• Non ci sono risultati.

- - + - unlabeled NF-kB probe

N/A
N/A
Protected

Academic year: 2021

Condividi " - - + - unlabeled NF-kB probe "

Copied!
1
0
0

Testo completo

(1)

- + - - anti-RelA/p65 Ab

- - + - unlabeled NF-kB probe

- - - + unlabeled mtNF-kB probe

protein-DNA complexes

free probe

Supplementary Figure 2. Nuclear extracts (2 µg) of SIE cells treated for 20 minutes with

50 ng/mL rDrm were incubated with a biotin-labeled NF-kB double-stranded DNA

oligonucleotide probe (5’AGTTGAGGGGACTTTCCCAGGC) in the absence or in the

presence of anti-RelA/p65 antibodies or of a molar excess of the unlabeled NF-kB probe

or of a mutant NF-kB probe (5’AGTTGAGGCGACTTTCCCAGGC). The protein-DNA

complexes were analyzed by EMSA onto a native 6% polyacrylamide gel.

Riferimenti

Documenti correlati

[r]

activity and of the expression of the interleukin-8 (IL-8) gene in bronchial epithelial cells in which the in flammatory response.. has been challenged

A and B Nuclear extracts from MCF-7 cells treated with 10!7 M DHT or left untreated in PRF–CT for 2 h were incubated with either a biotinylated oligonucleotide containing the

Forty nine proteins are shared by both the UNION and the DG sets, establishing a feedback loop: ‘‘interaction with NF-kB pathway R transcription factor activation R

disclosure è infatti solo uno degli outcome della Corporate Social Performance (si veda.. il paragrafo 7.3.2); ciononostante è stata utilizzata come proxy della CSP in virtù del

The agency of Third World actors is narrowed to harnessing ‘the dominant international reality of their age, the Cold War, to maximize potential benefits.’ 40 Ghana is solely

Occorre a questo punto dire che il legislatore non ha perso la cattiva abitudine di agire con norme processuali anche nel caso al nostro esame della

professore ordinario di Storia contemporanea presso la Scuola Normale Superiore di Pisa, General editor della Cambridge. History of Communism (Cambridge University