) by the enzyme Geranyldiphosphate:Olivetolate GeranylTransferase (GOT) [14]. CBGA works as substrate for three oxydocyclases: 1) cannabidiolic acid synthase (CBDAS) that converts it into cannabidiolic acid (CBDA) (Taura, Morimoto et al. 1996); 2) tetrahydrocannabinolic acid synthase (THCAS) that converts CBGA into tetrahydrocannbanolic acid (THCAS) [16]; 3) cannabichromenic acid synthase (CBCAS), which converts CBGA into cannabichromenic acid (CBCA) [17]
The gene encoding THCA synthase was isolated and consists of an open reading frame of 1635-bp encoding a peptide of 545 amino acids. The protein is FAD-dependent and the FAD-binding site is located on the histidine residue
114; In addition, a signal for glycosylation and one for peptide-transport were found on the open reading frame, indicating a post-translational regulation of this protein [18]. The THCA synthase is expressed and secreted exclusively in the glandular trichomes. This indicates that they are not only the site of accumulation of cannabinoids, but also the cellular compartment where THCA biosynthesis is carried out [19]. The genomic region coding for CBDA synthase has been sequenced: it contains an open reading frame that encodes a sequence of 544 amino acids, which shows homology with the THCA synthase of 83.9% [35]. Although this protein has a site for binding with the FAD and the site for glycosylation, the difference between the two enzymes is expressed in a different reaction mechanism specifically in the proton transfer way : while the CBDA synthase removes a proton from the terminal methyl group of the CBGA, the THCA synthase from hydroxyl group [20].
13C incorporation experiments demonstrated that the terpenoid moiety is
biosynthetized via deoxyxylulose phosphate pathway, which occurs in plant plastids. The condensation via polyketide synthase [21] of hexanoyl-CoA, deriving from the short-chain fatty acid hexanoate and activated by acyl activating enzyme 1 (AAE1) [22], with three molecules of malonyl-CoA leads to the formation of OA [23]. Olivetolic acid synthase (OLS) [24] has been identified as the enzyme responsible for OA formation. Whether OLS is the true polyketide synthase involved in cannabinoid production has been long debated. PKSs are a group of enzymes that catalyze the condensation of a starter acyl-CoA ester with extender CoA esters, such as malonyl-CoA. They are classified according to their architectural configuration as type I, II, III [25]. The type I describes a system of one or more multifunctional proteins that contain a different active site for each enzyme-catalyzed reaction in assembly and modification of the polyketide carbon chain. Type I PKSs are usually present in fungal or bacterial systems [26].They are organized into modules, containing at least acyltransferase (AT), acyl carrier protein (ACP) and β-keto acyl aynthase (β-KS) activities. Type II PKSs are individual enzymes that carry a single set of iterativeactivity. A minimal set consists of two ketosynthase units (α and β-KS) and an ACP, which plays as an anchor for the growing polyketide chain. Additional PKS subunits such as ketoreductases, cyclases or
aromatases define the folding pattern of the polyketo-intermediate and further PKS- modifications, such as oxydations, reductions or glycosylations are added to the polyketide [27]. Soil-borne and marine Gram- positive actinomycetes are the only organisms that employee PKS II. Type III PKS are present in bacteria, plants and fungi [28] and are homodimeric proteins that use CoA tethered substrates to carry out thioester exchange reactions, polyketide chain-elongation and select cyclization path in a single active site. In plants, type III PKSs are involved in the biosynthesis of a huge array of natural products, including flavonoids and stilbenoids. This diversity is due in part to the differences in the type of intramolecular cyclization reactions performed. PKSs involved in the biosynthesis of aromatic intermediates mainly utilize either an Aldol condensation-based mechanism (a.k.a. stilbene synthase or “STS-Type”), as in the case of OA [29], or a Claisen condensation-based mechanism (a.k.a. chalcone synthase or “CHS-Type”) for ring folding. STS-type condensation includes a decarboxylation activity which strikes with the fact that carboxylic group in OA is essential for subsequent prenylation and is always retained throughout the whole pathway. Up to date, there is only one exception, a gene encoding stilbenecarboxylate synthase (STCS) that has been cloned from Hydrangea macrophylla. This enzyme catalyzes the formation of lunularic acid by the condensation of dihydro-p-coumaryl- CoA and malonyl-CoA, without decarboxylation activity [30]. Actually there are some structural features that let OLS be more similar to a CHS-type PKS: the identity between OLS and the Medicago sativa CHS [31], which is the best characterized plant PKS, is 65% circa and the three CHS residues that catalyze chain elongation are conserved in the corresponding positions of OLS. Anyway, some modifications of important residues exist that determine CHS catalytic diversity [32], so it is hard to define whether OLS is a CHS- or STS-type synthase. Crystal structure analysis of CHS and STS have suggested that already a small number of amino acid substitutions in the former enzyme could alter the cyclazation reaction from claisen- into aldol-type, a phenomenon known as aldol-switch [28]. The dispute over OLS belonging to one type or the other PKS lost his importance since the discovery of a small enzyme that plays as a helper in the formation of OA. Being a type III PKS, olivetolic acid
synthase was expected to work on its own. However, in vitro assays never demonstrated the production of OA, but rather of olivetol, α-pyrones and lactones as product derailments [29]. This should be due to an intramolecular lactonization known to occur in some STS like PKSs, such as alkylresorcinol synthases [33]. In the attempt to solve this problem in 2012 Gagne and co-workers [34] identified an accessory protein, Olivetolic Acid Cyclase (OAC), which works in concert with OLS for the final cyclization of the tetraketide intermediate. This is a dimeric α+β barrel (DABB) protein structurally similar to polyketide cyclases from Streptomyces and to stress-responsive proteins in plants. It is puzzling that a type III PKS requires such an help from a second protein; as written above this is a characteristic of type II PKS, known to produce α-pyrones when polyketide cyclases are absent. An example is given by tetracenomycin PKS from Streptomyces that in the absence of TcmN ARO/CYC cyclase yields α- pyrones [35]. A first phylogenetic analysis on alkylresorcinolic synthases has been carried out, revealing that their activity together with the pyrone formation could represent the original function of type III PKSs that evolved to the common CHS- and STS-type enzymes with the rising of phenylpropanoid metabolism [36].In Cannabis hexanoate have been proposed to be produced either via de novo fatty acid biosynthesis or via the breakdown of existing lipids. One route involves the early termination of the fatty acid biosynthetic pathway, yielding hexanoyl-ACP. The hexanoyl moiety is transferred to CoA by the activation of an ACP-CoA transcyclase or cleaved by the action of a thioesterase, yielding hexanol, which is converted into n-hexanoyl-CoA by the action of acyl-CoA synthase. Instead, the other route involves fatty acid degradation: C18 unsaturated fatty acids are cleaved by lipoxygenase and hydroperoxide lyase to yield C6 and C12 products [37]. Results supporting both the pathway have been published [22], which could mean that both contribute to hexanoate production depending on particular spatio-temporal condition. As reported above, hexanoate is activated by CsAAE1 [22] which is lacking any of the two peroxisome targeting sequence, a common feature of this class of enzymes, being sequestered in the cytosol to work in concert with OLS [22].”[38]Summarizing here we have a complete view of the pathway of the three major cannabinoids.
1.3.2 Mode of action of cannabinoids
The characterization of cannabinoid receptors has led to a better understanding of cannabinoid pharmacology . Since the 70s, studies on the pharmacology of Cannabis claimed that the basis of its effect was explained by the lipophilic nature of phytocannabinoids, which were able to accumulate and persist in animal tissues [39]. Starting in the 80s, it was realized that the use of enantiomers of substances like THC gives different effects, depending if you used the left-handed or right-handed [40]. The pharmacological effect of (+) - 11-hydroxy-Δ8-THC-dimetileptil, for example, was a hundred times stronger than enantiomer (-). This set of information has led to the search of specific receptors that were first identified in the central nervous system, then, through the use of radio-actively labeled cannabinoids [41], in the peripheral system. They were identified as CB1 and CB2, both belonging to the large family of G-protein-coupled receptors. CB1 receptors are found primarily in the central nervous system. Inside the brain are distributed in all those sites in which cannabinoids produce many of their effects, such as memory or cognition (hippocampus and cerebral cortex) and motor function (basal ganglia and cerebellum). CB2 receptors are localized at the peripheral level and their amino acid sequence is only 44% similar to that of CB1. The CB2 receptors are expressed on a massive scale in B lymphocytes and NK lymphocytes also. Numerous experiments have shown that both types of receptor are accappiate to channels Ca ++ through G protein. For this reason, many of cannabinoid receptor agonists are able to inhibit, in a dose dependent manner, the internal currents Ca ++ voltage dependent.
The presence of cannabinoid receptors suggested the existence of specific ligands produced by our body. Endogenous agonists of cannabinoid receptors were identified and include an amide and a derivative of arachidonic acid: the first was called anandamide, an amide produced by our neurons, the etymology of the word (from the Sanskrit word "Ananda"), would represent the perception of euphoria, happiness and the mood relaxed and calm. The second agonistis the arachidonyl-glycerol (2-AG), a lipid molecule, which is also able to bind to cannabinoid receptors [42]. Generally neurotransmitters are synthesized at the
cytosolic and stored in synaptic vesicles, which are then secreted by exocytosis. Anandamide and 2-AG can be produced on demand, dependingon the stimulus of a membrane lipase, then released immediately after their production. Anandamide is produced by hydrolysis of an N-acetylated species of phosphatidylethanolamine (PE) N-arachidonyl PE, a process catalyzed by phospholipase D (PLD) [43]. Once released, it can bind to the CB1 and CB2 receptors, or be stored in nerve cells, where it can be hydrolyzed by an amide hydrolase (FAAH) [44]. The biosynthetic pathway of 2-AG involves the enzymatic cascade that catalyzes the formation of the second messengersinositol 1,4,5-triphosphate and 1,2-diacylglycerol (DAG). The phospholipase C, by acting on phosphatidinisitol-4.5-bisphosphate, generates the DAG, which is converted to 2-AG by DAG lipase. Although this compound is hydrolyzed by a specific lipase monigliceride (MGL). These two components can be released from neuronal and non neural cells; moreover, their short half-life after release suggests that they act as regulators in the release site as paracrine transmitters. It seems that endocannabinoids act as retrograde messengers, acting as short-living diffusible compounds that mediate cellular signals in a retrograde
manner, from the
depolarizingpostsynaptic
neurons back to the presynaptic terminals, where they inhibit the release of neurotransmitters. It has been proposed that endocannabinoids leave the
postsynaptic cell in which they are synthesized to go to activate the CB1 receptor axons adjacent terminals [45]. The endocannabinoid system thus plays Figura 6 Anandamide formation and pathway
activation [47].
Figura 7 Formation of arachidonic acid on the cell membrane [47].
an important role in physiological functions, such as regulation of glutamatergic or dopaminergic transmission, or even the perception of pain and pleasure. [46] It seems also that they behave like true organizers of neuronal networks in space and time, and that they are involved in the differentiation of specialized nerve cells during development of the central nervous system [47]. The study of these components, which play a role parallel to the opioid system, may lead to the development of new drugs useful for the treatment of various diseases.
1.3.3 Cannabinoids their medical uses
Cannabinoids have a very strong therapeutic potential. The main psychoactive agent is tetrahydrocannabinol or THC, also called ∆1-THC or ∆9-THC, depending on whether you are using the numbering based on the terpene or on the benzopyran system. THC is undoubtedly the best known component with a clear pharmacological activity; however, the other componentsof the phytocomplex are not negligible, as the cannabinols and cannabidiols and many others: in fact they do not have hallucinogenic properties but suppress the negative effects of THC. The leaves and the resin of Cannabis stored under normal conditions rapidly lose their activity and can become completely inactive after two years. The main change is the oxidation of THC in CBN. THC is more potent when smoked, rather than orally, its volatility allows a rapid absorption and a immediate effect. In fact, the drug is normally used in this way for recreational purposes. Cannabinoids acids undergo decarboxylation by heating, therefore, when the drug is smoked, the level of active cannabinoids increase. Smoking causes a state of euphoria, relaxation and wellbeing, with variation in the perception of sounds and colors. The effects, however, vary greatly depending on the subject , and especially the geographical origin, species, chemotype, and retention of the drug [48]. The chemotype has a significant influence on the kind of effect: a different chemotype hasdifferences on cannabinoids structures , which allows a different interaction with the cannabinoid receptors even with a slightly structural change .
Endogenous cannabinoids studies and the characterization of their interactions into human physiologyhas enabled a more specific use of Cannabisand cannbinoids in different pathologies. According to the research conducted so far, they can be used as antiemetics, appetite stimulants in patients debilitated by cancer or AIDS, analgesics in the treatment of multiple sclerosis, problems with the vertebrae, epilepsy, Tourette's syndrome and glaucoma [49]. Here is a table of the main drugs containing the active ingredient or obtained by synthesis or crude extracts of the drug [50].
1.4 Saccharomyces cerevisiae a model organism
The yeast Saccharomyces cerevisiae (S.cerevisiae) is one of the most widely used eukaryotic model organisms. It has been used as amodel to study aging [51], regulation of gene expression [52],signal transduction [53], cell cycle [54], metabolism [55,56], apoptosis [57], neurodegenerative disorders [58], and many other biological processes. For example, up to30% of genes implicated in human disease may have orthologs in the yeast proteome [59].[60]
For thousands of years, it’s been used by man to produce bread, wine and beer, food industries use carbon dioxide or ethanol ,the end products of its metabolism, in relation to the presence or absence of oxygen. Saccharomyces cerevisiae is a facultative anaerobic microorganism and metabolizes simple sugars in two ways: Aerobically in the presence of oxygen or with the anaerobic pathway in the absence of oxygen. Under aerobic respiration simple sugars are converted into carbon dioxide and water. Under anaerobic conditions instead alcoholic fermentation produces ethyl alcohol and carbon dioxide as well as other secondary metabolites responsible for the organoleptic characteristics of the food.
S. cerevisiae is a non-pathogenic yeast, fast growing, ellipsoidal with a diameter of about 5 microns, which is divided by budding (doubling time 1.25-2 hours), a feature that has made it very useful for studying the mechanisms of cell division. Its genome is represented by approximately 6000 genes of which 5800 are believed to function effectively. It is also estimated that S. cerevisiae shares 30% of its genome with humans, especially with regard to the genes involved in the cell cycle and repair systems. Its genome was completely sequenced in 1996 and consists of 16 chromosomes. The cell wall is thick in order to ensure the shape and integrity and is composed of three types of polymers: β-glucans, mannans and chitin. The 80-90% is represented by polysaccharides (glucans and mannans also branched) organized in micro fibrils; mannoproteins constitute the surface of the wall. They have cross-links mediated by hydrophobic interactions and / or disulfide bridges. Mannoproteins are also linked to the micro-glucan fibrils by covalent bonds. The 2-4% is represented instead of chitin, a polymer of n-acetylglucosamine that performs several functions, including: killer toxin receptor, maintaining the integrity and osmotic morphological ,scarring of budding.
S. cerevisiae can grow in a haploid or diploidstate. There are in fact three distinct cell types: a,α and a / α. The two haploid strains (a,α) can combine and form the diploid strain a / α that, in time of limiting nutrients, undergoes sporulation, generating haploid spores in a meiotic process. . The determination of the cell type is gene-dependent information present in the MAT locus. Cells that carry the allele MATa are type a and those that carry the allele MAT α are type α. Cells of opposite type can mate, while the cells of the same type can not. The recognition of opposite cell type occurs for secretion of pheromones.
1.5 Synthetic biology in yeast
Biological systemshavea great power to modify the world in various fields, such as sustainment, environment purification, and pharmaceutical, food and agricultural industries. Synthetic biology uses engineering principles and new technological tools to modify biological systemsbuilding up and implementing human-designed pathways, and to predictably produce a wide variety of metabolites. Metabolic engineering of microorganism rises important applications and it’s based on give new abilities not inherent to the microorganism such asproduction of artemisinic acid in engineered yeast [61], production of n-butanol in Saccharomyces cerevisiae[62], enhancements in production of fatty acid derived biofuels by using dynamic sensor- regulator system in E. coli [63]. These are few examples showing a way to transplant genes related to a specific biosynthetic pathway from natural to an heterologous host Figura 10The role of metabolomics in synthetic of secondary metabolism [81]
like E. coli or S. cerevisiae. Those implementations provide an alternative to traditional methods of producing metabolites giving faster and better results.
Into eukaryote host systems, yeast has a lot of benefits deriving from his unicellular behaviour, the easy wayof culture and genetic manipulations. Combine the fatc that it has a great capability for protein processing, post-translational modifications and protein folding; with a deep knowledge about its physiology, biochemistry and fermentation technologies, the lack of toxin production,S. cerevisiae, becames a suitable organism widely used for heterologous expression of secundary metabolism pathways or simply heterologous proteins in the field of cells engineering.
Due to its use in traditional biotechnology such as baking, brewing and wine making, in the food industry, S. cerevisiae, has been classified as GRAS (generally regarded as safe) .[64]
1.5.1DNA tools
The regulation of genes expression at the DNA level, and especially in yeast. Basically, can be done using several tools such as plasmids, yeast artificial chromosomes (YAC) or integrating heterologous genes via homologous recombination [65],[66].
Derived fromE. coli, different plasmids have been developed specifically for yeast, although they are lesser than the ones used in bacteria. Those plasmids have been successfully applied in metabolic engineering investigations [61] and can be classified into three different classes:
• YCp (yeast centromeric plasmid) vectors contain both an origin of replication and a centromere sequence. These two elements give YCp vectors high segregation stability in selective medium, while maintaining 1-2 copies per cell .[64]
• YEp (yeast episomal plasmid) vectors are maintained at more than 10 copies per cell. This type of vector harbors either a full version of S. cerevisiae native 2µ sequence orcommonly, a 2µ sequence including both the origin and the stability locus (STB), REB3. The latter ones are generally more stable in comparison to those which are carrying full 2µ sequence.[64] • YIps, yeast integrative plasmids, do not have any replication origin.
Therefore, they need to be integrated into the chromosome in order to maintain them in the cell. YIp vectors can be integrated into the genome via homologous recombination occurring between complementary target sites on both plasmid and genome. [64]
Both YCp and YEp vectors are easy to use, ideal for gene overexpression at low or high levels. Although plasmids offer a good and quick appraisal utilized in metabolic pathway building, the maintenance of two or more YCp (CEN/ARS) and/or YEp (2µ)vectors in a single cell can be hard. In addition, plasmids can carry a limited size of DNA molecule. However this limitation can be over pass by using yeast artificial chromosomes (YAC) which offer the chance to carry large DNA molecules (more than several Mbps).
YAC constructs, as YCp and YEp, require positive or negative selective pressure, to be maintained in long term cell culture. Chromosomal gene integration is, on
the other hand an efficient way to transform yeast thanks to its natural ability of making homologous recombination. In this work we used four different plasmids 2 YCp and 2 YEp belonging to a collection of 288 Saccharomyces cerevisiae Gateway vectors enabling the rapid and efficient generation of a variety of expression constructs. All of these vectors are available to the research community via Addgene.[67]
1.5.2 RNA regulation tools
Biological processes are regulated at the level of transcription but the second wayto control gene expression is by tune the transcription level. A lot of toolset for modulate RNA levels have been developed and they can be classified into two groups. The first group regulates directly the RNA level during the synthesis process by RNA polymerase using different promoters with promising desired effects, the second group controls the stability of RNA after being synthetized. In S. cerevisiaegene expression can be modulated by different promoters. They can have a costant activity or not. Most of the yeast glycolytic pathway genes in S. cerevisiae are controlled by constitutive promoters, for example TDH3, PGK1, PYK1 and TPI1. Gene expression cassettes have been developed allowing high expression levels during long-term cell culture.
Using constitutive promoters has several advantages such asan high and constant gene transcript levels, on the other hand tuning the expression level using different concentrations of molecules as iducer or repressor hasthe advantage of a specific gene response. A small number of regulated promoters have been found and employed in yeast. The most important are: MET25, MET3,CUP1,GAL1 and GAL10, which are induced in the presence of galactose and repressed using glucose as a carbon source [68].
Regulated promoters can be used to identify the best enzyme concentration in a specific pathway, they have a lot of intresting applications and are really easy to use. On the other hand they can showpleiotropic effects, activating other genes and giving rise to several problems; or they can be consumed by the cell, decreasing its concentration lowering transcript levels. In addition, the inducer molecules are typically expensive, and using inducible promoters may not be economical for industrial-scale fermentations. [64]
1.5.3 Yeast metabolic engineering: the terpenoid pathway
Isoprenoids (also known as terpenoids) belong to a vast group of secondary metabolites that include caroten- oids, sterols, polyprenyl alcohols, ubiquinone (coenzyme Q), heme A and prenylated proteins. They are of valuable commercial interest as food colorants and antioxidants (carotenoids), aroma and flavor enhancers (terpenes), nutraceuticals (ubiquinone), and antiparasitic and anti- carcinogenic compounds (taxol).
All isoprenoids are synthesized from a universal compound called isopentenyl diphosphate (IPP). In yeast, the mevalonate pathway is chiefly employed to form ergosterol (provitamin D2) which is an essential part of the yeast membrane and provides membrane permeability and fluidity. [69]
Extraction of terpenoids like artemisinin or taxol from natural sources is often low-yielding, inefficient, and dependent on unpredictable fluctuations in envi- ronmental conditions or external circumstances. Development of synthetic Figura 12Structures of some industrially interesting terpenoids or terpenoid precursorsbiosynthetically or semi-syntheticallyproduced by engineered yeaststrains.[70]
microbial production platforms for the biosynthesis of complex terpenoids provides a good alternative to the standard extraction methods, due to large-scale and cost-effective industrial production via fermentation, which is independent from climate and cultivation risks.
Several metabolic engineering approaches have been published in the last years for enhancing the production of mono-, sesqui- or diterpenoids in different host systems [70].
Prodoction of monoterpenoids it’s really intresting and needs to be investigated looking forward to our aim: Wild-type S. cerevisiae strains, with the notable exception of a few winemaking strains , do not produce monoterpenoids (C10-isoprenoids). In laboratory strains of S. cerevisiae, both geranyl- (GPP) and farnesyl-diphosphate (FPP) synthase activities are shared by one enzyme termed farnesyl diphosphate synthase (FPPS, Erg20p). For a long time it was thought that GPP is tightly bound to FPPS and cannot be released from the catalytic site leading to complete conversion to FPP. Analysis of a yeast strain with a K197E mutation in the catalytic site of Erg20p, however, exhibited unusual properties such as excreting prenyl alcohols like geraniol and linalool and synthesizing significantly longer dolichols than the wild-type strain [71].Monoterpenoid production capability of S. cerevisiae has been accomplished by co-expression of ,for example, geraniol or linalool synthases [72,73]. Oswald et al. demonstrated that, in addition to the ERG20 mutations described above, monoterpenoid production capacities could be further increased by co-expressing geraniol synthase (GES) from Ocimum basilicum (sweet basil) in S. cerevisiae [72]. Analysis revealed that the expression of GES had a suppressing effect on sterol biosynthesis, which was dependent on the genetic background of the wild-type strains[70]. Another example are Sesquiterpenoids ( C15 isoprenoids) used as
anticancers, flvours or antibiotics have been produced in yeast strains. There are several works have been published like the production of artemisin , an anti-malarian drug, modifying the mevalonate pathway in S.cerevisiae by overexpressing every enzymes involved and ERG20 [74] or the production of α-santalene a precoursor of α-santalol, one of the main components of East Indian sandalwood oil [75].
Figura 13Isoprenoid pathway in yeast and metabolic engineering strategies for production of interesting terpenoids. ADH6, alcohol dehydrogenase; ERG10, acetyl-CoA C-acetyltransferase; ERG13, hydroxymethylglutaryl-CoA synthase; HMG1/HMG2, hydroxymethylglutaryl-CoA reductase 1/2; ERG12, mevalonate kinase; ERG8, Phosphome- valonate kinase; ERG19, Mevalonate diphosphate decarboxylase; IPP, isopentenyl diphosphate; DMAPP, dimethylallyl diphosphate; GPP, geranyl diphosphate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; IDI1, isopentenyl diphosphate isomerase; ERG20, geranyl/farnesyl diphosphate synthase; BTS1, GGPP synthase; ERG9, squalene synthase; SeACS, Acetyl CoA synthase from Salmonella enterica [70].
Diterpenoids (C20-isoprenoids) are produced from geranylgera- nyl diphosphate (GGPP) by cyclisation and further metabolismyielding a variety of important compounds used as pharmaceuticals, agrichemicals or herbal medicines, such as paclitaxel (Taxol) which is used as efficient drug in cancer chemotherapy [70]. Paclitaxel is a complex diterpenoid containing three benzene rings in the molecule and was first isolated from the bark, roots, and branches of western yew, Taxus brevifolia. Due to inefficient and environmentally costly extraction of paclitaxel from natural sources, major focus in research was put on alternative methods, including chemical synthesis, plant cell culture strategies, microbial fermentation using endophytic fungi or metabolic engineering approaches using Escherichia coli or S. cerevisiae.Taxol has been produced engineering S. cerevisiae towards
the overexpression of the taxadiene synthase and tHMG genes in combination with a GGPP synthase gene from Sulfolobus acidocaldarius(SaGGPS).[76]
Carotenoids are mainly C40-isoprenoid pigments, synthesized in all phototrophic organisms such as plants, algae and cyanobacteria, but also in some non-phototrophic bacteria and fungi.
Due to their colours and health related benefits carotenoids are of high commercial interest as colorants, pharmaceuticals, and nutritional supplements or cosmetic additives.
The increasing industrial demand on carotenoids has led to extensive efforts in finding suitable natural sources and developing biotechnological processes, e.g. metabolic pathway engineering in plants, or carotenogenic or non-carotenogenic microorganisms for efficient production of novel carotenoids. Elucidation of a number of carotenoid biosynthetic pathways at a molecular level has provided a toolbox of carotenogenic (crt) genes that can be used to engineer microorganisms for carotenoid production. The over-expression of genes from the isoprenoid and carotenoid pathways for creating a stable, b-carotene producing S. cerevisiae strain. [77]
Recently, the non-carotenogenic yeast Pichia pastoris has been described as alternative host system for the production of lycopene, b-carotene and astaxanthin.[78]
1.6 Yeast and cannabinoids
Searching in literature words as cannabinoid and yeast does not produce any positive results.None, in fact, has built up the entirecannabinoids biosynthetic pathway in yeast. There are just two works available that combine yeast and cannabinoids:
The first one is a 2007 work made by Futoshi Taura et al.in wich they show how Pichia pastoris genetically transformed is able to produce the enzyme THC synthase, last step of the biosynthesis of cannabinoids. They also demonstrate that inserting THC precoursor (CBGA) in the mediaTHC can be obtained. In this case yeast is transformed with a secreting THCA synthase and the colture supernatant is able to produce THC from CBGA with a 98% conversion rate. The main problem is the fact that CBGA has a low solubility in the colture medium .[79]
In 2012 Steve J. Gane et al. identify the Olivetolic Acid ciclase from Cannabis sativa, in that work to demonstrate the capability of OAC to work together with OLS and generate Olivetolic Acid, Saccharomyces cerevisiaewas transformed with a pESC-TRP: OAC-OLS expressed respectly under control of GAL10 and GAL1 promoters. A four days colture was carried out under galactose condition with 1Mm Sodium Hexanoate. Olivetolic acid was obtained.[80]
The aim of the work
Cannabinoids can be a really interesting drug from a health and economical point of view. The main problem is the link between those compound toCannabis sativa, the plant in fact cannot be cultivated everywhere and it’s time, space, energy and water consuming. Our aim is to transfer cannabinoids pathway into S. cerevisiae arriving to THC production thus demonstrating that those genes identify in the plant are sufficient to led to THC. To do that we’re going to built four different vectors containing the four genes identify in Cannabis found in literature, than transform yeast and verify the presence of cannabinoids.
Material and Method 2.1 Yeast strain:
Yeast strain Saccharomyces cerevisiae W303 was bought from Thermo Scientific.1 The strain used in this work is the W303 Heterozygous Diploid : MATa/MATα
ura3-52/ura3-52 trp1Δ2/ trp1Δ2 leu2-3_112/ leu2-3_112 his3-11/ his3-11 ade2-1 can1-100/ ade2-1 can1-100
2.2 Transformation:
2.2.1 Entry vector preparation
Genomic DNA from Cannabis sativa has been extracted using “Wizard ® Genomic DNA Purification” Kit (Promega) following the manufacturer’s instructions, than evaluated with a spectrophotometer and eluted to a concentration of 100 ngL-1.
Four genes have been amplified by PCR using “GoTaq® Green Master Mix” (Promega).
Genes Primers:
Fw Rv
OLS olivetolic acid synthase CACCACTACCATTGCGCTAAGC TT
GATCAACATAGGCACATCCTTA TG
OAC olivetol synthase PKS CACCATGGCAGTGAAGCATTTG A
CTACTTTCGTGGTGTGTAGTCA A
GOT aromatic prenyltransferase GCAAAATCCTTCCACTGCAT ATGCAGTGGAAGGATTTTGC
THCAS THCA synthase CACCATGAATTGCTCAGCATTT
TC
TCAATGATGATGCGGTGGAAGA GGTG
PCR results were run into an electrophoresis agarose gel, and the bands were extracted using “GeneEluteTM Agarose Spin Column”(Promega) following the manufacturer’s instructions. A quantification of the eluates was performed.
DNA sequences were cloned into
pENTR/D-MOUSE (Life
Technologies), this kind of vector allows a directional insertion of PCR products built using a Fw primer that has a 5’- CACC extension.
E.coli competent cells were made using the Kit “One shot® Mach1TM-T1® Chemically competent E.coli “ (Life Technologies). 3µL of ligation product plus 50µL of competent cells were exposed to a thermal shock than grown into a LB rich media for 2 hours and plated on kanamicin plates at 37°C ON.
Using the Kit “PureYeldTM Plasmid Miniprep System”, plasmids were obtained
from E.coli colonies following the manufacturer’s instructions. A restriction analysis was performed to verify the presence of the four genes into the four vectors.
2.2.2 Destination vector preparation
Four different expression vectors compatible with the Getway® recombination-based cloning system were bought from Addgene2. Each entry vectors was
combined with a specific expression vector with an LR reaction using the Gateway® LR Clonase® II (Invitrogen) following the manufacturer’s instructions
Every vectors carry an inducible promoter GAL1, bacterial resistances to Ampicillin and Chloramphenicol, a ccdB cassette and four different selectable markers (HIS3,LEU2,URA3,TRP1).
- pAG414GAL-ccdB - pAG425GAL-ccdB - pAG413GAL-ccdB - pAG426GAL-ccdB
As before the four expression vectors were propagated into E.coli and extracted using the prep system.
.
2.2.4 Yeast cells transformation
W303 competent and transformed yeast cells were produced using the S.c. EasyCompTM Transformation Kit (Invitrogen). W303 yeast cells were transformed with one or more plasmids giving different W303 strains carrying different genes.
2.3 Culture condition
Yeast strains were grown at 30°C on plates or in 15 or 30 mL liquid media into batch depending on the type of the analysis needed to be done.
YPAD media:
Chemical Concentration
Bacto-yeast extract 1%
Bactopeptone 2%
Adenine hemi sulfate 0,02%
Agar 2% Dextrose 2% Selective media: Chemical Concentration Glucose Galactose Sugar 2% 6%
Yeast Nitrogen Base without aa 6,7g/L-1
Adenine hemi sulfate 0,02%
Agar 2%
Yeast Synthetic Nitrogen Base without aa 1,4gL-1
LEU URA TRP HIS
Amino acids (aa) :
6,25M 1,25M 2,5M 6,25M
W303 strains were grown one day at 30°C into 15 or 30 mL 2% Glucose liquid media adding amino acids depending on the plasmids the strain was carrying.
The induction phase for plasmids expression was done under galactose conditions. Cells were pelletted, washed with distilled water and transferred into 30 mL selective media containing 6% galactose in semi aerobic condition.
The maintenance of our several strain lines was made by plating them from the selective media to a non selective media YPAD than growing two days at 30°C and by storing them at 4°C.
2.4 Genes expression analysis
Total RNA was extracted from induced (Galactose 6%) cultured cells using the kit SpectrumTM Total RNA (Sigma), two solutions of the kit were hand made because they were not produced anymore by the manufacturer.
Enzyme stock solution:
Chemical Concentration
Glicerol 50%
Water 48,7%
Dipotassium hydrogen phosphate 1,14%
Lyticase 0,1%
Yeast lysis solution
Chemical Concentration
EDTA 0,001%
Glucitol 18,22%
Water 81,75%
RNA samples were checked for quality, quantified with a microdrop and treated RQ1 RNase-Free DNase (Promega) following the manufacturer’s instructions. First strand cDNA was synthesized using iScriptTM cDNA synthesis kit (Bio-Rad) following the manufacturer’s instructions. The thermal cycling of RT-PCR were as follows: stage I 10’’ at 50°C, Stage II 3’ at 95°C, stage III (x40) 5’’ at 95°C+30’’ at 60°C.
qPCR was carried out using the kit iTaqTM Universal SYBR® Green Supermix (BIORAD) and primers as it follows:
Genes Primers:
Fw Rv
OLS olivetolic acid synthase AGTCCCTCAGTGAAGCGTGT GCGCCTTTGTTATTCTCTGC
OAC olivetol synthase PKS AGCGCTTGGTCCAGTCATGT AAATGTCCCCATGCCTCCTT GOT aromatic prenyltransferase GCAAAATCCTTCCACTGCAT ATGCAGTGGAAGGATTTTGC
THCAS THCA synthase CCTGAAACTGCAATGGTCA TCTTCTCCCATGGATTTTCG
Gene expression level was calculated using ∆∆Ct [83], using UBC [84] as housekeeping gene.
2.4 Proteins extraction and SDS-page
Proteins extraction [85] was carried out at 4°C. 1g of each pellets, derived from induced liquid cultured, have been washed with 1 ml of distilled water, than homogenized with mortar and pestle.
100µL of distilled water and 100 µL of NaOH 0,6M were added, transferred into tubes and rest for 10’’. Tubes were centrifuged, supernatant was thrown away and 50 µL of SDS Buffer Biorad was added. Each tube was putted 3’’ at 95°C and the SDS-page gel was load. The gel is a Criterion™ XT gel from Biorad run (165 mA) with a running buffer containing MOPS 5,25g, Tris-HCl 3g, SDS 5g, EDTA 50 mM 10 mL, 0,1% of Sodium Bisulfite. After running, the gel was washed several times with milliQ water than fixed with a fixing solution 50% Methanol, 10% Acetic Acid and milliQ water 15’’ shaking, washed again with milliQ water and colored with EZ BlueTM Gel Staining reagent (Sigma).
2.5 Enzymatic assay
Total proteins were extracted homogenizing with mortar and pestle the pellet deriving from induced liquid culture adding a specific buffer composed by 60mM Tris-HCl ph 7,5, 2% SDS, 15% Sucrose, milliQ water and a protease inhibitor.
Tubes were centrifuged at 2000 rpm for 10’ at 4 °C and each supernatant was transferred in a new falcon tube and used with different mixture of precursor to test the production of cannabinoids. Protein concentration was verified with the Pierce BCA protein assay kit.
THCAS reaction mix contained 500µl CBGA stock solution (18mg of CBGA dissolved in 250ml of Na-citrate buffer pH 5.5 with 0.1% v/v Triton-X 100) and 500µl protein extract.
GOT reaction mix contained 60nmol olivetolic acid, 600 nmol GPP, 150µl protein extract and 325µl buffer K2HPO4.
Reaction mixtures were kept at 30°C for at least 2h, 30-50 rpm shaking. The reaction was stopped with an equal volume of MeOH.
Chemicals were purchased from Sigma-Aldrich CBGA and Olivetolic Acid were kindly given by GW-Pharma, directly extracted from Cannabis plants.
2.5.1 GC Analyses
Gas-chromatographic analyses were performed on a GC 7890 equipment by Agilent Technologies by Gw-Pharma with an autosampler and a flame ionization detector. The slightly polar column HP-5, 320µm×30µm, with 0.25-µm film was used for general quantitative analysis of larger sample loads.
Compound identities were determined by matching retention times with those of pure standards.
2.6 Cannabinoid production and extraction
W303-4T transformed strain was grown one day into 30 mL at 30°C into a 2% Glucose liquid media without amino acids.
The induction phase for plasmids expression was done under galactose conditions. Cells were pelletted, washed with distilled water and transferred into a selective media containing 6% galactose for 4 day in semi aerobic condition.
After four days growth cultures were collected by centrifugation. Supernatant and Pellet were extracted to obtain cannabinoids.
0.5 g of pellet was homogenized with mortar and pestle than 1 mL of absolute GC ethanol was added, mixed, filtered and placed in a new tube ready for the analysis. The four days growth culture supernatant was extracted using appropriated columns for SPE C18 Supelclean™ LC-18 SPE Tube.
2.7 GC-Mass analysis Standard preparation:
• Diluted Solution of CBGA 50 µl in 10 mL ethanol
• Standard Solution of Olivetolic Acid (OA) - concentrazione circa 50 mg/ml Figura 25 CBGA GC and Mass analysis
Ethanolic extracts of the pellets and supernatants were analized by GC-MS using a Clarus 500 gaschromatograph coupled with a Clarus 560S mass spectrometer (PerkinElmer Inc, Shelton, CT, USA). 1 ul of each extract was injected in splitless mode (2.5 min) using a Siltek liner (2mm internal diameter). Helium was used as carrier gas at 1 ml/min; the injector temperature was set at 90°C for 0.1 min and then immediately increased at 250°C until the end of the run. The GC oven temperature was initially set up at 50°C for 3 min and then increased up to 310°C (at 7,5°C/min rate) and held for 2.33 min; total run time was 40 min. The capillary column used was a DB-5ms, 30m lenght x 0.25 mm ID and 0.25 micron phase thickness. The MS range was set from 45 to 400 m/z value.
GC/ Mass Method :
• oven: 50°C x 3' --> 7.5°C/min --> 310°C (hold 2.33')
• injection: 1µL split 20 mL/min (iniezione in splitless per 2.5 min) - liner ID 2 mm Siltek
• injector: 1 ml/min; injection @ 90°C --> 260°C
Results
3.1 Generation of vectors and yeast transformation
OLS,OAC,GOT and THCAS were cloned from Cannabis sativa L. Using the gateway technology destinations vectors were developed which carry different genes responsible for prototophy restoration and therefore enabling selection. Each gene was under control of a GAL1 promoter meaning that genes would express only under galactose conditions. Combining entry vector with four Cannabis sativa genes and expression vectors we obtained four plasmids.
Figura 28 Yeast expression vectors: pAG414GAL-ccdB x pENTR-OAC
3. pAG413GAL-ccdB x pENTR-GOT:
Figura 30 Yeast expression vectors: pAG426GAL-ccdB x pENTR-THCAS
A restriction analysis was performed to verify the presence of the right inserts using enzymes SpeI and XhoI.
Plasmids were used to transform W303 yeast cells. Figura 31 Restriction Analysis of vectors
Different combinations of plasmids generated several W303 strains.
STRAIN NAME GENES Amino acids request to grow
4T OLS,OAC,GOT,THCAS No
3T OLS,OAC,GOT URA
2Ta OLS,OAC HIS,URA
2Tb GOT/THCAS LEU,TRP 1T OLS OAC GOT THCAS TRP,HIS,URA LEU,HIS,URA LEU,TRP,URA LEU,TRP,HIS 3.2 Yeast culture
A growth curve of Wt and 4T strains was made to verify possible differences in the growth ratio and to understand the growth trend identifying every phase (Lag phase, Exponential phase and Stationary phase) into selective media under glucose and galactose conditions.
Phonotypical differences were checked between Wt and 4T after the induction phase. 3.3 Gene expression evaluation
We made different experiments on different strains to analyze the expression of our vectors:
a. Afirst test was performed to check the expression of two vectors into three different strains: 1T-GOT; 1T-THCAS; 2T-THCAS/GOT.
Cells were grown one day in a 15 mL batch of selective media under 2% glucose condition than transferred under 6% galactose condition. RNA was extracted after 3 days of galactose growth condition and expression evaluated by qPCR.
b. A second experiment was carried out to evaluated the expression trend of four genes: OLS,OAC,GOT,THCAS with different time points in the 4T strain compared to Wt.
Cells were grown one day in a 30 mL batch of selective media under 2% glucose condition than transferred under 6% galactose condition. RNA was extracted after different time steps from the induction (4h,20h,28h,44h) and expression was checked by qPCR.
c. A third experiment was carried out to evaluated the expression trend of four genes: OLS,OAC,GOT,THCAS with shorter time steps in 4T strain compared to Wt. As before cells were grown one day in a 30 mL batch of selective media under 2% glucose condition than transferred under 6% galactose condition. RNA was extracted after different time steps from the induction (3h,6h,12h) and expression was checked by qPCR.
3.4 Protein detection
Wt 303 strain and 4T strain were grown under galactose conditions for 3 days. Protein extraction was carried out from pellets at different time points (4h,20h,28h,44h) and SDS- page was run. Total protein from Wt and 4T were compared. No differences were found. Antibodies were not available.
3.5 Enzymatic assay
4T strain and Wt lines protein extract was used to test the in vitro functionality of cannabinoids related enzymes. A crude protein extract was prepared and added to the compounds known to act as substrates in vivo. The reaction was stopped with methanol after two hours of incubation at 30 °C and samples were analyzed by gas chromatography analysis protocol optimized for cannabinoids. In all the cases we could not detect the expected product.
3.6 Cannabinoids detection:
Using GC-Mass Analysis differences between 4T strain and Wt strain after 4 days growth under galactose conditions were evaluated.
