2. Materials and Methods
2.1. Animals
Experimental procedures were in accordance with institutional guidelines. Mice of the rd10 strain (on a C57Bl6/J background) and wild-type (wt) C57Bl6/J control mice (both from the Jackson Laboratories, Bar Harbor, ME) were kept in a local facility with water and food ad libitum, in a 12-hour light/dark cycle, with illumination levels below 60 lux. A total of 70 mice were used for this study.
2.1.1. Isolation of a new transgenic mouse
Transgenic mice of the strain GFP-M (Feng et al., 2000; kindly donated by R. H.
Masland), aged 3-9 months were used for the experiments. In these homozygous animals (Thy1-GFP/Thy1-GFP), a small number of RGCs strongly express GFP.
A new line of transgenics, named rd10/Thy1-GFP mice, was obtained by crossing rd10 with GFP-M mice, both on the same C57B/6J background. In particular, homozygous Thy1-GFP animals were first crossed with homozygous rd10/rd10.
Individuals obtained from the first generation (F1) were backcrossed with rd10/rd10 obtaining the F2. Genotyping was performed on DNA extracted from the tails of F2 individuals by polymerase chain reaction (PCR) to identify Thy1- GFP positive individuals. The following primers were used: Thy1 forward
(AAGTTCATCTGCACCACCG) and Thy2 reverse (TCCTTGAAGAAGATGGTGCG), according to the protocol recommended by the
Jackson Laboratories. PCR amplification was performed in 35 cycles by denaturation at 94 °C for 1.5 min; annealing at 94, 61 and 72 °C, respectively, for 30 s, 1 min and 1 min; and elongation at 72 °C for 2 min.
A second PCR was performed to identify, among Thy1-GFP positive individuals, homozygous for the rd10 mutation.
In this case, primers were: RD10-F (CTTTCTATTCTCTGTCAGCAAAGC) and RD10-R (CATGAGTAGGGTAAACATGGTCTG).
The corresponding PCR amplification was performed in 30 cycles by denaturation at 94 °C for 3 min; annealing at 94, 60 and 72 °C, respectively, for 1min, 30 s and 1 min; and elongation at 72 °C for 7 min. The product obtained was purified and digested with a restriction enzyme whose restriction site is not represented in the
rd10 mutant DNA as compared to the heterozygous. The enzyme HhaI (New England BioLabs) recognizes the sequence: 5'...G/CGC...3' and 3'...CGC/G...5' (Chang B., unpublished data). After 2-hrs incubation in the enzyme at 37 °C, the digested DNA was run upon a Metaphor agarose (Cambrex, NJ, USA) allowing separation of the short DNA fragments.
2.2. Analysis of second order neuron score in rd10 mutant mice
2.2.1. Immunocytochemistry (ICCH)
Adult (1–9 months old) mice were anesthetized with intraperitoneal injection of Avertin (15 mg/kg) and perfused transcardially with 4% paraformaldehyde (PAF) in 0.1 M phosphate buffer (PB), pH 7.4. Young animals (10–20 days old) were enucleated under anaesthesia, and their eyes immersion-fixed in PFA. For ICCH on sections, whole eyes were sucrose-infiltrated, frozen at -20°C, and serially sectioned at 14 µm on a cryostat. Sections from groups of three age-matched animals of the same strain were mounted on the same slide to ensure minimal differences in tissue handling and allow consistent comparisons. ICCH was also performed on retinal whole mounts, upon retinal isolation from the eye cup following fixation. Primary antibodies used to label retinal cell types are illustrated in Table 2.
Secondary antibodies were anti-mouse Oregon Green 488, anti-mouse Alexa Fluor 488, and anti-rabbit Alexa 568 (all used as 1:400). Cones were stained with Alexa Fluor 488-conjugated peanut lectin. Nuclear staining was obtained with micromolar solutions of Ethidium homodimer-I (all fluorescent probes from Molecular Probes, Invitrogen, Milan, Italy). Retinal preparations were examined with a Leica TCS-NT confocal microscope equipped with a krypton-argon laser.
Table 2. Primary antibodies used in this study.
To compare retinal cell morphology in rd10 and wt preparations, the following parameters were matched: age; fixation and immunostaining protocols; retinal eccentricity (distance from the optic nerve head); magnification, pinhole size, gain, and offset of the confocal microscope; and thickness of extended-focus images.
Files were saved in TIF format and exported on an image workstation, equipped with Metamorph® software. Adobe Photoshop CS was used to adjust size, contrast and brightness of the images, although image manipulation was kept to a minimum. Three to four littermates for each strain and for each age (P10, P20, P30, and P45 and 3.5, 7, and 9 months) were used for ICCH on vertical sections, and reacted with the antibodies listed above. A total number of 10 rd10 and 3 wt animals were used for ICCH.
2.2.2. Rod bipolar and horizontal cells survival evaluation
Retinal whole mounts stained with antibodies against PKCα and calbindin D were used to estimate the number of rod bipolar and horizontal cells in rd10 mouse retinas, aged 1.5, 3.5, 7, and 9 months. Four retinal pairs were used for each age.
Serial optical sections were obtained at 1µm intervals to cover the thickness of the entire inner nuclear layer (INL), including the cell bodies of rod bipolar cells and horizontal cells. Scanning areas were 32 fields, 125 x 125 µm for rod bipolar cells and 250 x 250 µm in the case of horizontal cells. Fields were regularly spaced along the dorsal-ventral and nasal-temporal retinal meridians. Counts of rod bipolar cells were performed on serial reconstructions covering the entire thickness of the INL, by stacking a series of single focal planes (usually 30–40 consecutive planes, each of them 1 µm thick), with the aid of Metamorph®
software. Each rod bipolar cell was identified by the site of emergence of the primary dendrites and counted in a single focal plane; the same cell was then followed across the z stack and counted only once. This method does not require additional corrections to compensate for overcounting associated with cell counting procedures in single sections (Guillery, 2002). Horizontal cells were counted in extended-focus images of the INL, covering an average thickness of 12 µm on the z plane. Because horizontal cell bodies are largely spaced and do not overlap, counting on separate focal planes is not necessary. Retinal profiles containing labeled rod bipolar or horizontal cells were acquired with a microscope camera (Zeiss Axiocam) interfaced with dedicated software (Zeiss AxioVision)
that allowed the calculation of retinal areas. Total numbers of cells were obtained multiplying average cellular densities by corresponding retinal areas. Statistical analysis (one-way ANOVA) is performed with Excel 9.0. Average density values at each retinal location are used to generate 8 x 8 squared matrices and then analyzed with Sigmaplot 8.0 software, to obtain retinal isodensity maps at various ages.
2.3. Identification of mouse retinal ganglion cells (RGCs)
2.3.1. Immunocytochemistry
Animals are anesthetized with Avertin (0,1ml/5g) and after eye removal they were euthanize with an overdose of the same agent. Eyes are quickly enucleated taking a topographic reference (dorsal), rinsed and then fixed in 4% PAF in 0.1 M PB, pH 7.4, for 1 hour. Some of the retinas were dissected from the posterior pole, isolated, deprived of pigment epithelium, and flattened making four cuts plus a recognition sign in the dorsal quadrant. Others retinas were infiltrated in 30%
sucrose in 0.1 M PB and frozen in tissue-tek (Sakura, NL) and stored at -20 °C until use. After fixation, the retinas were rinsed in 0.1 M PB (3x 10 minutes) and left overnight in a blocking solution with 0,5% Triton X-100, 10% rabbit serum, 5%
BSA in phosphate-buffered saline (PBS; pH 7.4, Sigma Aldrich, St Louis, MO, USA) at 4°C. Subsequently, the retinas were incubated in a solution containing anti-GFP (1:500, rabbit conjugated with Alexa Fluor 488, Molecular Probes, Invitrogen, Milan, Italy), for two days at 4°C. Then the retinas were rinsed 3 x 15 min and treated with a solution with RNAse (Invitrogen, Milan, Italy) in PBS at 37°C for 1h. Finally, after rinsing in PBS, the retinas were stained with Ethidium homodimer-I (1:1000, Molecular Probes, Invitrogen, Milan, Italy) for 1h at room temperature on a rotary shaker. This nuclear marker is used to reveal retinal nuclear layers. Finally, the retinas were rinsed in PBS (3 x10 minutes) and mounted “ganglion cells up” on a slide in Vectashield (H1000, Vector Laboratories, Burlingame, CA) and visualized with Leica TCS-NT confocal microscope at resolutions of 1024x1024 or 512x 512 pixels. Images were acquired using a 25x (PL FLUOTAR 0.75 oil) and a 40x (HCX PL APO 1.25-0.75 oil) objectives, setting a constant distance between adjacent focal planes (1,013 μm). The files were saved in export format and analyzed off-line with Metamorph
(v. 5.0r1 Metamorph, Universal Imaging, Inc., Downingtown, PA, USA), to perform 3D reconstructions of single cells and to measure their dendritic tree and body area. This analysis provides key parameters for morphological classification of RGCs (following that of Sun et al., 2002a). A total number of 50 retinas were analyzed (see Table 3).
2.3.2. Classification parameters
To recognize different types of RGCs, the classification of Sun et al. (2002a) was followed. 4 parameters were taken into account: the first parameter was the diameter of the dendritic tree of ganglion cells. This was obtained measuring with Metamorph the area of the smallest 2D convex polygon traced along each dendritic tip on a projection of the dendritic arborization when collapsed along the z-axis. This measure was repeated three times for each cell and the average taken as the mean value of the diameter of the dendritic tree, rounded to a circle.
The second parameter was the diameter of the RGC body. This was derived tracing the contour of the 3-D projection of the cell body image, obtained from optimal, non saturated confocal images. Also in this case, the diameter was calculated approximating the cell to a circle. The third measure we determined was the mean stratification depth of the ganglion cell dendritic arborization within the inner plexiform layer. This parameter was measured using orthogonal projections of the cells (in which the outer and inner borders of the inner plexiform layers are visible), obtained from corresponding Ethidium homodimer stacks. The depth of stratification of a particular cell was directly measured as the mean depth of the dendrites within the layer derived from the formula reported in Fig.19.
The fourth parameter we took into account to evaluate RGC morphology was the shape of the dendritic arbor as described by Sun et al. (2002a). This parameter is a true blueprint suggestive of a cell type and allows the distinction of cellular types sharing other morphometric values.
The dendritic trees and somas of cells of different age groups classified as belonging to the same type, were selected and drawn along the whole z-stack with Neurolucida (3.2 version, MicroBright Field, Inc.). Neuronal tracings were analyzed with NeuroExplorer of the same suite.
To evaluate whether modifications in the fine dendritic arborization complexity occurred as a function of the disease progression, three additional parameters were considered: total dendritic length, total number of nodes and total dendritic tree area. All data were statistically evaluated with Origin (v.7SR1, OriginLab Corporation, MA, 01060, USA). A number of 572 RGCs were identified according to the classification of Sun et al. (2002a); of these, 164 were drawn with Neurolucida. A summary of the samples examined and of the total number of cells analyzed is reported in Table 3 (to see the totally of classification data, see the Appendix).
2.4. RGC survival in adult mutant mice
Another important information besides the retention of an appropriate morphology is the survival rate of RGCs as a function of the animal’s age and thus of the retinal degeneration process.
Figure 19. Method for determining the mean stratification depth of a RGC. a is the shortest distance from the dendritic arborization and the inner margin of the inner nuclear layer (IN); b is the distance between the innermost aspect of the dendritic tree and the INL; c is the total IPL depth.
(modified from Kong et al. 2005).
Table 3. Retinal samples examined for the transgenic strain at different ages and for control mice at 8 months of age.
2.4.1. Immunocytochemistry protocol for counting
Retinal whole mounts obtained with the same procedure described in 2.2.1 were stained with Ethidium homodimer-I and used to estimate survival of cells in the ganglion cell layer (GCL) of rd10/Thy1-GFP and wt mice, aged 9 months. Four retinal pairs were used for rd10/Thy1-GFP and 3 for control mice. Serial optical sections were obtained at 1,013 µm intervals to cover the thickness of the entire GCL. The method used was essentially the same described in 2.2.2, except for the employment of a 40x (HCX PL APO 1.25-0.75 oil) objective. Counting protocol and statistic analysis were the same used for rod bipolar and horizontal cells;
endothelial and perivascular cells in the GCL were excluded from the counts.
2.5. Vascular density (VD) assessment
The density of a vascular network matches the metabolic demand of different nervous system territories, with and increasing oxygen consumption (and, therefore, supply) in areas with higher activity, often related to high synaptic density.
2.5.1. Immunocytochemistry protocol for blood vessels
Retinal whole mounts obtained from the same procedure described in 2.2.1 and stained with isolectin from Griffonia simplicifolia, conjugated with FITC (1:200, Bandeiraea simplicifolia, Sigma-Aldrich, St Louis, MO, USA) were used to estimate the complexity of blood vessels of the GCL in rd10/Thy1-GFP and control retinas, aged 9 months. For each time point, three whole mount retinal pairs were isolated from rd10/Thy1-GFP and three from control mice, fixed in 4%
PFA, rinsed in PBS 3 times for 10 min and then incubated o/n with a solution of artificial cerebrum spinal fluid (ACSF, tissue culture grade from Sigma Aldrich, MO, USA) with 0,1 %Triton and Griffonia isolectin diluted 1:400. Then, the retinas were rinsed in ACSF (3 x10 minutes) and mounted ganglion cell side up in ACSF.
Images were obtained at the confocal microscope using a 10x (N-PLAN 0.25 dry) and a 16x (PL Fluotar 0,50 mm) objective, at a resolution of 1024x1024 pixels.
Scanning areas are 5 fields spanning both peripheral and central retinal areas. To measure the number of vessels per unit area, we applied the intersection method:
a count was made of the number of intersections between vessels and an overlaying squared grid, 500 µm in side and uniformly divided in 50 µm x 50 µm squares. Data were expressed as vessels/mm2.
2.6. Anterograde axonal transport in mutant mice
Active uptake and anterograde transport of ganglion cell axons was evaluated by injection of B subunit of cholera toxin into the eyes of four rd10 and one wt mice of 9 months of age.
2.6.1. Immunocytochemistry for cholera toxin
Animals were anesthetized with intraperitoneal injection of Avertin (0,1ml/5g). 0.5 µl of B subunit of biotinylated cholera toxin (10mg/ml, Sigma-Aldrich, St. Louis, MO, USA) were injected into the left eye; 0.5 µl of fluorescent cholera toxin (1mg/ml, Alexa fluor-488 conjugate, Molecular Probes, Invitrogen, Milan, Italy) were injected into the right one. Injections were done with a glass micropipette with a tip diameter of 0.45 µm (Clark Electromedical Instruments, Pangbourne, GB). 24 hours after the injection, mice were perfused transcardially with 4% PAF in 0.1 M PB, pH 7.4. The brains and optic nerves were dissected and post-fixed in PAF for 2 hours. After rinsing in buffer, brains were cryoprotected in 30% sucrose o/n. Coronal brain sections (40 µm thick) were obtained by using a sliding microtome. Selected sections of lateral geniculate nucleus (LGN) and superior colliculus (SC) were incubated overnight in Cy3 conjugated avidin (1:500, Molecular Probes, Invitrogen, Milan, Italy), rinsed in buffer (PBS) 3 times x 15 minutes and mounted with glycerol and visualized with Leica TCS-NT confocal microscope at a resolution of 1024x1024 pixels. Acquisitions were done using 5x (N-PLAN 0.12 dry) and 10x (N-PLAN 0.25 dry) objectives. Images were adjusted in brightness and contrast using Photoshop 8 (Adobe Systems, San Jose, CA, USA). A total number of 13 retinas were analyzed.
