1 23
Food Analytical Methods
ISSN 1936-9751
Volume 12
Number 5
Food Anal. Methods (2019)
12:1128-1132
DOI 10.1007/s12161-019-01447-1
Reliability Evaluation of MALDI-TOF
MS Associated with SARAMIS Software
in Rapid Identification of Thermophilic
Campylobacter Isolated from Food
Graziella Ziino, Stefania Maria Marotta,
Filippo Giarratana, Alessandro Giuffrida
& Felice Panebianco
1 23
Your article is protected by copyright and
all rights are held exclusively by Springer
Science+Business Media, LLC, part of
Springer Nature. This e-offprint is for personal
use only and shall not be self-archived in
electronic repositories. If you wish to
self-archive your article, please use the accepted
manuscript version for posting on your own
website. You may further deposit the accepted
manuscript version in any repository,
provided it is only made publicly available 12
months after official publication or later and
provided acknowledgement is given to the
original source of publication and a link is
inserted to the published article on Springer's
website. The link must be accompanied by
the following text: "The final publication is
available at link.springer.com”.
Reliability Evaluation of MALDI-TOF MS Associated with SARAMIS
Software in Rapid Identification of Thermophilic Campylobacter
Isolated from Food
Graziella Ziino1&Stefania Maria Marotta1&Filippo Giarratana1 &Alessandro Giuffrida1&Felice Panebianco2
Received: 19 October 2018 / Accepted: 21 January 2019 / Published online: 29 January 2019 # Springer Science+Business Media, LLC, part of Springer Nature 2019
Abstract
Thermophilic Campylobacter species represent the most frequent cause of food-borne disease worldwide. Biochemical and serological tests, according to ISO 10272:2017, are routinely used in microbiology laboratories for their detection/identification. However, these procedures require a lot of time and can incur in diagnostic mistakes. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) is considered a promising identification method for bacteria and fungi from clinical isolates. The aim of this study was to evaluate the reliability of MALDI-TOF MS associated with SARAMIS software, in rapid identification of food-related Campylobacter spp., considering that this method was tested only on human and animal clinical strains. A total of 276 putative thermophilic Campylobacter strains, isolated from different foodstuffs according to ISO 10272-1:2006, were identified comparing the results of MALDI-TOF MS/SARAMIS with Multiplex PCR assay. MALDI-TOF MS/SARAMIS correctly identified 96% (n = 267) of strains at the species level, while only 2.5% (n = 7) of strains were not identified. Misidentification occurred in 0.7% (n = 2) of samples. The performance of this method demonstrated an overall sensitivity (Se) of 97.45% and specificity (Sp) of 100%. Thus, this method can be used for the rapid identification of
Campylobacter strains isolated from food samples according to ISO 10272:2017.
Keywords MALDI-TOF MS . SARAMIS TM . Campylobacter . Rapid identification . Food strains
Introduction
Campylobacteriosis is the most commonly diagnosed gastroin-testinal disease worldwide. In 2016, a total of 246,307 con-firmed human cases were reported in the European Union (EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control)2017). The thermophilic Campylobacter species (C. jejuni, C. coli, and C. lari) are among the major bacterial causes of food-borne gastroenteritis including diarrhea, fever, and abdominal pain (Deckert et al.2010). Infection may be serious on its own, but in some cases, it can also have long-term consequences such as
reactive arthritis and Guillain–Barré syndrome, inflammatory bowel disease, and irritable bowel syndrome (Janssen et al.
2008). Campylobacter spp. are widespread in nature and the principal reservoirs is the intestinal tract of domesticated and wild mammals and birds (EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control)2015). Poultry products represent the major source of human infection, since pathogens can be shed in the intestinal tract of healthy birds (EFSA 2005,2011; Stella et al. 2017). Consumption and/or handling of other raw or undercooked meats, unpasteurized milk, and water has also been identified as risk factors (Deckert et al. 2010; EFSA2005; Hoelzl et al. 2013). The conventional identification scheme, reported in ISO 10272-1:2017, for Campylobacter spp. and re-lated microorganisms usually consists of growth and biochem-ical tests, including oxidase and catalase activity evaluation, indoxyl acetate hydrolysis, and hippurate hydrolysis (On2001; UNI EN ISO 10272-1:20172017). However, these traditional protocols may lead to identification errors. Variation in the spe-cies phenotype is a well-established source of potential error in identifying Campylobacter strains. The best-known problem is
* Filippo Giarratana fgiarratana@unime.it 1
Department of Veterinary Sciences, University of Messina, Polo Universitario dell’Annunziata, 98168 Messina, Italy
2 Department of Agraria,BMediterranea^ University of Reggio Calabria, Feo di Vito, 89122 Reggio Calabria, Italy Food Analytical Methods(2019) 12:1128–1132
https://doi.org/10.1007/s12161-019-01447-1
that some C. jejuni strains lack their ability to hydrolyse hippurate, thus could be misidentified as C. coli (On2001). For all these reasons, the identification of Campylobacter spe-cies is often performed only to the genus level, or optional as reported in ISO 10272-1:2017. On the other hand, the accurate identification of a species is essential to facilitate effective clin-ical management, to estimate its prevalence, as well as to study specific risk factors. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) is consid-ered a promising identification method for several organisms including bacteria and fungi from clinical isolates (Dubois et al.2012; Elbehiry et al.2017; Martiny et al.2011; Panda et al.2015). Recently, MALDI-TOF MS was, in fact, proposed for the identification of several clinical strains that are difficult to culture such as Campylobacter, Legionella, and Mycobacterium (Bessede et al.2011; Biswas and Rolain2013; Hsieh et al.2017; Kolinska et al.2008). MALDI-TOF reliability was tested posi-tively on several human and animal clinical strains (Alispahic et al.2010; Bessede et al.2011; Martiny et al.2011). Today, instead, few studies are available on the performance of this technique on food-related strains (Huber et al.2018; Jadhav et al.2014; Wenning et al.2014). Only in the recent study of Huber et al. (2018), a preliminary evaluation (only two strains) on the application of this method for the identification of food-derived Campylobacter strains was conducted with promising results. The results obtained with MALDI-TOF MS in the iden-tification of clinical strains cannot be directly transferred to food-related ones, considering that significant differences are reported between clinical and food isolates for several bacterial species (Attien et al. 2014; Eaton and Gasson 2001). Food-related Campylobacter strains are usually found to be much more stressed than clinical isolates (On2013). Changes in certain pathways, expression profiles, virulence, and resistance patterns have been reported in stressed Campylobacter strains (Duarte et al.2014; Groot et al.2014). Several authors attributed this variability to the surface cellular structures which could interfere with whole-cell extraction techniques used in MALDI-TOF analysis (Gilbert et al.2002; Karlyshev et al.2005).
For all these reasons, the aim of the study was to evaluate MALDI-TOF MS reliability on the identification of a consis-tent number of food-related Campylobacter spp. isolates, se-lected according to ISO 10272-1:2017, by comparing its per-formance with the molecular method (Multiplex PCR).
Materials and Methods
Sample Collection and Preparation for Identification
A total of 276 putative thermophilic Campylobacter strains were previously isolated, according to ISO 10272-1:2006, from 100 samples of commercial raw poultry and turkey products, in Sicily, Italy (Stella et al.2017; UNI EN ISO 10272-1:20062006). The strains were selected on the
basis of their growth characteristics, colony morphology, Gram staining reactions, and biochemical characteristics. Cultures which showed a typical corkscrew motility and growth in micro-aerobic conditions at 41.5 °C, Gram-negative reaction, small curve rods morphology, and oxidase-positive reaction were selected, according to ISO 10272-1:2006, as putative thermophilic Campylobacter spp. for further identification analysis. All 276 strains, stored at − 80 °C in Brain Heart Infusion broth (BHI, Biolife, Italy) supplemented with 50 mL L−1 of laked horse blood (Biolife, Italy) and 150 mL L−1 of glycerol (Biolife, Italy), were sub-cultured onto modified charcoal-cefoperazone-deoxycholate agar plates (mCCD, Biolife, Italy) in a micro-aerobic atmosphere for 48 h at 41.5 °C in plastic jar with genbox Microaer (bioMérieux, Firenze, Italy).
Multiplex PCR Identification
The isolates were then submitted to species identification by a multiplex PCR method, applying some modification to the protocol of Wang et al. (2002). The protocol, simultaneously, identifies the following: (i) the genes hipO (hippuricase) from Camplylobacter jejuni; (ii) glyA gene (serine hydroxymethyltransferase) from Camplylobacter coli, and Camplylobacter lari; (iii) the internal control 23S rRNA. The primer sequences used are reported in Table1.
As positive control C. jejuni ATCC 33291, C. coli ATCC 33559, and C. lari ATCC 35221 were used, while as negative control Escherichia coli ATCC 25922 according to the proto-col of Wang et al. (2002).
Each PCR template was prepared by using a loopful (1μl loop) of culture transferred to 1 ml of Brain Heart Infusion broth (Biolife, Italy). The optical density of each sample was adjusted to give a result of 0.3 at 600 nm (SmartSpec Plus, Bio-Rad, Italy). All samples were diluted 1:500 in distilled water and heated at 100 °C for 10 min in eppendorf tube (Biosigma, Italy) for DNA extraction.
Each multiplex PCR tube contained 200 μM each of deoxynucleoside triphosphate (dNTPs); 2.5μl of 10x reaction buffer (500 mM Tris-HCl [pH 8.3], 100 mM KCl, and 50 mM [NH4]2SO4); 20 mM MgCl2; 0.5μM Campylobacter jejuni
and Campylobacter lari primers; 1 μM Campylobacter coli primers; 0.2μM 23S rRNA primer; 1.25 U of FastStart Taq DNA polymerase (Roche Diagnostics, GmbH, Mannheim, Germany); and 2.5μl of whole-cell template DNA. The vol-ume was adjusted with sterile distilled water to give 25 μl. DNA amplification was carried out in a thermocycler (C1000 Touch, Bio-Rad, Italy) using an initial denaturation step at 95 °C for 6 min followed by 30 cycles of amplification (de-naturation at 95 °C for 0.5 min, annealing at 59 °C for 0.5 min, and extension at 72 °C for 0.5 min), ending with a final ex-tension at 72 °C for 7 min.
Food Anal. Methods (2019) 12:1128–1132 1129
MALDI-TOF MS Identification
In parallel with PCR identification, single-cell colony grown on mCCD agar, as previously described, were directly trans-ferred by using a loopful (1μl loop) on FlexiMass MALDI target plates, with 48-well samples spots (bioMérieux, Firenze, Italy). Each colony was smeared as a thin film on a single well, overlaid with 1μl of matrix solution (CHCA, saturated solution of alpha-cyano-4-hydroxycinnamic acid in 500 mL L−1acetonitrile, and 25 mL L−1tri-fluoroacetic acid), and air-dried for 3–5 min at room temperature.
E. coli ATCC 8739, used as a calibrator and internal ID control, grown in blood agar (50 mL L−1 sheep blood) (Biolife, Italy) for 24 h was inoculated on specific and separate calibration spots (G3 and G4 position). After crystallization of the matrix and microbial material, the plates were introduced in a Vitek MS Axima Assurance mass spectrometer (bioMérieux, Firenze, Italy) in positive linear mode at a laser frequency of 50 Hz with an acceleration voltage of 20 kV and an extraction delay time of 200 ns. Mass spectra detected ranging from 2000 to 20,000 Da.
MALDI-TOF generates unique MS spectra for microor-ganisms, that were transferred into the SARAMIS software (Spectral ARchive And Microbial Identification System, Database version V4.12—Software year 2013, bioMérieux, Firenze, Italy) where they were compared to the database con-taining the reference spectra and SuperSpectra of bacteria. The SARAMIS database contains over 25 000 spectra from 586 bacterial and fungal species (Mattei et al.2012). Each strain was analyzed for three times in separate runs. A percent prob-ability, or confidence level, was calculated by the software algorithm. This value represents the similarity in terms of presence or absence of specific peaks between the generated spectrum and the database spectra. A perfect match between the sample spectrum and the unique spectrum of a single or-ganism or bacterial group provided a confidence level of 99.9% (excellent ID). For confidence level ranging from > 60 to 99.8%, the identification was consideredBgood ID^ because the spectrum was sufficiently close to that of a refer-ence spectrum, while for value < 60%Bno identification^ (no ID) was given (Dubois et al.2012).
Specificity and Sensitivity
Performance parameters, sensitivity and specificity, were cal-culated for MALDI-TOF. In particular, specificity (Sp) was
considered the correct identification of negative samples, ob-tained by the formula:
Sp¼ True negative samples
True negativesþ False positives expressed in percentage
Sensitivity was considered the correct identification of pos-itive samples, obtained by the formula:
Se¼ True positive samples
True positivesþ False negatives expressed in percentage
Results
To our knowledge, this is the first study that evaluated the reliability of MALDI-TOF MS in association with SARAMIS software (MALDI-TOF MS/SARAMIS), in iden-tifying a consistent number of thermophilic Campylobacter spp. strains isolated from food matrix according to ISO 10272-1:2017. PCR assay identified as thermophilic Campylobacter all the 276 strains tested (Table2). An excel-lent agreement was obtained between Multiplex PCR assay and MALDI-TOF MS/SARAMIS. This system correctly identified n = 267 (true positive) of the tested strains, while misidentifications occurred in 0.7% n = 2 (false positive) of the samples, which were identified as C. coli by PCR assay and as C. jejuni and Campylobacter spp. by SARAMIS data-base. These two false positive samples were identified by SARAMIS with low level of confidence:Bno identification,^ 63.35% and 61.50% in the three repetitions identified as C. coli, 65.75%, 62.55%, and 63.80% in the three repetitions identified as C. jejuni. Finally, only 2.5% n = 7 (false negative) of the isolates were not identified (Bno identification^ with SARAMIS for all the three replications). The performance of this technology demonstrated an overall sensitivity (Se) of
97.45% and Specificity (Sp) of 100% (as no true negatives
were detected) (Table 2). Among the single species,
Table 1 Primer sequences used in
the multiplex PCR assay Primer Size (in pb) Sequence (5′–3′) Target gene CJF CJR 323 ACTTCTTTATTGCTTGCTGC GCCACAACAAGTAAAGAAGC C. jejuni hipO CCF CCR 126 GTAAAACCAAAGCTTATCGTG TCCAGCAATGTGTGCAATG C. coli glyA CLF CLR 251 TAGAGAGATAGCAAAAGAGA TACACATAATAATCCCACCC C. lari glyA 23SF 23SR 650 TATACCGGTAAGGAGTGCTG GAG ATCAATTAACCTTCGAGCACCG C. jejuni 23S rRNA
1130 Food Anal. Methods (2019) 12:1128–1132
MALDI-TOF MS/SARAMIS revealed a Se of 98.66%,
94.82%, and 90.00% respectively for C. jejuni, C. coli, and C. lari (Table2). Specificity (Sp) was assessed at 100% for
both C. coli and C. lari and 99% for C. jejuni.
Discussion
In spite of the already mentioned strain variability, which might compromise MALDI-TOF analysis, we did not find any difficulty during the identification procedure. In our pro-tocol, indeed, no additional tests were required to complete identification of Campylobacter strains and the results were obtained much more quickly (1 h) than the traditional methods (24–48 h). It is known indeed that older and stressed (exposi-tion for long time to air, to not optimal temperature and pH) organisms gradually become coccoidal and increasingly diffi-cult to diffi-culture. Furthermore, the preparation of samples was fast and easy, as we performed MALDI-TOF MS identifica-tion starting from pure cultures withdrawn directly from a selective medium (mCCD agar). Disagreeing with previous results (Alispahic et al.2010; Martiny et al.2013), we can assert that the reliability of the method was maintained and no additional sub-culture passages in blood agar were re-quired, with a conspicuous saving of time and costs reduction (less than 1€ for each strain) (El-Bouri et al.2012). Previous studies were referred to clinical isolates and have reported difficulty in picking colonies from mCCD agar, asserting also that some media components could interfere with MALDI-TOF analysis. Otherwise, our study evaluated mass spectrom-etry reliability in food-related strain identification, not incur-ring in difficult passages (growth, oxidase and catalase activ-ity evaluation, indoxyl acetate hydrolysis, and hippurate hy-drolysis) with reduction of environmental stress (air and tem-perature). An adequate sample preparation technique, and the correct interpretation of results, was much more decisive for the obtained results. In conclusion, MALDI-TOF MS in asso-ciation with SARAMIS software can be used for the rapid identification of Campylobacter strains isolated from food samples according to ISO 10272-1:2017.
Compliance with Ethical Standards
Conflict of Interest Graziella Ziino declares that she has no conflict of interest. Stefania Maria Marotta declares that she has no conflict of inter-est. Filippo Giarratana declares that he has no conflict of interinter-est. Alessandro Giuffrida declares that he has no conflict of interest. Felice Panebianco declares that he has no conflict of interest.
Ethical Approval This article does not contain any studies with human participants or animals performed by any of the authors.
Informed Consent Not applicable.
Publisher’s Note Springer Nature remains neutral with regard to jurisdic-tional claims in published maps and institujurisdic-tional affiliations.
References
Alispahic M, Hummel K, Jandreski-Cvetkovic D, Nöbauer K, Razzazi-Fazeli E, Hess M, Hess C (2010) Species-specific identification and differentiation of Arcobacter, Helicobacter and Campylobacter by full-spectral matrix-associated laser desorption/ionization time of flight mass spectrometry analysis. J Med Microbiol 59(3):295–
301.https://doi.org/10.1099/jmm.0.016576-0
Attien P, Sina H, Moussaoui W, Zimmermann-Meisse G, Dadié T, Keller D, Riegel P, Edoh V, Kotchoni SO, Djè M, Prèvost G, Baba-Moussa L (2014) Mass spectrometry and multiplex antigen assays to assess microbial quality and toxin production of Staphylococcus aureus strains isolated from clinical and food samples. Biomed Res Int 2014:1–8.https://doi.org/10.1155/2014/485620
Bessede E, Solecki O, Sifre E, Labadi L, Megraud F (2011) Identification of Campylobacter species and related organisms by matrix assisted laser desorption ionization–time of flight (MALDI-TOF) mass spec-trometry. Clin Microbiol Infect 17(11):1735–1739.https://doi.org/ 10.1111/j.1469-0691.2011.03468.x
Biswas S, Rolain JM (2013) Use of MALDI-TOF mass spectrometry for identification of bacteria that are difficult to culture. J Microbiol Methods 92(1):14–24.https://doi.org/10.1016/j.mimet.2012.10.014 Deckert A, Valdivieso-Garcia A, Reid-Smith R, Tamblyn S, Seliske P, Irwin R, De Wey C, Boerlin P, McEwen SA (2010) Prevalence and antimicrobial resistance in Campylobacter spp. isolated from retail chicken in two health units in Ontario. J Food Prot 73:1317–1324. https://doi.org/10.4315/0362-028X-73.7.1317
Duarte A, Santos A, Manageiro V, Martins A, Fraqueza MJ, Caniça M, Domingues FC, Oleastro M (2014) Human, food and animal Table 2 Identification results:
comparison between multiplex PCR and MALDITOF MS with % of sensitivity (Se) and specificity (Sp) for MALDITOF method Strains PCR MALDITOF MS % Se % Sp TPa FPb TNc FNd Thermophilic Campylobacter 276 267 2 0 7 97.45 100.00 C. coli 116 110 0 160 6 94.82 100.00 C. jejuni 150 148 1 125 2 98.66 99.21 C. lari 10 9 0 266 1 90.00 100.00 a True positive b False positive cTrue negative d False negative
Food Anal. Methods (2019) 12:1128–1132 1131
Campylobacter spp. isolated in Portugal: high genetic diversity and antibiotic resistance rates. Int J Antimicrob Agents 44(4):306–313. https://doi.org/10.1016/j.ijantimicag.2014.06.012
Dubois D, Grare M, Prere MF, Segonds C, Marty N, Oswald E (2012) Performances of the Vitek MS matrix-assisted laser desorption ionization–time of flight mass spectrometry system for rapid identi-fication of bacteria in routine clinical microbiology. J Clin Microbiol 50(8):2568–2576.https://doi.org/10.1128/JCM.00343-12 Eaton TJ, Gasson MJ (2001) Molecular screening of Enterococcus
viru-lence determinants and potential for genetic exchange between food and medical isolates. Appl Environ Microbiol 67(4):1628–1635 EFSA (European Food Safety Authority), ECDC (European Centre for
Disease Prevention and Control) (2015) The European Union sum-mary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2014. EFSA J 13(12):4329
EFSA (European Food Safety Authority), ECDC (European Centre for Disease Prevention and Control) (2017) The European Union sum-mary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2016. EFSA J 15(12):5077.https://doi.org/ 10.2903/j.efsa.2017.5077
EFSA Panel on Biological Hazards (BIOHAZ) (2005) Opinion of the scientific panel on biological hazards on the request from the com-mission related to Campylobacter in animals and foodstuffs. EFSA J 173:1–105
EFSA Panel on Biological Hazards (BIOHAZ) (2011) Scientific opinion on Campylobacter in broiler meat production: control options and performance objectives and/or targets at different stages of the food chain. EFSA J 9:2105
Elbehiry A, Marzouk E, Hamada M, Al-Dubaib M, Alyamani E, Moussa IM, Al Rowaidhan A, Hemeg HA (2017) Application of MALDI-TOF MS fingerprinting as a quick tool for identification and clus-tering of foodborne pathogens isolated from food products. New Microbiol 40(3):169–178
El-Bouri K, Johnston S, Rees E, Thomas I, Bome-Mannathoko N, Jones C, Reid M, Ben-Ismaeil B, Davies AP, Harris LG, Mack D (2012) Comparison of bacterial identification by MALDI-TOF mass spec-trometry and conventional diagnostic microbiology methods: agree-ment, speed and cost implications. Br J Biomed Sci 69(2):47–55 Gilbert M, Karwaski MF, Bernatchez S, Young NM, Taboada E,
Michniewicz J, Cunningham AM, Wakarchuk WW (2002) The ge-netic bases for the variation in the lipo-oligosaccharide of the mu-cosal pathogen, Campylobacter jejuni. Biosynthesis of sialylated ganglioside mimics in the core oligosaccharide. J Biol Chem 277(1):327–337.https://doi.org/10.1074/jbc.M108452200 Groot MN, de Boer AG, van Pelt W, van der Hulst-van Arkel MC, de
Leeuw P, Widjaja HCA, Smits MA, van der Wal FJ (2014) A SpoT polymorphism correlates with chill stress survival and is prevalent in clinical isolates of Campylobacter jejuni. Poult Sci 93(11):2900– 2909.https://doi.org/10.3382/ps.2014-04055
Hoelzl C, Mayerhofer U, Steininger M, Brüller W, Hofstädter D, Aldrian U (2013) Observational trial of safe food handling behavior during food preparation using the example of Campylobacter spp. J Food Prot 76(3):482–489.https://doi.org/10.4315/0362-028X.JFP-12-231 Hsieh YH, Wang YF, Moura H, Miranda N, Simpson S, Gowrishankar R, Barr J, Kerdahi K, Sulaiman IM (2017) Application of MALDI-TOF MS Systems in the Rapid Identification of Campylobacter spp. of Public Health Importance. J AOAC Int 101(3):761–768. https://doi.org/10.5740/jaoacint.17-0266
Huber I, Pavlovic M, Maggipinto M, Konrad R, Busch U (2018) Interlaboratory proficiency test using MALDI-TOF MS for identifi-cation of food-associated bacteria. Food Anal Methods 11:1068– 1075.https://doi.org/10.1007/s12161-017-1084-y
ISO-International Organization for Standardization 10272-1:2006 (2006) Microbiology of food and animal feeding stuffs-Horizontal method for detection and enumeration of Campylobacter spp. - Part 1:
Detection method. International Organization for Standardization, Geneva
ISO-International Organization for Standardization 10272-1:2017 (2017) Microbiology of food and animal feeding stuffs– horizontal method for detection and enumeration of Campylobacter spp.– Part 1: Detection method. International Organization for Standardization, Geneva
Jadhav S, Sevior D, Bhave M, Palombo EA (2014) Detection of Listeria monocytogenes from selective enrichment broth using MALDI– TOF mass spectrometry. J Proteome 97:100–1066.https://doi.org/ 10.1016/j.jprot.2013.09.014
Janssen R, Krogfelt KA, Cawthraw SA, van Pelt W, Wagenaar JA, Owen RJ (2008) Host-pathogen interactions in campylobacter infections: the host perspective. Clin Microbiol Rev 21(3):505–518.https://doi. org/10.1128/CMR.00055-07
Karlyshev AV, Champion OL, Churcher C, Brisson JR, Jarrell HC, Gilbert M, Brochu D, St Michael F, Li J, Wakarchuk WW, Goodhead I, Sanders M, Stevens K, White B, Parkhill J, Wren BW, Szymanski CM (2005) Analysis of Campylobacter jejuni cap-sular loci reveals multiple mechanisms for the generation of struc-tural diversity and the ability to form complex heptoses. Mol Microbiol 55(1):90–103
Kolinska R, Dřevínek M, Jakubů V, Žemličková H (2008) Species iden-tification of Campylobacter jejuni ssp. jejuni and C. coli by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and PCR. Folia Microbiol (Praha) 53(5):403–409.https://doi.org/ 10.1007/s12223-008-0061-7
Martiny D, Dediste A, Debruyne L, Vlaes L, Haddou NB, Vandamme P, Vandenberg O (2011) Accuracy of the API campy system, the Vitek 2 Neisseria–Haemophilus card and matrix-assisted laser desorption ionization time-of-flight mass spectrometry for the identification of Campylobacter and related organisms. Clin Microbiol Infect 17(7): 1001–1006.https://doi.org/10.1111/j.1469-0691.2010.03328.x Martiny D, Visscher A, Catry B, Chatellier S, Vandenberg O (2013)
Optimization of Campylobacter growth conditions for further identi-fication by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). J Microbiol Methods 94(3): 221–223.https://doi.org/10.1016/j.mimet.2013.06.018
Mattei R, Vicario C, Nardone M, Savarino A (2012) Evaluation of the system Axima/Saramis MALDI-TOF MS bioMérieux in a clinical laboratory. Microbiol Medica 27(1):34–37
On SL (2001) Taxonomy of Campylobacter, Arcobacter, Helicobacter and related bacteria: current status, future prospects and immediate concerns. Symp Ser Soc Appl Microbiol 30:1S–15S
On SL (2013) Isolation, identification and subtyping of Campylobacter: where to from here? J Microbiol Methods 95(1):3–7.https://doi.org/ 10.1016/j.mimet.2013.06.011
Panda A, Ghosh AK, Mirdha BR, Xess I, Paul S, Samantaray JC, Srinivasan A, Khalil S, Rastogi N, Dabas Y (2015) MALDI-TOF mass spectrometry for rapid identification of clinical fungal isolates based on ribosomal protein biomarkers. J Microbiol Methods 9:93–
105.https://doi.org/10.1016/j.mimet.2014.12.014
Stella S, Soncini G, Ziino G, Panebianco A, Pedonese F, Nuvoloni R, Di Giannatale E, Colavita G, Alberghini L, Giaccone V (2017) Prevalence and quantification of thermophilic Campylobacter spp. in Italian retail poultry meat: analysis of influencing factors. Food Microbiol 62:232–238.https://doi.org/10.1016/j.fm.2016.10.028 Wang G, Clark CG, Taylor TM, Pucknell C, Barton C, Price L, Woodward DL,
Rodgers FG (2002) Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J Clin Microbiol 40(12):4744–4747 Wenning M, Breitenwieser F, Konrad R, Huber I, Busch U, Scherer S
(2014) Identification and differentiation of food-related bacteria: a comparison of FTIR spectroscopy and MALDI-TOF mass spec-trometry. J Microbiol Methods 103:44–52.https://doi.org/10.1016/ j.mimet.2014.05.011
1132 Food Anal. Methods (2019) 12:1128–1132
