Production and <i>in vitro</i> manipulation of oncogenic animal papillomaviruses

(1)

Dipartimento di Scienze Biomediche

INTERNATIONAL PhD SCHOOL IN BIOMOLECULAR AND BIOTECHNOLOGICAL SCIENCES

Indirizzo: Microbiologia ed Immunologia XXVIII CICLO

Direttore Prof. Leonardo A. Sechi

PRODUCTION AND IN VITRO MANIPULATION OF

ONCOGENIC ANIMAL PAPILLOMAVIRUSES

Tutor PhD student

Prof. Alberto Alberti Gian Mario Dore

(2)

Gian Mario Dore

Production and in vitro manipulation of oncogenic animal Papillomaviruses International PhD School in Biomolecular and Biotechnological Sciences

University of Sassari

Acknowledgments

(3)

Gian Mario Dore

Abstract

Papillomaviruses are a diverse group of small, non-enveloped, double stranded DNA viruses that cause proliferations of the stratified squamous epithelium of the skin and mucosa in a wide variety of vertebrate hosts. Papillomaviruses play an important role in human cancer development, and have been isolated from a number of animal malignancies. This project focuses on the recently described ovine papillomavirus OaPV3, a virus associated with squamous cell carcinoma (SCC) in sheep.

Like all papillomaviruses, OaPV3 is characterised by the inability to productively infect replicating cells in culture, this hampering studies on infection, biological cycle, and isolation. Therefore, we generated OaPV3-based non-infectious virus-like particles (VLPs) through expression of the viral L1 major capsid protein in insect cells, using recombinant baculoviruses. Also, infectious OaPV3 pseudovirions (PsVs) have been produced, that can transduce reporter genes in 293TT cells.

VLPs were used to develop an ELISA test for measuring the presence of antibodies in immunized and naturally infected sheep, as well as to produce sera and monoclonal antibodies useful for detecting OaPV antigens in direct diagnosis and as specific assay controls. OaPV3 pseudovirions were also produced and used in infection and neutralisation assays with sera and monoclonal antibodies raised against VLPs, to investigate the potential of OaPV3 virus-like particles as vaccines candidates.

Developed tools will be useful to improve general knowledge on OaPV3 interaction with the natural host, and to investigate the viral biological cycle and pathogenesis.

(8)

Gian Mario Dore

1. INTRODUCTION

1.1 Papillomavirus

Papillomaviruses (PVs), belonging to the family Papillomaviridae, are small, double stranded epitheliotropic DNA viruses that can be subdivided based on their ability to infect either mucosal or cutaneous keratinocytes. Most of the kown and genetically characterized papillomavirus types have been isolated from human, with 178 HPV types currently listed as Reference Genomes of human papillomaviruses in the PApillomaVirus Episteme (http://pave.niaid.nih.gov). A comparable genotype diversity has not yet been discovered in single animal species, in fact, the 137 (PAVE database) animal papillomaviruses identified to date were recovered from 54 different host species, belonging to 16 taxonomic orders, and these include mostly mammals but also 3 bird species and 3 reptiles (Rector and Van Ranst 2013).

The direct link between papillomavirus infection and neoplasia, and the relationship between virus and environmental co-carcinogens was first established in animal papillomaviruses studies, regarding in particular the cottontail rabbit papillomavirus (CRPV), BPV, and the canine oral papillomavirus (COPV) (Campo 2002).

Human papillomaviruses (HPVs) infect skin or mucosa of the anogenital and respiratory tracts and are therefore divided into cutaneous and mucosal types. In particular, mucosal HPV are classified in two groups of viruses based on their pathogenic effect, (zur Hausen 1991):

• “High risk” viruses which can cause invasive carcinomas and intraepithelial lesions (e.g. HPV16 /18 / 31 /4)

• “Low risk” viruses causing benign proliferating lesions (common warts), and considered as low risk viruses in the progression to invasive tumours (e.g. HPV6 /11).

Among cutaneous types, the initial evidence for a role for cutaneous HPVs in the pathogenesis of skin malignancies came from the identification of HPV5 and HPV8 from patients with epidermodysplasia verruciformis (EV), a rare genetic condition characterized by diffuse, wart-like lesions over broad areas of the skin that frequently develop into carcinomas early in life (Farzan et al. 2013). It is assumend that PVs are strictly epitheliotropic and are characterized by strict host- and tissue-specificity, however some

(9)

Gian Mario Dore

virus types are able to infect cross-species and the best known example is BPV types 1 and 2 (BPV-1, BPV-2), the causative agents of common skin tumours of equids named equine sarcoids (Lubna Nasir and Campo 2008). Several other PV types are also being investigated for their role in the development of non-melanoma skin cancer (NMSC), whose Squamous cell carcinoma (SCC) and basal cell carcinoma (BCC) are the most common types (Aldabagh et al. 2013; Madan, Lear, and Szeimies 2010). Many PVs appear to occur preferentially in a latent life cycle, because a wide variety of different types can be detected at random sites of healthy skin of humans and animals (Antonsson and Hansson, 2002; Antonsson et al., 2000, 2003).

1.2 Classification

Papillomaviruses were originally classified, along with polyomaviruses, in the family of Papovaviridae, for their similarity in structure, genomic DNA (circular and double-stranded) and for the absence of an envelope. Later, it was found that the two viral groups exhibit a distinct genome size (5 Kb vs 8 Kb), a different genomic organization, and did not have any significant nucleotide or amino acid sequence similarity. Papillomaviridae and Polyomaviridae share only a homologous segment: the papillomavirus gene E1 and the polyomavirus T-antigen that correspond to a helicase, suggesting an ancient common origin of the replication proteins of these viruses (Rebrikov et al. 2002).

Recently, two viruses of marsupials were published to contain a surprising unique genome organization, that combines a papillomaviral late region encoding canonical L1 and L2 structural proteins, and an early region containing ORFs that encode the typical polyomaviral nonstructural proteins large T antigen and small t antigen (Rector and Van Ranst 2013; Bernard et al. 2010).

These polyoma–papilloma “hybrid” viruses suggest an evolutionary mechanism in which the early and late gene cassettes of papillomavirus genomes are relatively independent entities that can be interchanged by recombination, although these events are extremely rare (Rector and Van Ranst 2013; Bernard et al. 2010).

After the 7th Report of the ICTV, guidelines for Papillomavirus taxonomy were decided and Papillomaviruses were designated as a distinct family (De Villiers et al. 2004). The open reading frame (ORF) of a late capsid gene L1 is the most conserved gene within the HPV

(10)

Gian Mario Dore

genome and has therefore been used for the identification of new HPV types. To be recognized as a novel papillomavirus type, a viral genome has to fulfill a strict set of requirements (De Villiers et al. 2004; Bernard et al. 2010):

1. The entire viral genome must be cloned (overlapping fragments are OK).

2. The L1 sequence cannot share more than 90% nucleotide sequence identity with its closest neighbour.

3. The cloned genome must be submitted to, and reviewed by, the “International Human Papillomavirus Reference Center”.

Such species within a genus share between 60% and 70% nucleotide identity within the complete L1 ORF, whereas such PV types within a species share between 71% and 89% nucleotide identity within the complete L1 ORF. Subtypes are defined by homology differences of 2–10 %, whereas variants are defined as having homology differences of less than 2 % (De Villiers et al. 2004; Bernard et al. 2010).

A nomenclature of Papillomavirus genera is based on the Greek alphabet. Given that the genera are more than the alphabet letters, researcher propose to use the Greek alphabet a second time, employing the prefix “dyo”, (i.e., Greek “a second time”) e.g. Dyo-lamda PV.

(11)

Gian Mario Dore

Figure 1 Phylogenetic relationships between all established papillomavirus types based on an L1 nucleotide sequence alignment of all characterized papillomavirus types. Papillomavirus species or genera containing only human PV types were collapsed. (Rector and Van Ranst 2013)

(12)

Gian Mario Dore

Figure 2 Papillomavirus phylogenetic tree. Aligned of DNA sequence coding for E1, E2, L1 and L2 for all 241 papillomaviruses currently on PaVE. A partitioned gene alignment was used as the base for a maximum likelihood reconstruction of the phylogenetic tree (Van Doorslaer 2013).

(13)

Gian Mario Dore

1.3 Viral genome

PVs are small, non-enveloped viruses that have circular double-stranded DNA genomes with sizes close to 8 kb. Despite their small size, their molecular biology is very complex. Briefly, three oncogenes, E5, E6, and E7, modulate the transformation process, two regulatory proteins, E1 and E2, modulate transcription and replication, and two structural proteins, L1 and L2, compose the viral capsid. The E1, E2, L1, and L2 ORFs are particularly well conserved among all members of the family.

Within the capsids, viral genomes are associated with cellular histones, forming chromatin-like structures (Doorbar 2005).

Viral genomes from all HPV types harbor an average of 8 open reading frames (ORFs), and these ORFs are expressed from polycistronic mRNAs which are transcribed from a single DNA strand (Johansson and Schwartz 2013; Zheng and Baker 2006).

1.3.1 Non coding region

The upstream regulatory region (URR) or long control region (LCR) represent about 12% of the viral genome. It is located between the L1 and E6 genes and contains the E6 promoter, E2 protein -binding sites and an enhancer region with cis-responsive elements that regulate viral gene expression, replication, and packaging into viral particles (Stünkel and Bernard 1999; Clarke et al. 2012).

1.3.2 Early proteins

E1 protein is a 70-kDa ATP-dependent DNA helicase that binds specifically to the viral origin and assembles into a dihexameric complex to initiate replication (Stenlund 2003). It is the only enzyme encoded by papillomaviruses and it plays an important role in the initial phase of viral genome replication, together with E2. It is essential for replication and amplification of the viral episome in the nucleus of infected cells (Bergvall, Melendy, and Archambault 2013).

E1 alone weakly binds to origin sequences, but this binding is enhanced through complex formation with E2 proteins (Dixon et al. 2000).

(14)

Gian Mario Dore

E2 is a dimeric protein approximately 50 kDa in size, important in the regulation of the viral replication and transcription. It contains a conserved N-terminal transactivation domain linked to a C-terminal DNA binding domain. The two domains are connected by a flexible linker sequence (A A McBride, Schlegel, and Howley 1988). The E2 proteins bind specifically to sequence motifs in the viral genome and can activate or repress transcription, depending on the context of these binding sites and nature of the associated cellular factors (Alison A McBride 2013). E2 participates in the initiation initiation of viral DNA replication by loading the E1 helicase onto the replication origin (Frattini and Laimins 1994). At low levels, E2 binds to specific recognition sequences activating early promoters, while at high concentrations it represses the transcription by blocking the transcription factors binding. The role of E2 as a repressor is very important in regulating the E6 and E7 expression levels.

The E4 protein is translated from a spliced mRNA transcript as an E1^E4 fusion protein that contains the first few residues of E1 fused to the remaining of E4. Although E4 belong to early genes group, it is expressed later during the viral replication cycle. The functions of E4 have been suggested to play a role in facilitating and supporting viral genome amplification, the regulation of late gene expression, the control of virus maturation and the mediation of virus release (Doorbar 2013; IARC 2007).

E5 is a highly hydrophobic protein composed of 83 amino acids and it is the smallest PV oncoprotein. The E5 gene is present in some HPV but absent in others, indicating that the E5 protein is not essential for either the life cycle, or cell transformation by these viruses (Venuti et al. 2011). When over-expressed, HPV16 E5 is present in the endo- plasmic reticulum (ER), in the nuclear envelope and in the Golgi apparatus (GA) (Conrad, Bubb, and Schlegel 1993). Its expression can interfere with several signal transduction pathways, such as the activation of the MAPK pathway (Crusius, Auvinen, and Alonso 1997) and the block of MHC I transport to the cell surface by retains the complex in the Golgi apparatus (Ashrafi et al. 2006). In general, the biological activities of the protein and its role in the PV pathogenesis remain poorly characterized.

(15)

Gian Mario Dore

The E6 and E7 proteins are responsible for cell transformation and malignant progression of cervical cancer and for this reason are defined oncogene proteins (Munger et al. 2004). The main function of the early proteins E6 and E7 of papillomaviruses in the viral life cycle is the facilitation of viral replication by driving the host cell into S-phase; however, these functions can also lead to malignant transformation of the infected cell. The oncogenic action of E6 and E7 proteins resides in the ability to inactivate two important tumor suppressor proteins, p53 and the retinoblastoma protein pRb (Scheffner et al. 1990). The role of E6 and E7 in cancer development has been well established for mucosal types (such as HPV16), whereas their role in skin carcinogenesis have not been fully understood yet.

The E6 protein contains four C-X-X-C zinc-binding domains and is known to interact with more than twelve different cellular proteins. Its function is mainly anti-apoptotic, and its most important target is the tumor repressor p53 (Scheffner et al. 1990).

E6 binds the ubiquitin ligase E6-AP and it leads to the ubiquitinylation of p53, which results in its degradation (Vande Pol and Klingelhutz 2013). When activated, p53 promote the pathways for DNA repair, cell cycle arrest and/or apoptosis, based upon the type and extent of damage. The downregulation of p53 interferes with the G1/S-phase and G2/M phase cell cycle checkpoints, which results in the accumulation of mutations (Thompson et al. 1997).

E7 is a small, approximately 17 kDa, protein which is approximately 100 amino acids long and it consists of three domains designated as CR1, CR2 and CR3. CR3 is the C-terminal region and contains two C-X-X-C zinc-binding motifs, which are known to facilitate the dimerization of E7. High-risk HPV E7 proteins are best known for their ability to associate with the cellular tumour suppressor, pRb (Roman and Munger 2013). Association of high-risk E7 with pRb also promotes the degradation of pRb through a proteasome-mediated pathway (Gonzalez et al. 2001) and blocks the ability of pRb to bind and inactivate cellular E2F transcription factors (Phelps et al. 1991). E7 protein binds to the pocket domain of pRb through a conserved LXCXE motif in the CR2 domain at the amino-terminus which disrupts the association between pRb and the E2F family of transcription factors (Schreiber et al. 2004). E7 of high-risk HPVs binds RB stronger than the E7 proteins

(16)

Gian Mario Dore

of low-risk HPVs and targets RB to proteasomal degradation (Gage, Meyers, and Wettstein 1990)

1.3.3 Late proteins

The late proteins L1 and L2 have a structural function: L1 is the major viral capsid protein, while L2 is the minor viral capsid protein. The major capsid protein L1 assembles in the cytoplasm into pentamers, also called capsomeres, which are subsequently transported into the nucleus. The L1 proteins are highly conserved and can spontaneously self-assemble into 72-pentamer virus-like particles (VLPs) that present an exterior surface essentially indistinguishable from the native T=7 icosahedral structure of papillomavirus virions (Kirnbauer et al. 1993; Buck, Day, and Trus 2013).

The minor capsid protein L2 is localized in PML bodies in the nucleus and it has been reported to be required for efficient DNA/viral genome encapsidation for BPV1, although the effect may be minor for HPV16 (Buck et al. 2004).

L2 interacts with L1 via an L1-binding domain near its carboxy terminus (X. S. Chen et al. 2000; Bishop, Dasgupta, and Chen 2007). L2 proteins interact with each other in an intercapsomeric-dependent manner, with the hydrophobic C-terminal region of one molecule interacting with the N-terminal region of another (Buck et al. 2008).

The viral capsid consists of 72 capsomeres and between 12 and 72 L2 monomers (Buck et al., 2008). Virus maturation is thought to occur by cross- linking through the formation of disulfide bonds.

Figure 3. 3D reconstruction of HPV16 viral capsid.

(17)

Gian Mario Dore

The L2 minor capsid protein localizes in the internal surface of the virion, supposedly within the central cavities under the L1 pentamers and plays a role in capsid stabilization through interaction with the major capsid protein L1.

1.4 Life cycle

Papillomaviruses (PVs) establish their productive life cycle exclusively in stratified epithelium of skin or mucosa. These tissues are complex, composed of several different cell types, majority of which comprise stratified keratinocytes in different stages of differentiation (Kadaja et al. 2009). There are two types of dividing keratinocytes in the epidermis: slowly cycling undifferentiated stem cells, and the cells capable of transient proliferation in basal cell compartment. These undifferentiated proliferating basal keratinocytes are the initial target for productive PV infections and establishment of latent infection (Kadaja et al. 2009). The viral life cycle is strictly linked to the differentiation of the infected epithelial cell.

The papillomavirus infection requires access of infectious particles to cells in the basal layer of stratified squamous epithelium. This is possible due to micro wounds or abrasion that allow the virus to penetrate through the layers (Doorbar 2005) and reach the basal layer of stem cells (Egawa 2003). Hair follicle may represent an important site of entry (Weissenborn et al. 2012).

Currently, there are still controversies about the precise receptor involved in the entrance of the virus in the basal cells. HPVs bind to a widely expressed and evolutionary conserved cell surface receptor by interaction with the major capsid protein L1. The most commonly encountered attachment factors are glycosaminoglycan chains, especially heparan sulphate (HS) proteoglycans.

Binding of HSPGs to the cell surface in vitro, induces a conformational change in the capsid that exposes the N-terminus of L2 to cleavage by furin, or the closely related proprotein convertase (PC) 5/6 (Richards et al. 2006). The furin cleavage site is absolutely conserved among all PVs and cleavage is required for infection (Schiller, Day, and Kines 2010). After binding to cell surface receptors, HPV must be internalized into the cell to establish an infection. The identity of the keratinocyte-specific receptor is unknown. One candidate that

(18)

Gian Mario Dore

has been suggested based on in vitro studies is α6-integrin, an epithelial cell adhesion molecule (Evander et al. 1997).

The internalization of HPV occurs via endocytosis with clathrin- coated vesicles: after binding to the receptors, virions enter into the cytoplasmic compartment (Culp and Christensen, 2004).

Afterwards, virions are disassembled in the lysosomes and then the viral DNA is transferred into the nucleus carried by the minor capsid protein L2 (Day, Lowy, and Schiller 2003).

1.4.1 Genome maintenance

Following infection and uncoating, the virus begins to express the E1 and E2 proteins that maintain the viral DNA as an episome (10 to 100 copies per cell) and facilitate the correct segregation of genomes during cell division. E2 initiates viral genome replication by loading the viral helicase E1 onto the origin of replication allowing the viral episome to be maintained at low copy numbers in the basal epithelium (You 2010). In infected cells, it appears that the viral genome replicates with the cellular DNA during S-phase: during this phase E2 ensures accurate partitioning of the replicated viral genomes to daughter cells by tethering them to host mitotic chromosomes (Bastien and McBride 2000).

This type of replication ensures a latent and persistent infection in the basal cells of the epidermis. The expression of E1 and E2 is required and seems to be sufficient for the basal maintenance of viral episomes (Doorbar 2005).

1.4.2 Proliferative phase and genome amplification

Initial infection is followed by a proliferative-phase that results in an increase in the number of basal cells harbouring viral episomes. The increased proliferation of suprabasal cells is attributed to the expression of viral oncogenes, E6 and E7 and the mechanism by which papillomaviruses stimulate the progression of the cell cycle is well known.

Both E6 and E7 stimulate cell cycle progression and can associate with cell-cycle regulators (Doorbar 2005).

The E7 protein associates with the retinoblastoma protein (pRb), a negative regulator of the cell cycle that normally prevents S-phase entry, preventing its association with the E2F family of transcription factors. Subsequently, E2 activates cellular proteins required for viral

(19)

Gian Mario Dore

DNA replication, such as cyclins A and E. E7 is associated also with other proteins involved in cell proliferation, including histone deacetylase and cyclin-dependent kinase inhibitors p21 and p27. The function of the E7 protein is complemented by the viral protein E6. The primary role of E6 is to associate with the p53 protein of which mediates ubiquitination and degradation. This is thought to prevent the growth arrest or apoptosis in response to unscheduled S-phase entry mediated by E7 (Doorbar, 2005). This delay of cell-cycle arrest allows further viral episome replication using the host DNA replication machinery in suprabasal epithelial cells, and produces the thickening of the skin (or wart) characteristic of some papillomavirus infections (Frazer, 2004).

Papillomaviruses must amplify their viral genomes and package them into infectious particles in order to produce infectious virions. The assembly of the E1/E2 initiation complex may allow the progress of viral genomes replication in the absence of synthesis of cellular DNA. The newly replicated genomes will serve as templates for the further expression of E1 and E2, facilitating an additional amplification of the viral genome (Middleton et al., 2003).

1.4.3 Viral particle assembly

Papillomaviruses encode two structural proteins L1 and L2 expressed in the upper layers of infected tissue when the amplification of the viral genome is completed. The major capsid protein (L1) is expressed after L2 allowing the assembly of infectious particles in the upper layers of the epithelium. Papillomavirus virion assembles in the cell nucleus by imported L1 pentamers (Buck, Day, and Trus 2013).

Papillomavirus particles comprise an approximately 8000 base pair genome within a capsid that contains 360 copies of the L1 protein, and probably 12 copies of L2, organized into a 72 capsomere icosohedral shell. To be successful, the virus must eventually escape from the infected skin cell and survive out of the cells prior to restart a new infection. Papillomaviruses are non-lytic, so they are not released until the infected cells reach the epithelial surface (Doorbar 2005).

(20)

Gian Mario Dore

1.5 Delta papillomavirus

The delta papillomavirus genus comprises the artiodactyl papillomavirus with 13 PV identified so far. Delta-PVs were isolated from 1 moose (AaPV1), 1 yak (BgPV1), 4 Bovines (BPV1- 2-13-14), 1 roe deer (CcaPV1), 2 dromedaries (CdPV1-CdPV2), 1 deer (OvPV1) and 1 reindeer (RtPV1).

BPV is one of the most studied virus. This group of viruses is notable because they induce the development of fibropapillomas in their natural hosts, providing evidence of a pathogenic mechanism that appears to be unique among Delta-PVs (Narechania et al. 2004).

It has been observed that the ability to cause fibropapilloma coincides almost exactly with the lack of the canonical pRB-binding motif. Furthermore, It has been demonstrated that every animal PV known to induce fibropapillomas lacks the pRB-binding motif, including those PVs that seem to produce lesions with a dual pathology pattern (Epsilonpapillomaviruses) (Lunardi et al. 2013). The correlation between the lack of pRB-binding and the development of fibropapillomas is a finding, thus far, restricted to animals, and is most conspicuous among the artiodactyl PVs of the Delta genus (Narechania et al. 2004).

Delta-PVs include the well-studied bovine papillomaviruses type 1 and 2 (BPV1 and 2) which are known to be the only PVs able to cross- infect an other specie and that can establish non-productive infections in horses (L. Nasir and Reid 1999).

Recently, the genome of a new BPV type (BPV-14) was isolated from a feline sarcoid closely related to BPV1-2 and 13 (Munday et al. 2015) suggests that feline sarcoids, as is well recognised for equine sarcoids, are also caused by cross-species infection by a bovine Delta PV (Lunardi et al. 2013).

1.5.1 Ovine Papillomaviruses

The first association between Papillomavirus and warts in sheep was described by Gibbs et al. in which the viral etiology of the lesions was established by the successful transmission of the disease with inocula prepared from a single sheep to another sheep (E.P.J. Gibbs, C.J. Smale 1975).

(21)

Gian Mario Dore

One of the most common form of skin cancer in sheep is the squamous-cell carcinoma (SCC) and it was described at the first time in Australia (Hawkins, Swan, and Chapman 1981) and later in South Africa, France, Spain, Saudi Arabia and Brazil (Alberti et al. 2010).

The SCC occurred more commonly on areas poorly covered by wool and lacking pigmentation which implied that UV light played as an important role as a co-factor in their etiology (IARC 2007). This hypothesis is supported from a study that correlated the increased practice of the removal of tails with an increased prevalence of neoplasias in sheep, because the whole perineal area is expose to direct sunlight (IARC 2007).

Some cases of rumenal fibropapillomas were also reported in sheeps from Scotland and one sheep with a squamous cell carcinoma of the rumen was identified (Norval et al. 1985). Papillomavirus-like virions were detected by negative staining electron microscopy in hyperkeratotic scales of the perineum of sheep and in papillomatous areas on the face and on the ear of merino sheep in Australia (Vanselow and Spradbrow 1982).

In artiodactyl ruminants papillomaviruses, fibroblasts appear to be the primary target cells and the viruses lacks of the canonical L-X-C-X-E pRB-binding domain in E7 ORF. This seems to be associate with the development of fibropapillomas (Narechania et al. 2004). Regarding Papillomavirus genome, three genotype are isolated in sheep so far. The two papillomavirus genotypes OaPV1 and OaPV2 seem to associate only to fibropapillomas and have never been observed in precancerous lesions and skin tumors (Alberti et al. 2010). A third sheep papillomavirus, OaPV3, was identified in Sardinia in 2010.

Although OaPV3 was found in SCC sheep lesions, the phylogeny tree based on L1 sequence comparison, arrange this PV in a new genus, weakly related to the artiodactyl papillomaviruses of the Delta genus (Alberti et al. 2010).

1.6 Dyolambdapapillomavirus – OaPV3

The recently identified novel OaPV3 virus, object of this thesis, clusters with RrupPV1 into the Dyolambda papillomavirus genus. OaPV3 was isolated from a sheep SCC in Sardinia (Alberti et al. 2010) while RrupPV1 was isolated from a nasal neoplasia of a free-ranging alpine chamois (Rupicapra r. rupicapra) in Italy (Mengual-Chuliá et al. 2014). OaPV3 (Ovis aries Papillomavirus type 3) was identified in squamous cell carcinoma (SCC) of sheeps from four different flocks in Sardinia; whereas the two already known ovine

(22)

Gian Mario Dore

papillomaviruses (OaPV1 and OaPV2) isolated in sheep, seem to associate only to fibropapillomas and they have never been observed in precancerous lesion and skin tumors (Alberti et al. 2010).

Unlike OaPV1 and 2, OaPV3 lacks an E5 gene and maintains the conserved retinoblastoma tumor suppressor binding sequence motif in E7. For these reasons, the OaPV3 genome does not meet the criteria for fibroblast infection and fibropapilloma development typical of Artiodactyl papillomaviruses (Alberti et al. 2010). The Pairwise alignment of OaPV3 with other PVs shows less than 60% of L1 nucleotide sequence identity with any other PV, placed this virus in the new genus Dyolambda. RrupPV1 and OaPV3 L1 shares a 77% nucleotide identity, identifying RruPV1 as the sister taxon of OaPV3 (Mengual-Chuliá et al. 2014).

The complete nucleotide sequence of OaPV3 (GenBank accession number FJ796965) counts 7344 bp, and contains the classical PV major ORFs E6, E7, E1, E2, L2, L1 and the non coding region (NCR or URR). A putative E4 is also present as a result of spiced message (Alberti et al. 2010).

OaPV3 NCR contains six typical E2- binding sites (E2BS) for binding of an E1/E2 complex in order to activate the origin of replication. The E6 ORF contains two conserved zinc-binding domains (C-X-X-C-X29-C-X-X-C) separated by 36 aminoacids and the E7 ORF contain one zinc-binding domain and the conserved retinoblastoma tumor suppressor binding domain (LYCDE).

(23)

Gian Mario Dore

(24)

Gian Mario Dore

1.7 Virus-like particle (VLP)

HPV virions are non-enveloped, icosahedral particles approximately 50 to 60 nm in diameter. Each particle is composed of 72 pentamers of the L1 capsid protein. L1 pentamers are thought to form a network of intra- and interpentameric disulfide interactions, which serve to stabilize the capsid.

The two structure proteins L1 and L2 are expressed only in the differentiated keratinocytes. The major capsid-protein L1 has a molecular weight of 55 kDa and is capable of assembling spontaneously to higher order structures similar to authentic viral particles (VLPs) when expressed in eukaryotic cells (Yamaji 2014). L1 can spontaneously assemble into VLPs alone, or in tandem with L2 (Conway and Meyers 2009).

VLPs resemble infectious virions morphologically but they lack viral DNA and are, therefore, non-infectious (Ribeiro-Müller and Müller 2014).

VLPs serve as excellent platforms for the development of safe and effective vaccines and diagnostic antigens. Currently there are two commercial prophylactic virus-like particle (VLP) vaccines based on L1, Gardasil® and Cervarix®. Gardasil® is a tetravalent vaccine composed by high risks oncogenic HPV16 and HPV18 VLPs and also HPV6 and HPV11 that cause genital warts, whereas Cervarix® is a bivalent vaccine produced in insect cells with recombinant baculovirus based on high risks HPV16 and HPV18 VLPs (J. Chen, Ni, and Liu 2011). A VLP-based nonavalent vaccine, which targets 5 extra genital high-risk types, is currently in clinical trials by Merck to broaden protection among the high-risk mucosal alpha HPV types (Vinzón and Rösl 2015; Ribeiro-Müller and Müller 2014).

Also, since VLPs mimic the structure of virions and are relatively easy to be employed in large scale productions, they represent the ideal candidate as antigens for the development of innovative indirect tests (such as ELISA), and as immunogens to produce sera for in vitro studies and for direct immunohistochemical diagnosis.

1.7.1 Multibac baculovirus expression system

Among various recombinant protein production systems, the baculovirus insect cell system has been used extensively for the production of a wide variety of VLPs.

The expression of one capsid protein alone in insect cells is enough to cause the formation of VLPs that are morphologically and antigenically similar to native viruses (Kirnbauer et

(25)

Gian Mario Dore

al. 1993). Papillomavirus VLPs, produced by over-expression of the major capsid L1 protein in insect cells, represent the most studied example as a prophylactic vaccine among non enveloped VLPs (Schiller and Lowy 2012).

The MultiBac expression system is a simple and rapid method for generation of multigene baculoviruses described by (Berger, Fitzgerald, and Richmond 2004) This system uses the Bac-to-Bac and Cre-recombinase technologies to express heterologous multiprotein complexes from one single baculovirus. The Multibac system is composed by two transfer vectors pFBDM and pUCDM. The pFBDM vector (used in this thesis) contain the followed features: a central multiplication module, AcNPV promoters (p 10, polh), two multiple cloning sites in a head-to-head arrangement (MCS1, MCS2) and two terminators (SV40, HSVtk. This shuttle vector also contains elements for Tn7 transposition and antibiotic resistance markers (Berger, Fitzgerald, and Richmond 2004). In order to produce OaPV3 VLPs, L1 sequences were cloned into the two MCS and selected with the appropriate antibiotic. The resulting vectors are then introduced by electroporation into MultiBac baculoviral DNA in DH10multiBac E. coli cells which contain the factors for Tn7 transposition for pFBDM. Colonies containing bacmid carrying integrated multi-L1 cassettes are identified by blue/white screening (Tn7 transposition disrupts expression of the lacZ peptide) plus gentamycin resistance. Bacmid DNA is prepared from selected clones and used to transfect insect cells for VLPs production.

1.8 Pseudovirions

Because the HPV life cycle is tightly linked to the host cell differentiation, the virus has been hard to grow in culture. Therefore, systems to create viral particles bypassing epithelial differentiation were developed. Papillomavirus-based gene transfer vectors, also known as Pseudovirions (PsV), have become standard tools for studying papillomavirus assembly, cellular entry and neutralization and could be used as gene transfer tools or DNA vaccines vehicles (Buck and Thompson 2007). The method is based on transfection of a 293TT cell line, engineered to express high levels of SV40 Large T antigen. The 293TT cells are co-transfected with codon-modified capsid genes L1 and L2 together with a reporter plasmid containing a SV40 origin of replication. Because the expression of native L1 and L2 genes is restricted in cultured mammalian cells, both genes must be codon-modified

(26)

Gian Mario Dore

(humanized) according to mammalian genetic code. The codon usage in papillomavirus genes is described in (Bravo and Müller 2005). The codon optimization does not change the aminoacid sequence but allows an increase capsid proteins production. Co-transfection of 293TT cells with a plasmid contains humanized L1 and L2 sequences together with a reporter plasmid carrying a marker gene (SEAP or Gaussia Luciferase), result in assembly of reporter preudovirions in the nucleus of transfected cells. The PsV obtained consist of a crude extract of detergent-lysed 293TT cells.

The capsid of obtained PsV are infectious but physically too fragile and this affects the level of infectivity (Buck et al. 2005). Then it is necessary to induce the capsid maturation with an overnight incubation of crude extract at 37°C that allows the formation of disulfide bonds between L1 molecules and the capsid becomes more stable (Buck et al. 2004).

To obtain purified PsV it is necessary to separate capsids from cell debris and detergent by high salt extraction followed by Opriprep gradient ultracentrifugation. With this procedure, it is possible to partially separate DNA-containing PsV from empty capsids and from free reporter protein in the lysate. The clarified supernatant can be used to infect cells of interest directly as a crude papillomaviral vector stock of after optiprep purification (Buck and Thompson 2007).

1.9 Host immune response to PV infection

HPVs are very successful infectious agents. Pv are able to induce chronic infections that rarely kill the host, and periodically shed large amounts of infectious virus, over weeks and months, for transmission to new individuals (M. A. Stanley 2012). Infection and viral growth are completely dependent upon the program of keratinocyte differentiation, from basal cell to terminally differentiated keratinocytes. Viral replication and assembly does not produce any cytolysis or cytopathic effect. These key events for the virus occur in the fully differentiating keratinocyte, a cell destined for death and desquamation far from the sites of immune activity (M. A. Stanley 2012).

PV infections are exclusively intraepithelial and, in theory, the presence of the virus should be detected by the APC of squamous epithelia, the Langerhans cells (LCs). Activated LCs should then migrate to the draining lymph node, process PV antigens, and present

(27)

Gian Mario Dore

antigen to naїve T cells in the limph node. The T cells should then differentiate into armed effector cells, migrate back to the infected site, and destroy the infected keratinocytes. But this does not happen because infectious cycle is itself an escape mechanism developed to evade host immune system, and furthermore because there is no viraemia, and very low levels of viral protein are expressed (M. Stanley 2010). Keratinocytes are programmed to die, so, there is little or no release of the proinflammatory cytokines important for dendritic cell activation, and the essential signals required for immune responses in squamous epithelia are absent (Kupper and Fuhlbrigge 2004).

HPVs have evolved mechanisms to downregulate host interferon (IFN) production. E7 of high-risk HPV types interact with components of the IFN-α signaling cascade thereby down-regulating IFN inducible gene expression (M. Stanley 2006; Barnard and McMillan 1999). Also HPV E6 influences Langerhans’ cell density and E-cadherin expression, preventing the retention of LC in the skin (Matthews et al. 2003). In general, HPV efficiently evades the innate immune response and delays the activation of the adaptive immune response (M. Stanley 2006).

The increased risk of progression of HPV infection to the malignancy in immunosupressed women after transplantation indicate the importance of the immune system in the control of HPV infection (Ozsaran et al. 1999).

(28)

Gian Mario Dore

1.10 Aim of the project

This project was carried out at the Department of Veterinary Medicine of the University of Sassari under the supervision of Prof. Alberto Alberti and at the DKFZ “German Cancer Research Center” in the Department of “Tumorvirus-specific Vaccination Strategies” under the supervision of Prof. Martin Müller.

The main objective of this study was the development of biotechnological tools for the study of the new ovine papillomavirus OaPV3.

Specific objectives were:

 Production of non-infectious OaPV3 virus-like particles (VLPs) potentially useful for the development of vaccines and other prophilactic tools.

 Development of an indirect diagnostic VLP-based ELISA test for investigating himmune humoral response in naturally infected sheep.

 Production of polyclonal sera and monoclonal antibodies for the development of of direct diagnostic test, such as immunohistochemistry-based.

 Production of infectious pseudovirions (PsV) for evaluating the ability to block viral entry by OaPV3-based sera and monoclonal antibodies when tested in vitro in neutralization assays, that is to evaluate the ability of inducing the formation of neutralizing antibodies by different proteins or viral preparations (VLPs).

(29)

Gian Mario Dore

2. MATERIALS

2.1 Media and supplements

2.1.1 Bacterial culture

LB Medium (Luria Bertani) Tryptone 10 g

Yeast extract 5 g

NaCl 10 g

add 1 L H2O, pH 7, sterilized by autoclaving

LB agar plates Tryptone 10 g

Yeast extract 5 g

NaCl 10 g

European bacteriological agar 14 g add 1 L H2O, pH 7, sterilized by autoclaving

2X YTG (2X YT + 2% glucose)

Tryptone 16 g

Yeast extract 10 g

NaCl 5 g

Dissolve above ingredients in 900 ml of H2O. Adjust the pH to 7.0 with NaOH. Autoclaving. Once the medium has cooled, add 100 ml of a sterile filtered 20% glucose solution (final concentration 2% glucose)

(30)

Gian Mario Dore

pFBDM agar selection plates Kanamycin 50 µg/ml Gentamycin 7 µg/ml Ampicillin 100 µg/ml Tetracyclin 10 µg/ml

BluoGal 100 µg/ml

IPTG 40 µg/ml

2.1.2 Insect cells culture

TNM-FH medium 10% FBS

1% Glutamine

1% Penicillin/streptomycin

Ex-CellTM _{405 serum free} _1% _{Penicillin/streptomycin} 1% Glutamine

Specific medium recipe Grace insect medium pH 6,02

10% FBS

1% Penicillin/streptomycin 0.1% Pluronic F-68

Specific solution recipes

Buffer B pH 7.1 25 mM HEPES pH 7.1 125 mM CaCl2

140 mM NaCl

(31)

Gian Mario Dore

University of Sassari Staining solution (X-gal assay) 50 µl K3Fe(CN)6 400 mM 50 µl K4Fe(CN)6 400 mM 10 µl MgCl2 1M 500 µl PBS 10X to 5 ml H2O MilliQ

2.1.3 Mammalian cell culture

DMEM complete 10% FBS heat inactivated

1% Penicillin/streptomycin

RPMI-1640 complete 10% Heat inactivated FBS

1% Penicillin/streptomycin HAT-medium 15% FBS 1% Penicillin/ streptomycin 0,33% HEPES 1M pH 7.2 0,07% β-Mercaptoethanol 0,2% HFCS 2% HAT

to volume RPMI medium

Supplements

DMEM Sigma, Steinheim, Germany

Gibco, Carlsbad, CA, USA Euroclone S.P.A., Milan, Italy

(32)

Gian Mario Dore

University of Sassari Penicillin/Streptomycin

Pen (10,000 u/ml) Strep (10,000 µg/ml)

Gibco, Carlsbad, CA, USA

β-Mercaptoethanol (99 %) Roth, Karlsruhe, Germany

L-glutamine (200 mM) Gibco, Carlsbad, CA, USA

Trypsin (0.25 %)/EDTA Sigma, Steinheim, Germany Gibco, Carlsbad, CA, USA

Trypsin (0.05 %)/EDTA Sigma, Steinheim, Germany Euroclone S.P.A., Milan, Italy

HAT Sigma, Deisenhofen

HFCS Hybridoma fusion and cloning supplement, Sigma, Deisenhofen

(33)

Gian Mario Dore

2.2 Biologic materials

2.2.1 Bacteria

2.2.2 Insect cells

Sf9 Insect cells derived from pupal ovarian tissue of the Fall armyworm Spodoptera frugiperda (ATCC® CRL-1711™). Doubling time: 24-30 hours.

Used for the propagation of recombinant baculovirus stocks. One Shot® TOP10

chemically competent E. coli (Invitrogen)

genotype: F- mcrA Δ(mrr-hsdRMS-mcrBC)

φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR₎ endA1 λ

-E. coli BL21 CodonPlus® (Stratagene)

genotype: F– ompT hsdS(rB– mB–) dcm+ Tetr gal l (DE3) endA Hte [argU ileY leuW Camr]

E. coli MxDH10α electrocompetent (Invitrogen)

genotype: F- mcrA Δ (mrr-hsdRMS-mcrBC) ψ80lacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG tonA

DH10Multibac (kindly provided by Martin Müller)

genotype F-mcrA Δ(mrr- hsdRMS- mcrBC) φ80lacZ ΔM15 ΔlacX74 recA1 endA1 araD139 Δ (ara, leu)7697 galU galK λ- rpsL nupG

(34)

Gian Mario Dore

High Five TM _{BTI-TN-5B1-4, derived from the parental Trichopulsia ni cell line.} Suitable for the expression of recombinant proteins using recombinant baculoviruses.

Used for the production of papillomaviruses VLPs

2.2.3 Mammalian cells

2.2.4 Pseudovirions

Designation Description Reference

HPV16 Gaussia Co-transfection #988 + #1998 M. Müller

OaPV3 H1 Gaussia Co-transfection pGEM L1 IRES L2 + #1998 This thesis OaPV3 H2 Gaussia Co-transfection pGEM L1 IRES L2 + #1998 This thesis 293TT 293T cells, additional stably transfected SV40 Large T-antigen for

higher protein expression.

Used for pseudovirions production.

HeLa T K4 HeLa cells (HPV18 cervical cancer cell line) stably transfected with a linearized expression plasmid containing SV40 large T-antigen under control of the CMV promoter (Sehr et al. 2013)

(35)

Gian Mario Dore

2.2.5 Laboratory animals

6-8 or 16 weeks old female BALB/c mice were specified pathogen-free and maintained under pathogen-free conditions at the animal facility of the German Cancer Research Center (DKFZ, Heidelberg, Germany). Lymphocytes extracted from the spleen were used for the cell fusion (hybridome production) and spleen cells were used as feeder cells.

Wistar rats weighing 280–300 g were housed in the animal facility of the Faculty of Veterinary Medicine (Sassari) at constant room temperature (24 ± 1 °C) and humidity (60 ± 5%) with a 12 h light–dark cycle. All procedures were complied with the standard stated in the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources, National Academy of Sciences, Bethesda, MD, USA).

2.3 Molecular biological materials

2.3.1 Plasmids and primers

Vectors

pCRTM_4-TOPO® (Invitrogen)

TOPO TA vector used for PCR product cloning.

pCDNA3.1 (+) (Invitrogen)

Expression vector for stable and transient high-level expression in mammalian cells.

pGEX-2T (GE Healthcare)

Used for the expression of GST-fusion proteins under the control of the tac promoter (de Boer, Comstock, and Vasser 1983) in E. coli.

(36)

Gian Mario Dore

#1483 pFBDM Baculovirus transfer vector used to clone L1 genes into two expression cassettes in a head-to-head arrangement (kindly provided by Prof. Martin Müller)

#226 pIE HR1 Vector with β-gal gene under baculo immediate early promoter control (kindly provided by Prof. Martin Müller)

#847 pGEM-Rec1-IRES-GFP Bicistronic vector for pseudovirions production (kindly provided by Prof. Martin Müller)

#1998 pGF-Gaussia-EGFP Gaussia and EGFP gene under control of EF1alpha Promoter (kindly provided by Prof. Martin Müller)

#988 HPV16 L1h+L2h pCDNA 4.0 TO vector with HPV16 L1 and L2 linked via IRES under control of CMV promoter (kindly provided by Prof. Martin Muller)

Plasmid and primers for cloning and expression of GST-L1 in E. coli

The OaPV3 L1 gene was cloned into the pGEX-2T vector for the expression of GST-fusion proteins in E. coli.

pGEX-2T_OaPV3-L1: BamHI, EcoRI

OaPV3/L1/start/BamHI/F TATAGGATCCGCCGTGTGGGTGCCCAATG

(37)

Gian Mario Dore

Plasmid and primers for cloning and expression of GST-E6 in E. coli

In order to express the recombinant protein in E. coli, OaPV3 E6 was cloned into the pGEX-2T vector for the expression of GST-fusion proteins in E. coli.

pGEX-2T_OaPV3-E6: BamHI, EcoRI

OaPV3E6/start/BamHI/F TTATGGATCCGAGGGAAGCCCTCGTACAAT

OaPV3E6/end/EcoRI/R TATGAATTCTCAGGGAGTGTGGGCTGCTGA

Primers for cloning wild-type OaPV3 L1 into the baculovirus shuttle vector #1483pFBDM. L1-Kozak

-BamHI-F

AAGGATCCGCCACCATGGCCGTGTGGGTGCCCA

ATG Multiple cloning site 1 L1-STOP- NotI-R AGGCGGCCGCTTATTTATTGTTTAATTTTCGCCT ACG L1-Kozak -XhoI-F

AACTCGAGGCCACCATGGCCGTGTGGGTGCCCA

ATG Multiple cloning site 2 L1-STOP-NheI-R CGCGCTAGCTTATTTATTGTTTAATTTTCGCCTA CG

(38)

Gian Mario Dore

2.3.2 Humanized sequences

L1 humanization

OaPV3 L1/H1 (one aminoacid/one codon)

>GAATTCCTCGAGTCTAGAGCCACCATGGCCGTGTGGGTGCCCAACGGCAAG AGCTTCTACCTGCCCCAGAGCGCCGTGACCCGGATCCTGAGCACCAACGAGTA CGTGCAGGGCACCGGCCTGGTGTTCCACGGCAGCAGCAACCGGCTGCTGTGCG TGGGCCACCCCTTCTACGAGACCCAGCGGCCCGACGGCAGCGTGAAGGTGCCC AAGGTGAGCAGCAGCCAGTACCGGGTGTTCAAGGTGCTGCTGCCCGACCCCAA CAAGTTCGTGTTCAGCGAGCCCAACCTGTACGACCCCGAGAGCCAGCGGCTGG TGTGGAAGCTGCGGGGCCTGCAGGTGGACCGGGGCCAGCCCCACGGCGTGGG CGTGACCGGCCACCTGCTGATGAACAAGCTGGACGACACCGAGAACCTGGGC CGGCAGGGCAGCGACCCCGCCGGCCGGGACAAGGACAGCCGGGTGAACATGG GCCTGGAGCCCAAGCAGATGCAGGTGCTGATCGTGGGCTGCCGGCCCCCCTGG GGCGAGCACTGGGGCGTGGCCAAGAAGTGCGCCAGCGACAACGCCGACCCCG ACAAGTGCCCCGCCATCGAGCTGAAGAGCACCATCATCGAGGACGGCAACAT GATGGACACCGGCTTCGGCAACCTGGACTTCCGGAGCCTGCAGGAGAACAAG GCCGACGCCCCCATCGACATCTGCCAGAGCATCTGCAAGTACCCCGACTTCAT CCGGATGAGCCAGGAGACCTACGGCGACCACATGTTCTTCTGCGCCAAGCACG AGCAGATCTACCTGCGGCACTACTTCAGCAAGGCCGGCAAGATCGGCGAGGA GGTGCCCAAGACCCTGTACGTGCCCCCCCAGCCCGACACCGTGAACGGCACCG TGAACTTCTGGGGCAGCCCCAGCGGCAGCATGGTGAGCAGCAACAACCAGCT GTTCAACAAGCCCTACTGGGTGCGGCAGGCCCAGGGCCACAACAACGGCGTG CTGTGGAACAACCTGGCCTTCATCACCGTGGGCGACACCACCCGGGGCACCAA CTTCAACATCAGCGTGCTGGACAACGGCGCCCAGCCCTACAAGGACAGCAGCT ACGCCGAGTTCCTGCGGCACGTGGAGGAGTTCGACATCCAGATCATCGTGGAG GCCTGCATCGTGGACCTGACCCCCGAGATCGTGAGCTTCATCCACCAGATGGA CCCCACCATCCTGGACAACTGGAACCTGGGCATCCAGGCCGCCCCCGACAGCA GCCTGTGGGAGACCTACCGGTACATCAGCAGCTTCGCCACCAAGTGCCCCGAC CAGGTGCCCAAGCCCGAGGCCCCCAAGGACCCCTACGAGAAGCTGAGCTTCTG

(39)

Gian Mario Dore

GACCGTGGACCTGAACGAGAAGCTGAGCCAGGACCTGACCCACTTCCCCCTGG GCCGGCGGTACCTGTTCCAGTACACCGTGCGGCCCCCCAAGAGCGCCGTGAAG CGGAAGGCCGCCAACAACAGCGGCCTGAACAGCAGCAAGCGGCGGCGGAAGC TGAACAACAAGTAAGCATGCCTCGAGTTCGAA

OaPV3 L1/H2 (guided random)

The guided random nucleotidic version of L1 is cut by XhoI. In order to eliminate the XhoI site the first C of the restriction site was mutated to A. This does not change the aminoacid (TCC, TCA=S) >GAATTCCTCGAGTCTAGAGCCACCATGGCTGTGTGGGTGCCTAATGGTAAA TCATTCTACTTGCCACAGAGTGCTGTGACACGCATACTCTCTACTAACGAGTAT GTCCAGGGGACAGGGCTGGTATTCCACGGATCCAGCAACAGGCTGCTGTGTGT AGGTCACCCATTCTACGAGACACAGAGGCCAGACGGCAGCGTTAAGGTGCCA AAGGTGTCATCGAGTCAGTACCGGGTGTTCAAAGTCCTGCTGCCCGATCCCAA TAAGTTTGTGTTCAGCGAGCCCAATCTCTACGATCCCGAGAGTCAGAGGCTTGT GTGGAAACTCCGGGGGCTACAGGTAGATCGCGGGCAGCCCCACGGAGTTGGA GTGACAGGCCACTTGCTGATGAACAAGCTCGACGATACAGAGAATCTGGGTCG GCAGGGGTCCGATCCTGCCGGTAGAGACAAGGATAGCAGAGTGAACATGGGA CTGGAGCCCAAACAGATGCAAGTGCTCATAGTGGGTTGTCGCCCCCCATGGGG AGAGCACTGGGGAGTGGCCAAGAAATGTGCAAGCGATAATGCCGACCCAGAC AAATGTCCAGCAATCGAGCTCAAGAGCACCATCATCGAGGATGGCAACATGAT GGATACTGGGTTCGGCAACCTCGATTTCCGTTCCCTACAGGAAAACAAGGCTG ACGCCCCCATCGATATATGCCAGAGTATATGTAAATACCCCGACTTCATTCGTA TGAGTCAGGAGACATACGGGGATCACATGTTTTTTTGTGCAAAGCACGAACAG ATCTATCTGCGACATTATTTCAGTAAGGCTGGCAAGATTGGAGAGGAGGTCCC TAAAACTCTTTACGTCCCCCCTCAGCCTGACACCGTCAACGGGACCGTGAATTT CTGGGGGTCCCCCTCTGGATCCATGGTCAGTTCTAACAACCAGCTGTTTAATAA ACCCTATTGGGTGCGCCAAGCGCAAGGGCACAACAATGGTGTGCTTTGGAATA ATTTGGCTTTCATCACGGTGGGTGACACCACGAGGGGAACTAATTTTAACATCT

(40)

Gian Mario Dore

University of Sassari CCGTGCTGGATAACGGCGCTCAACCCTACAAAGACAGTAGTTACGCGGAATTT CTGCGACATGTGGAGGAATTTGATATTCAGATCATTGTAGAGGCGTGTATTGT GGACCTCACACCAGAAATTGTAAGTTTCATTCACCAAATGGACCCCACAATTTT GGACAACTGGAATTTGGGTATTCAGGCGGCCCCGGATTCTTCACTATGGGAAA CCTACAGATATATCAGCAGCTTTGCTACCAAGTGCCCAGACCAGGTTCCCAAA CCTGAAGCCCCGAAAGACCCGTACGAGAAACTGTCGTTCTGGACCGTTGACCT CAACGAGAAATTGTCCCAAGACCTGACACACTTTCCTCTGGGCCGGCGCTATC TGTTCCAATATACCGTACGCCCTCCTAAGAGTGCTGTAAAACGCAAAGCCGCC AACAACTCCGGGCTTAACAGCTCCAAGCGCAGAAGGAAGCTCAACAACAAGT AAGCATGCCTCGAGTTCGAA L2 humanization:

OaPV3 L2/H1 (one aminoacid/one codon)

>GCGGCCGCGCCACCATGGCCCCCCTGCGGCGGCGGAAGCGGGACACCGCCG AGAACATCTACCGGAACTGCAAGCCCTGGGGCACCTGCCCCCCCGACGTGATC AACAAGGTGGAGGGCACCACCGTGGCCGACCAGATCCTGAAGTACGGCAGCG GCCTGACCTACTTCGGCGGCCTGGGCATCGGCACCGGCCCCGGCGGCGGCGGC CGGCTGGGCTACCTGCCCCTGGGCAACCGGCCCGCCGGCCGGCCCGCCGTGCC CTTCTACCGGCCCCAGCCCCCCGTGGGCATCCCCGTGGAGACCATCCCCGAGA TCGTGGGCGGCGACGTGGTGGACGCCACCGCCGACAGCATCGTGCCCCTGCTG GAGGACGTGACCCGGGACATCGACGTGGCCGTGACCAGCGGCGGCCCCACCG CCCAGCCCGGCCCCACCCGGCCCAACAGCACCGAGATCAGCCTGCTGCCCCCC ACCCGGGACGTGACCGTGACCCAGAGCACCCACGAGAACCCCATGTTCGACCC CATCACCGTGAGCGACACCCACATGACCCAGAGCGTGACCGTGGAGAGCACC AGCGTGGGCACCTTCATCGGCGAGAGCTTCGAGGGCACCGTGCAGGAGGAGA TCGAGCTGCACAGCCTGGGCGGCGGCGGCGCCAGCAGCACCCACGGCAGCAC CTTCAGCGAGACCATCGTGGACGAGACCCCCTTCAGCAGCAGCACCCCCCGGA GCGGCGTGCAGGTGACCACCCGGTTCGGCGGCAGCAAGGTGAGCGCCTACAA CCGGCGGTTCGTGCAGGTGGAGGTGAGCAACCCCCTGTTCCTGAGCGAGCCCG AGGTGCTGGTGCAGGCCGGCGCCCCCCGGAGCGTGGCCGACACCAGCCTGACC

(41)

Gian Mario Dore

University of Sassari TTCGACAGCGGCGGCGACGACTTCACCCCCGCCCCCCACGCCGACTTCCAGAA CCTGCGGAAGCTGAGCCAGCCCTACTACACCCAGGGCCCCAGCGGCCACGTGC GGGTGAGCCGGCTGGGCCAGGAGAGCAGCATCGAGACCCGGAGCGGCCTGGT GATCGGCCCCCAGAAGCACTACTACCACGACCTGAGCACCGTGACCAACGCCG AGGAGACCGTGGTGCTGAACGTGGACACCCCCAGCATCACCGTGGGCCAGGG CCCCCCCGACAGCTACGAGACCATCAGCCTGAGCAGCCTGAGCCAGTACAGCG ACAGCGACCTGCTGGACATCATCGAGCCCGTGGGCGAGGACCTGCACCTGGTG CTGGGCGGCACCCGGCGGAAGCCCCCCGCCACCGTGCCCGTGAGCCTGAGCGG CTGGAGCGCCGTGCTGGGCAGCGTGACCGTGGACTACAGCAGCAACGACAAC AGCGCCGGCGAGCACCCCGACACCCCCGCCGGCATGCCCGCCATCCCCGTGAG CCCCGCCGTGAGCCTGGGCGGCGCCAACTACTGGCTGGAGCCCAGCCTGATCA AGAAGAAGCGGAAGAAGAAGCGGCTGATCTAAGGATCC

OaPV3 L2/H2 (guided random)

The guided random nucleotidic version of L2 is cut by XhoI. In order to eliminate the XhoI, the second C in position 374 was mutated to A. This doesn’t change the aminoacid (CTC, CTA = L) >GCGGCCGCGCCACCATGGCTCCCCTGCGAAGGCGCAAACGAGATACCGCCG AAAACATTTACCGGAATTGTAAACCTTGGGGAACATGTCCACCCGATGTGATA AATAAGGTTGAGGGCACCACCGTCGCCGACCAGATTCTCAAGTACGGCTCAGG CCTCACGTATTTCGGAGGTCTCGGTATAGGGACTGGACCAGGCGGCGGGGGGC GGTTGGGCTACCTGCCTCTCGGGAACCGACCAGCTGGGAGGCCAGCCGTCCCC TTTTATAGACCCCAGCCCCCCGTGGGCATCCCTGTTGAGACAATTCCTGAGATT GTCGGGGGGGATGTCGTGGATGCGACCGCAGACAGCATTGTGCCCCTGCTAGA GGATGTGACCAGAGACATCGACGTTGCCGTCACTAGCGGCGGCCCAACCGCCC AACCGGGACCTACCCGGCCAAATAGTACAGAGATCAGCCTTTTACCACCAACA CGAGACGTGACCGTTACTCAGAGCACCCATGAGAACCCCATGTTCGATCCGAT TACAGTGTCAGATACTCATATGACTCAGTCTGTGACCGTGGAAAGCACATCGG TGGGAACTTTCATTGGCGAGAGCTTCGAGGGCACGGTACAGGAGGAAATTGAA TTGCATTCTCTTGGAGGTGGTGGGGCTTCCAGCACACACGGGTCGACGTTCAGT

(42)

Gian Mario Dore

University of Sassari GAAACCATCGTGGACGAAACACCCTTCTCATCAAGTACCCCACGTTCAGGTGT GCAGGTTACAACACGGTTCGGAGGCTCCAAAGTCTCTGCATATAATCGGCGAT TTGTACAAGTGGAAGTGTCCAACCCTTTATTCCTGTCTGAGCCTGAAGTCTTAG TGCAGGCCGGGGCCCCACGTTCCGTGGCCGACACTAGCTTGACCTTTGACAGT GGAGGCGATGACTTTACCCCCGCCCCGCACGCCGATTTCCAAAATCTCCGTAA GTTGTCTCAACCATACTACACGCAGGGGCCCTCCGGGCATGTTCGCGTGAGCC GGCTGGGCCAAGAGTCTAGTATTGAGACACGGTCCGGGCTTGTAATAGGCCCT CAGAAACATTACTATCACGATTTGAGTACCGTCACCAATGCGGAAGAGACGGT TGTGCTAAATGTAGATACACCATCCATTACTGTCGGCCAGGGGCCCCCAGACA GTTATGAAACAATATCCTTGTCCAGTTTGTCACAATATTCGGACTCGGACCTCT TAGACATTATTGAGCCTGTGGGGGAGGATCTACATTTGGTCCTAGGCGGTACC CGGCGAAAGCCTCCCGCCACCGTACCGGTCTCTCTGTCGGGTTGGAGTGCCGT TCTGGGGTCTGTGACCGTGGACTACAGCTCAAACGACAATTCCGCTGGGGAGC ACCCCGACACTCCCGCTGGTATGCCAGCTATCCCCGTGTCACCCGCCGTATCTC TGGGGGGGGCCAACTACTGGCTGGAGCCAAGCCTGATTAAGAAAAAAAGAAA AAAAAAGCGATTAATATAAGGATCC 2.3.3 Antibodies Primary antibodies

Name Specificity Species Application Source MD2H11

(monoclonal)

HPV16 L1 Mouse WB- ELISA Prof. Martin Muller - DKFZ

1.3.5.15 (monoclonal)

HPV16 L1 Mouse ELISA Prof. Martin Muller - DKFZ

#4543 (polyclonal)

HPV16 L1 Rabbit ELISA Prof. Martin Muller - DKFZ

K18 L2 (20-38) (monoclonal)

HPV16 L2 Mouse Neutralization assay

Prof. Martin Muller - DKFZ

(43)

Gian Mario Dore

University of Sassari Secondary antibodies

2.4 Materials for molecular and cell biology methods

2.4.1 Preparation, manipulation and analysis of DNA

Kits

TOPO TA cloning kit Invitrogen, Carlsbad, CA

Rapid DNA Dephos & Ligation Kit Roche, Basilea, CH PureLink ™ Quick Plasmid Miniprep kit Invitrogen, Carlsbad, CA PureLink ™ Quick Plasmid Maxiprep kit Invitrogen, Carlsbad, CA QIAquick® Gel Extraction Kit Qiagen, Hilden

QIAGEN Plasmid Plus Maxi Kit Qiagen, Hilden QIAprep® Spin Miniprep Kit Qiagen, Hilden

Name Applications Source

Rabbit Anti-Sheep IgG(H+L)-HRP WB – 1:50000 ELISA – 1:10000

Southern biotech, Birmingham, USA Goat Anti-Mouse IgG(H+L), Rat

ads-HRP

WB – 1:50000 ELISA – 1:10000

Southern biotech, Birmingham, USA Donkey Anti-Rat IgG(H+L), Mouse SP

ads-HRP

WB – 1:50000 ELISA – 1:10000

Southern biotech, Birmingham, USA Goat α- mouse IgG - HRP (GAMPO) WB - ELISA Dianova, Hamburg,

Germany

Goat α-Rabbit IgG - HRP (GARPO) WB - ELISA Dianova, Hamburg, Germany