FIGURE E TABELLE
C: Angiopatia amiloide
Figura 2: Processamento fisiologico e patologico della proteina precursore dell amiloide (APP). Nel riquadro a sinistra è schematizzata la via non
Figura 3: Ipotetico coinvolgimento del danno endoteliale nel fenomeno dell amiloidogenesi. EC= cellule endoteliali. APP=Proteina precursore dell amiloide.
Figura 4: Angiogenesi nella MA
Figura 5: Meccanismo di morte cellulare nella demenza vascolare. CBF=Flusso cerebrale sanguigno; ROS=specie reattive dell ossigeno.
Figura 6: Regione amplificata del promotore del gene VEGF contenente il sito polimorfico a livello del nucleotide 2578C/A (in grassetto). Le sequenze evidenziate in giallo rappresentano i primers utilizzati. I nucleotidi in rosso rappresentano l inserzione associata all allele A.
gggctgactaggtaagctccctggagcgttttggttaaattgagggaaattgctgcattcccattctcagtccatgcctc cacagaggctatgccagctgtaggccagaccctggcaCgatctgggtggataatcagactgactggcctcagagcccca actttgttccctggggcagcctggaaatagccaggtcagaaaccagc
Allele C (wild type): 206 pb
gggctgactaggtaagctccctggagcgttttggttaaattgagggaaattgctgcattcccattctcagtccatgcctc cacagaggctatgccagctgtaggccagaccctggcaAgatctgggtggataatcagactgactggtcccactcttccc acaggcctcagagccccaactttgttccctggggcagcctggaaatagccaggtcagaaaccagc
Figura 7: Regione amplificata del promotore del gene VEGF contenente il sito polimorfico a livello del nucleotide 1198 (in grassetto). In verde è
rappresentata la sequenza di riconoscimento dell enzima. ^ indica i siti di taglio.
tcctgctccctcctcgccaatgccccgc^gggcgcgtgtctctggacagagtttccgggggcggatgggtaattttcagg ctgtgaaccttggtggggtcgagcttccccttcattgcggcgggctgcgggcc^aggCttcactgggcgtccgcagagc ccgggcccgag^ccgcgtgtggaggggctgaggctcgcctgtccccgcc
sottoponendo a digestione enzimatica con HpyF10VI:
Allele C (wild type): 28, 106, 34, 37 Allele T (mutato): 28, 140, 37
Figura 8: Distribuzione dei genotipi 2578 (AA, AC, CC) nei tre gruppi oggetto di studio. 0 10 20 30 40 50 60 AA AC CC MA DV Controlli
Figura 9: Distribuzione degli alleli A e C del 2578 nei tre gruppi oggetto di studio. 0 10 20 30 40 50 60 70 MA DV Controlli A C
Figura 10: Distribuzione degli alleli E2, E3 ed E4 del gene dell ApoE nei tre gruppi oggetto di studio.
0 10 20 30 40 50 60 70 80 90 100 E2 E3 E4 MA DV Controlli
Tabella 1: Classificazione delle demenze
Demenze primarie o degenerative 1) demenza di Alzheimer
2) demenze frontotemporali e malattia di Pick 3) demenza a corpi di Lewy
4) Parkinson-demenza 5) corea di Huntington
6) paralisi sopranucleare progressiva 7) degenerazione corticobasale
Demenze secondarie
A) demenza vascolare ischemica B) disturbi endocrini e metabolici
1) ipo e ipertiroidismo
2) sindrome di Cushing e morbo di Addison
3) encefalopatia portosistemica in corso di epatopatia 4) insufficienza renale cronica
5) ipoglicemia
C) malattie metaboliche ereditarie
D) malattie infettive e infiammatorie del SNC
1) meningiti ed encefaliti (batterica, neurosifilide, micotica, virale) 2) sclerosi multipla e malattie demielinizzanti
3) connettiviti
4) malattia di Creutzfeldt-Jacob 5) AIDS dementia complex E) stati carenziali
1) carenza di tiamina (sindrome di Korsakoff) 2) carenza di vitamina B12 e di folati
3) malnutrizione generale F) sostanze tossiche 1) alcol 2) metalli pesanti 3) farmaci 4) composti organici G) processi espansivi intracranici
1) neoplasie, ematomi, ascessi cerebrali H) miscellanea
1) traumi cranici
2) sindromi paraneoplastiche
Tabella 2 : Distribuzione delle frequenze genotipiche e alleliche per il gruppo di pazienti con malattia di Alzheimer (MA) e il gruppo dei controlli
Genotipo Controlli n.(%) Pazienti MA n. (%) OR 95%CI 2 p VEGF/-2578 Tot = 96 Tot = 194 5.01 0.081 CC 29 (30.2) 65 (33.5) 1.0a -- AC 54 (56.3) 85 (43.8) 0.70 0.40-1.22 AA 13 (13.5) 44 (22.7) 1.51 0.71-3.22 Frequenza allele C 0.583 0.554 1.0a -- Frequenza allele A 0.417 0.446 1.13 0.64-1.67 0.504 VEGF/-2578
(Maschi) Tot = 38 Tot = 67 2.47 0.289 CC 12 (31.6) 23 (34.4) 1.0 a -- AC 19 (50.0) 24 (35.8) 0.66 0.26-1.66 AA 7 (18.4) 20 (29.8) 1.49 0.49-4.51 Frequenza allele C 0.565 0.522 1.0a -- Frequenza allele A 0.435 0.478 1.19 0.68-2.10 VEGF/-2578
(Femmine) Tot = 58 Tot =127 3.14 0.208 CC 17 (29.3) 42 (33.1) 1.0 a -- AC 35 (60.3) 61 (48.0) 0.71 0.35-1.42 AA 6 (10.4) 24 (18.9) 1.62 0.56-4.66 Frequenza allele C 0.594 0.523 1.0a -- Frequenza allele A 0.406 0.477 1.10 0.71-1.72
I valori di p e di 2 sono calcolati mediante analisi del Chi-quadro ( 2) (gradi di libertà =2)
Tabella 3 : Distribuzione delle frequenze genotipiche e alleliche per il gruppo di pazienti con demenza vascolare (DV) e il gruppo dei controlli
Genotipo Controlli n.(%) Pazienti DV n. (%) OR 95%CI 2 p Tot. 96 Tot. 23 VEGF/-2578 2.31 0.314 CC 29 (30.2) 9 (39.1) 1.0a -- AC 54 (56.3) 9 (39.1) 0.54 0.19-1.50 AA 13 (13.5) 5 (21.8) 1.24 0.35-4.48 Frequenza allele C 0.583 0.587 1.0a -- Frequenza allele A 0.417 0.413 0.99 0.51-1.89
I valori di p e di 2 sono calcolati mediante analisi del Chi-quadro ( 2) (gradi di libertà =2)
Tabella 4 : Distribuzioni delle frequenze genotipiche e alleliche (polimorfismo 2578 C/A del gene VEGF) in pazienti con malattia di Alzheimer (MA) e controlli osservate nel nostro studio e confrontate con quelle riportate in letteratura
0.658 43.0 44.0 0.538 48.0 47.0 <0.001 40.9 48.8 0.504 41.7 44.6 A 57.0 56.0 52.0 53.0 59.1 51.2 58.3 55.4 C 0.445 18.0 20.0 0,897 24.0 23.0 0,005 14.7 23.7 0,065 13.5 22.7 AA 49.0 47.0 49.0 47.0 52.4 50.2 56.3 43.8 AC 33.0 33.0 27.0 30.0 32.9 26.1 30.2 33.5 CC p Controlli % n=428 Pz. MA % n=362
p Controlli % n=631 Pz. MA % n=601 p Controlli % n=347 Pz. MA % n=249 p Controlli % n=96 Pz. MA % n=194 -2578 Mateo et al., 2006 Chapuis et al., 2005 Del Bo et al., 2005 Tesi
BIBLIOGRAFIA
Agarwal S, Sohal RS. Differential oxidative damage to mitochondrial proteins during aging. Mech. Ageing. Dev. 1995; 85 (1): 55-63.
Aguero-Torres H, Fratiglioni L, Winblad B. Natural history of Alzheimer s disease and other dementias: review of the literature in the light of the findings from the Kungsholmen Project. Int. J. Geriatr. Psychiatry 1998; 13 (11): 755-766.
Alvarez V, Alvarez A, Lahoz CH, Martinez C, Pena J, Guisasola LM, Salas-Puig J, Moris G, Uria D, Menes BB, Ribacoba R, Vidal JA, Sanchez JM, Coto E. Association between an alpha(2) macroglobulin DNA polymorphism and late-onset Alzheimer s disease. Biochem. Biophys. Res. Commun. 1999; 264: 48 50.
Bates DO, Jones RO. The role of vascular endothelial growth factor in wound healing.
Int. J. Low. Extrem. Wounds. 2003; 2 (2): 107-120.
Beck JA, Janssen JC, Campbell TA, Dickinson A, Fox NC, Harvey RJ, Houlden H, Rossor MN, Collinge J. Early onset familial Alzheimer's disease: Mutation frequency in 31 families. Neurology 2003; 60 (2): 235-239.
Benjamin LE, Golijanin D, Itin A, Pode D, Keshet E. Selective ablation of immature blood vessels in established human tumors follows vascular endothelial growth factor withdrawal. J. Clin. Invest. 1999; 103: 159 165.
Bertram L., Tanzi R.E. The current status of Alzheimer's disease genetics: what do we tell the patients? Pharmacol. Res. 2004; 50 (4): 385-396
Bianchetti A. Le demenze. WHO Mental Healt Bullettin. Monografia. Ed. Folini, 2000. Blacker D, Wilcox MA, Laird NM, Rodes L, Horvath SM, Go RC, Perry R, Watson B Jr, Bassett SS, McInnis MG, Albert MS, Hyman BT, Tanzi RE. Alpha-2 macroglobulin is genetically associated with Alzheimer disease. Nat. Genet. 1998; 19: 357 360.
Blennow K, De Leon M, Zetterberg H. Alzheimer s disease. Lancet 2006; 368: 387- 403.
Boero JA, Ascher J, Arregui A. Increased brain capillaries in chronic hypoxia. J. Appl.
Physiol. 1999; 86: 1211-1219.
Bowen D, Francis P. Neurochemistry, neuropharmacology, and aetiological factors in Alzheimer s disease. Semin. Neurosci. 1990; 2: 101-108.
Braunwald E, Fauci AS, Kasher DL, Hanser SL, Longo DL, Janeson JL. In Harrison: principi di medicina interna. EDS McGraw-Hill 2001.
Breteler MMB, Claus JJ, Grobbee DE, Hofman A. Cardiovascular disease and distribution of cognitive function in elderly people: the Rotterdam study. Br. Med. J. 1994; 208: 1604-1608.
Brogan IJ, Khan N, Isaac K, Hutchinson JA, Pravica V, Hutchinson IV. Novel polymorphisms in the promoter and 5' UTR regions of the human vascular endothelial growth factor gene. Hum. Immunol. 1999; 60 (12): 1245-1249.
Broxmeyer HE, Cooper S, Li ZH, Lu L, Song HY, Kwon BS, Warren RE, Donner DB. Myeloid progenitor cell regulatory effects of vascular endothelial cell growth factor.
Int. J. Hematol. 1995; 62 (4): 203-215.
Broxmeyer, HE, Cooper S, Li ZH, Lu L, Song HY, Kwon BS, Warren RE, Donner DB. Myeloid progenitor cell regulatory effects of vascular endothelial cell growth factor. Int
J. Hematol. 1995; 62: 203-215.
Buee L, Hof PR, Delacourte A. Brain microvascular changes in Alzheimer's disease and other dementias. Ann. N. Y. Acad. Sci. 1997; 826: 7-24.
Buee L, Hof PR, Roberts DD, Delacourte A, Morrison JH, Fillit HM. Immunohistochemical identification of thrombospondin in normal human brain and in Alzheimer s disease. Am. J. Pathol. 1992; 141 (4): 783-738.
Campion D, Dumanchin C, Hannequin D, Dubois B, Belliard S, Puel M, Thomas- Anterion C, Michon A, Martin C, Charbonnier F, Raux G, Camuzat A, Penet C, Mesnage V, Martinez M, Cernak I, Savic VJ, Kotur J, Prokic V, Veljiovic M, Grbovic D. Characterization of plasma magnesium concentration and oxidative stress following graded traumatic brain injury in humans. J. Neurotrauma 2000; 17: 53-68.
Campion D., Dumanchin C., Hannequin D., Dubois B., Belliard S., Puel M., Thomas- Anterion C., Michon A., Martin C., Charbonnier F., Raux G., Camuzat A., Penet C., Mesnage V., Martinez M., Clerget-Darpoux F., Brice A., Frebourg T. Early-onset autosomal dominant Alzheimer disease: prevalence, genetic heterogeneity, and mutation spectrum. Am. J. Hum. Genet. 1999; 65(3): 664 670.
Cao L, Jiao X, Zuzga DS, Liu Y, Fong DM, Young D, During MJ. VEGF links hippocampal activity with neurogenesis, learning and memory. Nat. Genet. 2004; 36 (8): 827-835.
Carmeliet P, Mackman N, Moons L, Luther T, Gressens P, Van Vlaenderen I, Demunck H, Kasper M, Breier G, Evrard P, Muller M, Risau W, Edgington T, Collen D. Role of tissue factor in embryonic blood vessel development. Nature. 1996; 383 (6595): 73-75.
Carmeliet P, Storkebaum E. Vascular and neuronal effects of VEGF in the nervous system: implications for neurological disorders. Semin. Cell Dev. Biol. 2002; 13 (1): 39-53.
Chapuis J, Tian J, Shi J, Bensemain D, Cottel D, Lendon C, Amouyel P, Mann D, Lambert JC. Association study of the vascular endothelial growth factor gene with the risk of developing Alzheimer s disease. Neurobiol. Aging. 2006; 27 (9): 1212-1215.
Chong ZZ, Li F, Maiese K. Oxidative stress in the brain: novel cellular targets that govern survival during neurodegenerative disease. Prog. Neurobiol. 2005; 75 (3): 207- 246.
Christen Y. Oxidative stress and Alzheimer disease and Alzheimer disease. Am. J. Clin.
Nutr. 2000; 71 (2): 621S-629S.
Ciallella JR, Figueiredo H, Smith-Swintosky V, Mc Gillis JP. Thrombin induces surface and intracellular secretion of amyloid precursor protein from human endothelial cells. Thromb. Haemost. 1999; 81: 630-637.
Clauss M. Molecular biology of the VEGF and the VEGF receptor family. Semin.
Thromb. Hemost. 2000; 26: 561-569.
Collins JS, Perry RT, Watson B Jr, Harrell LE, Acton RT, Blacker D, Albert MS, Tanzi RE, Bassett SS, McInnis MG, Campbell RD, Go RC. Association of a haplotype for tumor necrosis factor in siblings with late-onset Alzheimer disease: the NIMH Alzheimer Disease Genetics Initiative. Am. J. Med. Genet. 2000; 96: 823 830.
Corbo R.M., Scacchi R. Apolipoprotein E (APOE) allele distribution in the world. Is APOE*4 a 'thrifty' allele? Ann. Hum. Genet. 1999; 63 (Pt 4):301-310.
Coyle J, Price D, De Long M. Alzheimer s disease: a disorder of cortical cholinergic innervation. Science 1983; 219: 1184-1190.
Cracowski JL, Durand T, Bessard G. Isoprostanes as a biomarker of lipid peroxidation in humans: physiology, pharmacology and clinical implications. Trends Pharmacol.
Sci. 2002; 23 (8): 360-366.
Cullum CM, Rosemberg RN. Memory loss-when is Alzheimer disease? JAMA 1998; 279 (21): 1689-1690.
Cummings JL, Cole G. Alzheimer disease. JAMA 2002; 287: 2335-2338.
Cutter WJ, Norbury R, Murphy DG. Oestrogen, brain function, and neuropsychiatric disorders. J. Neurol. Neurosurg. Psychiatry 2003; 74 (7): 837-840.
Davies P, Maloney AJR. Selective loss of central cholinergic neurons in Alzheimer s disease. Lancet 1976; 2: 1403-1405.
de Leon MJ, Convit A, DeSanti S, Bobinski M, George AE, Wisniewski HM, Rusinek H, Carroll R, Saint Louis LA. Contribution of structural neuroimaging to the early diagnosis of Alzheimer's disease. Int. Psychogeriatr. 1997; 9 (Suppl. 1): 183-190. Del Bo R, Scarlato M, Ghezzi S, Martinelli Boneschi F, Fenoglio C, Galbiati S, Virgilio R, Galimberti D, Galimberti G, Crimi M, Ferrarese C, Scarpini E, Bresolin N, Comi GP. Vascular endothelial growth factor gene variability is associated with increased risk for AD. Ann. Neurol. 2005; 57: 373 80.
Dooley M, Lamb HM. Donepezil: a review of its use in Alzheimer s disease. Drugs
Dor Y, Porat R, Keshet E. Vascular endothelial growth factor and vascular adjustments to perturbations in oxygen homeostasis. Am. J. Physiol. 2001; 280: C1367 C1374. Douglas R. AD, drinking water and aluminium content. Australasian. J. Ageing 1998; 17: 2-3.
Dvorak HF, Brown LF, Detmar M, Dvorak AM. Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis. Am. J.
Pathol. 1995; 146: 1029 1039.
Erkinjuntti T, Lee DH, Gao F, Steenhuis R, Eliasziw M, Fry R, Merskey H, Hachinski C. Temporal lobe atrophy on magnetic resonance imaging in the diagnosis of early Alzheimer's disease. Arch. Neurol. 1993; 50 (3): 305-310.
Esterbauer H, Cheeseman KH. Determination of aldehydic lipid peroxidation products: malonaldehyde and 4-hydroxynonenal. Methods Enzymol. 1990; 186: 407-421.
Esterbauer H, Schaur RJ, Zollner H. Chemestry and biochemestry of 4- hydroxynonenal, malonaldehyde and related aldehydes. Free Radic. Biol. Med. 1991; 11: 81-128.
Ferrara N, Davis-Smyth T. The biology of vascular endothelial growth factor. Endocr.
Rev. 1997; 18 (1): 4-25.
Ferrara N, Frantz G, LeCouter J, Dillart-Telm L, Pham T, Draksharapu A, Giordano T, Peale F. Differential expression of the angiogenic factor genes VEGF and EG-VEGF in normal and polycystic human ovaries. Am J. Pathol. 2003; 162: 1881 1893.
Ferrara N.Vascular endothelial growth factor. Eur. J. Cancer. 1996; 32A (14): 2413- 2422.
Ferri CP, Prince M, Brayne C, Brodaty H, Fratiglioni L, Ganguli M, Hall K, Hasegawa K, Hendrie H, Huang Y, Jorm A, Mathers C, Menezes PR, Rimmer E, Scazufca M; Alzheimer's Disease International. Global prevalence of dementia: a Delphi consensus study. Lancet 2005; 366: 2112 2117.
Fillit H, Ding WH, Buee L, Kalman J, Altstiel L, Lawlor B, Wolf-Klein G. Elevated circulating tumor necrosis factor levels in Alzheimer's disease. Neurosci. Lett.. 1991; 129 (2): 318-320.
Foy CJ, Passmore AP, Vahidassr MD, Young IS, Lawson JT. Plasma chain-breaking antioxidants in Alzheimer's disease, vascular dementia and Parkinson's disease. QJM. 1999; 92 (1): 39-45.
Francis P. Targeting cell death in dementia. Alzheimer Dis. Assoc. Disord. 2006; (20): S3-S7.
Gerber HP, Dixit V, Ferrara N. Vascular endothelial growth factor induces expression of the antiapoptotic proteins Bcl-2 and A1 in vascular endothelial cells. J. Bio. Chem. 1998; 273: 13313 13316.
Gerber HP, McMurtrey A, Kowalski J, Yan M, Keyt BA, Dixit V, Ferrara N. VEGF regulates endothelial cell survival by the PI3-kinase/Akt signal transduction pathway. Requirement for Flk-1/KDR activation. J. Biol. Chem. 1998; 273: 30336 30343. Gilmor ML, Erickson JD, Varoqui H. Preservation of nucleus basalis neurons containing choline acetyltransferase and the vesicular acetylcoline transporter in the elderly with mild cognitive impairtment and early Alzheimer s disease. J. Comp.
Neurol. 1999; 411: 693-704.
Glenner GG, Wong CW. Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochem. Biophys. Res.
Commun. 1984; 120 (3): 885-890.
Goate A, Chartier-Harlin MC, Mullan M, Brown J, Crawford F, Fidani L, Giuffra L, Haynes A, Irving N, James L, et al. Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer s disease. Nature 1991; 349: 704 706. Grugel S, Finkenzeller G, Weindel K, Barleon B, Marme D. Both v-Ha-Ras and v-Raf stimulate expression of the vascular endothelial growth factor in NIH 3T3 cells. J. Biol.
Chem. 1995; 270: 25915 25919.
Hachinski VC, Lassen NA, Marshall J. Multiinfarct dementia. A cause of mental deterioration in the elderly. Lancet 1974; 2: 207-210.
Harik SI, Hritz MA, La Manna JC. Hypoxia-induced brain angiogenesis in the adult rat. J. Physiol. (London) 1995; 485: 525-530.
Harman D. Aging: a theory based on free radical and radiation chemistry. J. Gerontol. 1956; 11 (3): 298-300.
Harman D. Free radical theory of aging. Mutat Res. 1992; 275(3-6):257-266.
Hèbert R, Brayne C. Epidemiology of vascular dementia. Neuroepidemiology 1995; 14: 240-257.
Hensley K, Hall N, Subramaniam R, Cole P, Harris M, Aksenova M, Gabbita SP, Wu JF, Carney JM. Brain regional correspondence between Alzheimer s disease histopathology and biomarkers of protein oxidation. J. Neurochem. 1995; 65: 2146- 2156.
Houck KA, Ferrara N, Winer J, Cachianes G, Li B, Leung DW. The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol. Endocrinol. 1991; 5: 1806 1814. Howell WM, Ali S, Rose-Zerilli MJ, Ye S. VEGF polymorphisms and severity of atherosclerosis. J. Med. Genet. 2005; 42 (6): 485-490.
Hung T, Mak K, Fong K. A specificity enhancer for polymerase chain reaction. Nucl.
Iadecola C. Cerebrovascular Effects of Amyloid-ß Peptides: Mechanisms and Implications for Alzheimer s Dementia. Cellular and Molecular Neurobiology 2003; 23 (4-5): 681-69.
in t' Veld BA, Ruitenberg A, Hofman A, Launer LJ, van Duijn CM, Stijnen T, Breteler MM, Stricker BH. Non steroidal antiinfiammatory drugs and the risk of Alzheimer disease. N. Engl. J. Med. 2001; 345: 1515-1521.
Jellinger KA, Paulus W, Wrocklage C, Litvan I. Effects of closed traumatic brain injury and genetic factors on the development of Alzheimer's disease. Eur. J. Neurol. 2001; 8: 707-710.
Jin KL, Mao XO, Greenberg DA. Vascular endothelial growth factor: direct neuroprotective effect in vitro ischemia. Proc Natl Acad Sci USA 2000; 97 (18): 10242-10247.
Joseph J, Shukitt-Hale B, Denisova NA, Martin A, Perry G, Smith MA. Copernicus revisited: amyloid beta in Alzheimer's disease. Neurobiol. Aging. 2001; 22 (1): 131- 146.
Kalaria RN, Cohen DL, Premkumar DR, Nag S, La Manna JC, Lust WD. Vascular endothelial growth factor in Alzheimer s disease and experimental cerebral ischemia.
Brain Res. Mol. Brain Res. 1998; 62: 101 105.
Keyt BA, Berleau LT, Nguyen HV, Chen H, Heinsohn H, Vandlen R, Ferrara N. The carboxyl-terminal domain (111 165) of vascular endothelial growth factor is critical for its mitogenic potency. J. Biol. Chem. 1996; (271): 7788 7795.
Knopman DS, DeKosky ST, Cummings JL, Chui H, Corey Bloom J, Relkin N, Small GW, Miller B, Stevens JC. Practice parameter: diagnosis of dementia (an evidence- based review). Report of the Quality Standards Subcommittee of the American Academy of Neurology. Neurology 2001; 56 (9): 1143-1153.
Koo EH, Squazzo SL. Evidence that production and release of amyloid beta-protein involves the endocytic pathway J. Biol. Chem. 1994; 269 (26): 17386-17389.
Kovacs DM, Fausett HJ, Page KJ, Kim TW, Moir RD, Merriam DE, Hollister RD, Hallmark OG, Mancini R, Felsenstein KH, Hyman BT, Tanzi RE, Wasco W. Alzheimer-associated presenilins 1 and 2: neuronal expression in brain and localization to intracellular membranes in mammalian cells. Nat. Med. 1996; 2 (2): 224-229.
Kowalska A. Genetic basis of neurodegeneration in familial Alzheimer's disease. Pol J
Pharmacol. 2004; 56 (2): 171-178.
Krum JM, Rosenstein JM. VEGF mRNA and its receptor flt-1 are expressed in reactive astrocytes following neural grafting and tumor cell implantation in the adult CNS. Exp. Neurol. 1998; 154 (1): 57-65.
Lamb HM, Goa KL. Rivastigmine: a pharmacoeconomic review of its use in Alzheimer s disease. Pharmacoeconomics 2001; 19: 303-318.
Lambert JC, Coyle N, Lendon C. The allelic modulation of apolipoprotein E expression by oestrogen: potential relevance for Alzheimer s disease. J. Med. Genet. 2004; 41: 104-112.
Lambrechts D, Storkebaum E, Morimoto M, Del Favero J, Desmet F, Marklund SL, Wyns S, Thijs V, Andersson J, Van M, I, Al Chalabi A, Bornes S, Musson R, Hansen V, Beckman L, Adolfsson R, Pall HS, Prats H, Vermeire S, Rutgeerts P, Katayama S, Awata T, Leigh N, Lang-Lazdunski L, Dewerchin M, Shaw C, Moons L, Vlietinck R, Morrison KE, Robberecht W, Van Broeckhoven C, Collen D, Andersen PM, Carmeliet P. VEGF is a modifier of amyotrophic lateral sclerosis in mice and humans and protects motoneurons against ischemic death. Nat Genet 2003; 34: 383-394.
Lennmyr F, Ata KA, Funa K, Olsson Y, Terent A. Expression of vascular endothelial growth factor (VEGF) and its receptors (Flt-1 and Flk-1) following permanent and transient occlusion of the middle cerebral artery in the rat. J. Neuropathol. Exp. Neurol. 1998; 57 (9): 874-882.
Li F, Calingasan NY, Yu F, Mauck WM, Toidze M, Almeida CG, Takahashi RH, Carlson GA, Flint Beal M, Lin MT, Gouras GK. Increased plaque burden in brains of APP mutant MnSOD heterozygous knockout mice. J. Neurochem. 2004; 89 (5): 1308- 1312.
Liao A, Nitsch RM, Greenberg SM, Finckh U, Blacker D, Albert M, Rebeck GW, Gomez-Isla T, Clatworthy A, Binetti G, Hock C, Mueller-Thomsen T, Mann U, Zuchowski K, Beisiegel U, Staehelin H, Growdon JH, Tanzi RE, Hyman BT. Genetic association of an alpha2-macroglobulin (Val1000lle) polymorphism and Alzheimer s disease. Hum. Mol. Genet. 1998; 7: 1953 1956.
Lim A, Tsuang D, Kukull W, Nochlin D, Leverenz J, McCormick W, Bowen J, Teri L, Thompson J, Peskind ER. Clinic-neuropathological correlation of Alzheimer disease in a community-based case series. J. Am. Geriatr. Soc. 1999; 47: 564-569.
Liu F, Lau BH, Peng Q, Shah V. Pycnogenol protects vascular endothelial cells from beta-amyloid-induced injury. Biol. Pharm. Bull. 2000; 23: 735 737.
Lobo A, Saz P, Marcos G, Dia JL, De-la-Camara C. The prevalence of dementia and depression in the elderly community in a southern European population. The Zaragoza study. Arch. Gen. Psychiatry 1995; 52: 497-506.
Loeb C, Favale E. Neurologia di Fazio Loeb. Società Editrice Universo, 2003.
Looi JC, Sachdev PS. Differentiation of vascular dementia from AD on neuropsychological tests. Neurology1999; 53 (4): 670-678.
Luchsinger JA, Mayeux R. Dietary factors and Alzheimer s disease. Lancet Neurol. 2004; 3: 579 587.
Mahley RW, Rall Jr SC. Apolipoprotein E: far more than a lipid transport protein.
Annu. Rev. Genomics Hum. Genet. 2000; 1: 507-537.
Manuale diagnostico dei disturbi mentali; DSM IV 1994.
Marcus DL, Thomas C, Rodriguez C, Simberkoff K, Tsai JS, Strafaci JA, Freedman ML. Increased peroxidation and reduced antioxidant enzyme activity in Alzheimer s disease. Exp. Neurol. 1998; 150: 40-44.
Markesbery WR. Oxidative stress hypothesis in Alzheimer's disease. Free Radic. Biol.
Med. 1997; 23 (1): 134-147.
Marti HJH, Bernaudin M, Bellail A. Hypoxia-induced vascular endothelial growth factor expression precedes neovascularization after cerebral ischemia. Am. J. Pathol. 2000; 156: 965-976.
Marti HJH, Bernaudin M, Petit E. Neuroprotection and angiogenesis: A dual role of erythropoietin in brain ischemia. News Physiol. Sci. 2000; 15: 225-229.
Marti HJH, Risau W. Systemic hypoxia changes the organ-specific distribution of vascular endothelial growth factor and its receptors. Proc. Natl. Acad. Sci. USA 1998; 95: 15809-15814.
Mateo I, Llorca J, Infante J, Rodrìguez-Rodriguez E, Sànchez-Quintana C, Sànchez- Juan P, berciano J, Combarros O. Case-control study of vascular endothelial growth factor (VEGF) genetic variability in Alzheimer's disease. Neuroscience Letters 2006; 401 (1-2): 171-173.
Matsumoto K, Yoshitomi H, Rossant J, Zaret KS. Liver organogenesis promoted by endothelial cells prior to vascular function. Science 2001; 294: 559 563.
Matsuzaki H, Tamatani M, Yamaguchi A, Namikawa K, Kiyama H, Vitek MP. Vascular endothelial growth factor rescues hippocampal neurons from glutamate- induced toxicity: Signal transduction cascades. FASEB J. 2001; 15: 1218-1220.
Mayeux R, Ottman R, Maestre G, Ngai C, Tang MX, Ginsberg H, Chun M, Tycko B, Shelanski M. Synergistic effects of traumatic head injury and apolipoprotein-epsilon 4 in pazients with Alzheimer's disease. Neurology 1995; 45: 555-557.
Mayeux R. Epidemiology of neurodegeneration. Annu. Rev. Neurosci. 2003; 26: 81 104.
Mc Khann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM. Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology 1984; 34 (7): 939-944.
McGeer PL, McGeer EG. The inflammatory response system of brain: implications for therapy of Alzheimer and other neurodegenerative diseases. Brain. Res. Rev. 1995; 21 (2): 195-218.
Mecocci P, Cherubini A, Senin U. Invecchiamento celebrale, declino cognitivo, demenza, un continuum? Critical Medicine Publishing, 2002.
Mecocci P, Mac Garvey U, Beal MF. Oxidative damage to mitochondrial DNA is increased in Alzheimer's disease. Ann. Neurol. 1994; 36 (5): 747-751.
Meda L, Baron P, Scarlato G. Glial activation in Alzheimer's disease: the role of Abeta and its associated proteins. Neurobiol. Aging 2001; 22 (6): 885-893.
Mergenthaler P, Dirnagl U, Meisel A. Pathophysiology of stroke: lessons from animal models. Metab. Brain Dis. 2004; 19: 151 167.
Miyakawa T. Electron microscopy of amyloid fibrils and microvessels. Ann N. Y. Acad.
Sci. 1997; 826: 25 34.
Mortimer JA, Snowdon DA, Markesbery WR. Head circumference, education and risk of dementia: findings from the Nun Study. J. Clin. Exp. Neuropsychol 2003; 25: 671 679.
Mullan M., Houlden H., Windelspecht M., Fidani L., Lombardi C., Diaz P., et al. A locus for familial early-onset Alzheimer's disease on the long arm of chromosome 14, proximal to the alpha 1-antichymotrypsin gene. Nat. Genet. 1992; 2(4): 340-342. Mullis KB, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp.
Quant. Biol. 1986; 51 (Pt 1): 263-273.
Mullis KB, Faloona FA. Specific synthesis of DNA in vitro via a polymerase- catalyzed chain reaction. Methods Enzymol. 1987; 155: 335-350.
Mulnard RA, Corrada MM, Kawas CH. Estrogen replacement therapy, Alzheimer's disease, and mild cognitive impairment. Curr. Neurol. Neurosci. Rep. 2004; 4 (5): 368- 373.
Mulnard RA, Cotman CW, Kawas C, van Dyck CH, Sano M, Doody R, Koss E, Pfeiffer E, Jin S, Gamst A, Grundman M, Thomas R, Thal LJ. Estrogen replacement therapy for treatment of mild to moderate Alzheimer disease: a randomized controlled trial. Alzheimer s disease Cooperate study. JAMA 2000; 283 (8): 1007-1015.
Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial growth factor (VEGF) and its receptors. Faseb J. 1999; 13 (1): 9 22.
Nilsberth C., Westlind-Danielsson A., Eckman C.B., Condron M.M., Axelman K., Forsell C., Stenh C., Luthman ., Teplow D.B., Younkin S.G., Näslund J., Lannfelt L. The 'Arctic' APP mutation (E693G) causes Alzheimer's disease by enhanced A protofibril formation. Nat. Neurosci. 2001; 887-893.
Nishiyama M, Kato Y, Hashimoto M, Yukawa S, Omori K. Apolipoprotein E, methylenetetrahydrofolate reductase (MTHFR) mutation and the risk of senile dementia an epidemiological study using the polymerase chain reaction (PCR) method. J.