INDEX Abstract ... 3 Riassunto ... 4 Preface ... 5 Introduction ... 7 1. Group B Streptococcus ... 7 1.1 Pathologies ... 7
1.2 Pathogenic mechanisms and virulence factors... 8
1.3 GBS antigens... 10
1.4 Epidemiology ... 12
1.4.1 GBS emergence and intrapartum antibiotic prophylaxis ... 12
1.4.2 Infants ... 13 1.4.3 Adults ... 13 1.4.4 Serotype distribution ... 14 1.5 Vaccines ... 14 2. Characterizing GBS in a population ... 16 2.1 Antibiotic resistance ... 16
2.2 GBS capsular serotype identification ... 18
2.3 GBS sequence type identification by Multilocus Sequence Typing (MLST) ... 19
2.3.1 Frequent Sequence Types and hypervirulent ST-17 ... 20
2.3.2 Study of GBS clustering ... 21
Aim of the thesis ... 22
Material and methods ... 23
1. Sample collection ... 23
2. Antibiotic susceptibility testing ... 23
2.1 Penicillin-Erythromycin-Clindamycin antibiogram ... 23
2.2 Epsilon test (E-test) ... 24
3. Capsular serotyping of GBS strains ... 25
3.1 Agglutination with Strept-B-Latex (Staten Serum Institut) ... 25
3.2 Multiplex PCR ... 25
3.2.1 DNA extraction ... 25
3.2.2 Multiplex PCR ... 25
3.2.3 Separation and detection of amplified DNA ... 26
3.3 Multilocus Sequence Typing System (MLST) ... 27
3.3.1 DNA amplification ... 27
3.3.2 Purification of the amplification products ... 29
3.3.3 DNA sequencing ... 29
3.3.4 Precipitation of sequencing products ... 30
3.3.5 Sequence analysis ... 31
Results and discussion ... 32
1. Antibiotic resistance ... 32
2
3. Sequence types ... 38 Conclusions ... 42 Bibliography ... 43
3
ABSTRACT
Streptococcus agalactiae, also known as Group B Streptococcus (GBS) is an important
human pathogen mainly known as a leading cause of neonatal sepsis and meningitis, but is also responsible for invasive disease in pregnant women and adults. From extensive studies in newborns it is known that GBS can cause early-onset disease in the first days of life when it is acquired from colonized mothers during birth, or late-onset disease, between 7 and 90 days after birth. In pregnant women GBS can cause invasive disease or colonize asymptomatically the urogenital tract. More recently, GBS has emerged as an important pathogen for elderly adults, where it causes primary bacteremia without evident focus, and skin or soft tissue infection. Overall estimated GBS
incidence in neonates, which decreased after intrapartum antibiotic prophylaxis was introduced, is now 0.53 per 1000 live births in Europe, 0.67 in the Americas and 0.15 in Australasia. In pregnant women GBS disease incidence is 0.49/1000, while estimated colonization is 20-30%. In non-pregnant adults invasive GBS incidence is heavily increasing, being 7.3/100 000 in people aged 15-64, and 26.0/100 000 among those 65 years or older.
Streptococcus agalactiae is a β-hemolytic bacteria according to Brown’s classification and
is a group B Streptococcus in the Lancefield classification. GBS can be classified on the basis of the capsular polysaccharide (CPS), which defines ten serotypes (Ia, Ib, II-IX). GBS can furthermore be characterized by a Sequence Type, based on the sequence of seven housekeeping genes, revealed with Multilocus Sequence Typing (MLST).
The aim of the thesis is to characterize GBS distribution in colonized post-menopausal women in Granada, Spain. While the epidemiology of GBS is well studied in neonatal disease, there are few data on the elderly. The project included: 1) study of susceptibility and resistance to
Penicillin, Erythromycin and Clindamycin; 2) serotype distribution analysis with Strep-B-Latex agglutination test and Multiplex PCR; 3) Sequence Type identification and distribution through Multilocus Sequence Typing.
Colonization rate in post-menopausal women was 17.8%. GBS strains isolated from 50 colonized subjects were 100% susceptibility to penicillin. Erythromycin resistance rate was 26 %, and clindamycin resistance rate was 22%. Analysis of the capsular serotype showed that the most frequent serotypes were III (34 %), Ia (22 %), V (20 %) and II (14 %), while other serotypes were present in less significant percentages.
MLST showed that the most frequent ST was ST-19, followed by ST-23, ST-1 and ST-17. Remarkable correlation were observed between serotype Ia and ST-23 (16%), followed by serotype III ST-19 (14%), serotype III ST-17 (12%) and serotype V ST-1 (12%).
Group B Streptococcus distribution in post-menopausal women was similar to infants, pregnant women and adults, with some minor divergence in terms of serotypes and sequence types. The emergence in serotype V as the major capsular serotype in the elderly, reported in the literature, was not observed in our population. Due to the lack of information on GBS in the elderly, with our data we contribute to the scientific background on the epidemiology of this pathogen, thus allowing to better understand the bacteria and its features. Our data will represent a basis for comparison to data on other subgroups of elderly adults, to understand why GBS invasive disease is spreading in this population, and if colonization with a certain strain might be a risk factor for pathology development, therefore allowing us to intervene with appropriate prophylaxis measures.
4
RIASSUNTO
Streptococcus agalactiae, o Streptococco di gruppo B (Group B Streptococcus, GBS) è un
importante patogeno umano, conosciuto come principale causa di sepsi e meningite neonatale, ma è anche responsabile di malattia invasiva nelle donne in gravidanza e negli adulti. Ampiamente studiato nei neonati, GBS causa una sindrome precoce nei primi giorni di vita, definita early onset
disease, quando il batterio è acquisito durante il parto dalla madre colonizzata, o una sindrome che
si manifesta tra 7 e 90 giorni dopo la nascita, late onset disease. Nelle gestanti, GBS può causare malattia, o colonizzare in modo asintomatico il tratto urogenitale. Negli ultimi anni GBS è emerso come patogeno negli anziani, causando malattia invasiva che si manifesta con batteremia e infezioni della pelle e dei tessuti molli. L’incidenza della malattia da GBS nei neonati, ridotta con
l’introduzione di una profilassi antibiotica, attualmente è di 0,53 su 1000 nati vivi in Europa, 0,67 in America e 0,15 in Australasia. Nelle donne in gravidanza l’incidenza di malattia da GBS è di
0,49/1000, ma si stima una colonizzazione del 20-30%. Negli adulti l’incidenza di malattia da GBS, che risulta in aumento, è di 7,3/100 000 nella fascia d’età 15-64 anni, e 26,0/100 000 oltre i 65 anni.
Streptococcus agalactiae è un batterio β-emolitico secondo la classificazione di Brown ed è
uno Streptococco di gruppo B nella classificazione di Lancefield. GBS può essere classificato sulla base del polisaccaride capsulare, che definisce dieci sierotipi (Ia, Ib, II-IX); può inoltre essere caratterizzato con un sequence type (ST) in base alla sequenza di sette geni house-keeping identificata con la tecnica del Multilocus Sequence Typing (MLST).
Lo scopo della tesi è di caratterizzare la distribuzione di GBS nelle donne in
post-menopausa colonizzate nel tratto urogenitale, nell’area geografica di Granada, Spagna. Il progetto include: 1) lo studio della suscettibilità e della resistenza agli antibiotici Penicillina, Eritromicina e Clindamicina; 2) l’analisi della distribuzione dei sierotipi utilizzando due tecniche, l’agglutinazione Strep-B-Latex e Multiplex PCR; 3) l’identificazione e la distribuzione degli ST grazie alla tecnica MLST.
Il tasso di colonizzazione delle donne in menopausa è risultato del 17,8%. I ceppi di GBS isolati da 50 donne colonizzate dal batterio hanno mostrato una sensibilità del 100% alla penicillina. Il tasso di resistenza all’eritromicina è del 26%, mentre il 22% è risultato resistente alla
clindamicina. L’analisi del sierotipo capsulare ha mostrato una frequenza maggiore dei sierotipi III (34%), Ia (22%), V (20% e II (14%), mentre gli altri sierotipi sono rilevabili in percentuali meno significative. Con l’MLST sono stati identificati gli ST più frequenti: ST-19, ST-23 e ST-17. È inoltre osservabile una importante correlazione tra sierotipo Ia e ST-23 (16%), sierotipo III e ST-19 (14%), sierotipo III e ST-17 (12%), sierotipo V e ST-1 (12%). La distribuzione del GBS nelle donne in menopausa è risultato simile a quella riscontrabile nei neonati, nelle donne gestanti e negli adulti, con delle divergenze secondarie nei sierotipo e ST. La progressiva diffusione del sierotipo V negli anziani, riportata in letteratura, non è rilevabile nella popolazione oggetto del nostro studio.
Considerando la mancanza di informazioni sulla distribuzione di GBS negli anziani, i dati ottenuti con questo studio contribuiscono ad ampliare le conoscenze epidemiologiche sul patogeno, permettendo di capire in modo più approfondito e completo il batterio e le sue caratteristiche. I nostri dati potranno essere comparati con quelli di altre sottogruppi nelle fasce di età avanzate, per capire perché GBS si sta diffondendo in questa popolazione, e se la colonizzazione con un dato ceppo può rappresentare un fattore di rischio per l’evolversi della malattia, permettendoci così di intervenire con misure profilattiche appropriate.
5
PREFACE
Streptococcus agalactiae, also known as Group B Streptococcus (GBS), is a pathogen mainly
known as leading cause of neonatal sepsis and meningitis that can arise in the first three months of life. GBS is also an important cause of disease in pregnant women and immunocompromised adults, but it is acquiring relevance in the elderly, where it is becoming a major concern among infectious diseases. GBS has been thoroughly studied in neonates and pregnant women. However, lack of information on the elderly represents a limit to understand the arising GBS pathologies in this population.
Due to the concern for newborns health, many studies have been carried out from the 1960s, focusing on the application of antibiotic strategies and on the development of a vaccine against GBS. In 2008, a pan-European program known as DEVANI (Design of a Vaccine Against Neonatal
Infection) was launched with the purpose to design a new vaccine to protect neonates against GBS
infections. The notions that have been acquired with this study might be extended and applied to protect elderly from GBS infection.
To date ten GBS serotypes have been identified, and different colonization and infection rates have been described in different populations or geographical regions. This draws attention to
epidemiological studies as an important vehicle for evaluating the health risks posed by changes in distribution of GBS serotypes. They also represent an essential tool to provide as much information as possible to understand how the bacteria spread, infect and evolve to avoid the host immune system.
Our study acquires relevance in this context. There is an important lack of information on GBS colonization among adults and elderly; we studied the distribution of GBS in post-menopausal women, providing data about non-invasive colonization in this group. Post-menopausal women are a subgroup of the elderly, but also represent a link with pregnant women that, when colonized, can infect the newborn. Starting from the information we provide, further studies can be carried out to investigate some hypothesis: women may undergo an immune system weakening with age, therefore colonization with a specific strain might represent a risk factor and alert for pathology development; local environment changes which occur with menopause may bring a new
colonization site for GBS that was not present in fertile women, and can therefore result in disease expression.
6
As GBS is studied in many laboratories of different regions, the information can be summed to understand more and more the bacteria and its features. We are gradually enhancing the scientific background on the epidemiology of GBS, thus allowing to focus future research on effective targets with the purpose to eliminate GBS as a health concern.
7
INTRODUCTION
1. Group B Streptococcus
Streptococcus agalactiae, or Group B streptococcus (GBS), is a human pathogen that represents a
leading cause of neonatal invasive disease and an emerging etiological agent in
immunocompromised and elderly patients. However, GBS is usually a commensal bacterium that asymptomatically colonizes the gastrointestinal and genitourinary tract of up to 30% of healthy adults (1).
GBS is a Gram-positive, round-shaped, immobile and non-sporulating opportunistic pathogen. It is a catalase-negative, facultative anaerobic bacterium. Although this bacterium grows on enriched media such as blood-containing agar plates, where hemolysis is readily detectable, the selective and differential Granada Medium has been developed to recognize specifically GBS. Production of a red pigment, recognized as an ornithine glycopolyene, was identified early in GBS (2), and is the basis for the rapid detection of beta-hemolytic GBS on Granada medium, which contains
methotrexate as a pigment-enhancing folic acid antagonist (3).
According to Brown’s classification (1919), GBS is a beta-hemolytic bacterium, recognizable by a yellowish and transparent halo around the colonies due to the complete hemolysis of red blood cells when grown on a blood agar plates. According to Lancefield’s classification, based on the group carbohydrate expressed on the cell wall, Streptococcus agalactiae in also known as Group B Streptococcus. GBS is also classified on the basis of a capsular polysaccharide (CPS), which defines nine distinct serotypes: I, II, III, IV, V, VI, VII, VIII. A new serotype, serotype IX, has recently been discovered (4). GBS can furthermore be characterized by Sequence Type, based on the sequence of seven housekeeping genes.
1.1 Pathologies
- In infants, GBS causes two syndromes: early-onset disease (EOD) and late-onset disease (LOD). EOD occurs in the first days of life, due to the perinatal transmission from colonized mothers to the newborn. LOD occurs between 1 week and 2 to 3 months of age and may be transmitted from the mother or acquired from nosocomial or community environments (5).
8
Clinical symptoms include sepsis, meningitis, pneumonia, cellulitis, osteomyelitis and septic arthritis. Bloodstream infections occur in 89% of infancy cases (6), while meningitis
frequently develops in LOD . GBS disease can result in death and neurologic sequelae after meningitis. Risk factors for newborn infection are maternal colonization, prolonged rupture of membranes, prematurity, low levels of GBS specific maternal antibodies, intrapartum fever, male sex, ethnicity (Black race) (7).
- In pregnant women GBS colonization can be symptomatic or asymptomatic. Clinical illness ranges from mild urinary tract infection to sepsis and meningitis. Most invasive maternal infections are bloodstream infections, however osteomyelitis, endocarditis and meningitis have also been described (5). In pregnancy and postpartum, noninvasive syndromes include amnionitis, endometritis, post-cesarean wound infection, cellulitis and fasciitis (8). Risk factors for mother colonization include local hygiene and sexual practices, use of tampons or intrauterine devices, ethnicity (Black race), obesity, absence of lactobacilli in the
gastrointestinal flora and preterm delivery. A possible role for the GBS colonization of the mother leading to preterm low birth weight has also been suggested (5).
- In non-pregnant adults, the clinical presentation that most often occurs is primary
bacteremia without evident focus, and skin or soft tissue infection is the next most common presentation. Other symptoms, such as pneumonia, urosepsis, endocarditis, peritonitis, meningitis and empyema occur less frequently. GBS disease presentations are often
associated to polymicrobial bacteremia, with staphylococci and enterococci being the most common isolated organisms. Risk factors for invasive GBS disease are age and some pathologic conditions such as diabetes mellitus, previous stroke, decubitus ulcer, cirrhosis, breast cancer and neurogenic bladder (9).
1.2 Pathogenic mechanisms and virulence factors
GBS uses different strategies in the various stages of the infection, from the adherence and invasion of the host’s epithelium to the avoidance of the immune system.
- Adherence to epithelial cells: GBS binds efficiently to human cells of many fetal, infant and adults tissues. A non-protein ligand important for GBS adherence is lipoteichoic acid (LTA),
9
an amphiphilic glycolipid polymer that extends through the cell wall. It has been suggested that the age-restricted susceptibility to GBS disease may be linked to the levels of LTA on the GBS surface. GBS also binds to the extracellular matrix components fibronectin, fibrinogen and laminin.
- Crossing the epithelium: GBS strains can present different affinities to the epithelia of different host districts, determining the invasive degree of the strain. GBS can cross the epithelium by cellular invasion, triggering its own endocytotic uptake, and the alpha C protein can mediate translocation (10). However, it has been observed that bacteria cross intercellular junctions by a temporary dislocation of junctional elements, demonstrating that translocation occurs mainly through a paracellular route (11).
- Direct injury to host cellular barriers: The most important GBS product that is cytotoxic to human cells is the β-hemolysis/cytolysin (β-H/C). This protein is a pore-forming cytolysin which disrupts epithelial and endothelial barriers, thus theoretically facilitating placental penetration and systemic spread of GBS in the infant. However, intracellular invasion and transcytosis of the alveolar epithelium by colonizing GBS may represent a mechanism of bacterial spread to the bloodstream. H/C is responsible for the GBS characteristic β-hemolysis on blood agar plates.
- Avoidance of the immune system: GBS possesses several virulence factors that interfere with effective opsonophagocytosis, the main one being the type-specific polysaccharide capsule. The sialic acid component has been correlated to the virulence, and it interferes with the effective deposition of C3 on the pathogen surface. The c-antigen is a protein consisting of two components, α and β. The latter binds to IgA in a non-immune manner, interfering sterically with deposition of protein C3. CpsA is a surface protease that cleaves fibrinogen, producing fragments that coat the bacterial surface and thus prevent
opsonization. In addition, to avoid the immune clearance, GBS contribute to poor neutrophil mobilization by producing an enzyme that inactivates human C5a, a complement protein that chemoattracts neutrophils. β-H/C lyses directly macrophage and neutrophils. GBS also produces superoxide dismutase as a means of protection against oxidative stress.
10
1.3 GBS antigens
Streptococcus agalactiae has several polysaccharide and protein antigens.
Polysaccharide antigens:
- Group B carbohydrate is an antigen common to all strains and serotypes of GBS. Positioned proximal to the cell wall, it is composed of rhamnose, galactose, N-acetylglucosamine and glucitol arranged in four different oligosaccharide units linked by phosphodiester bonds. Group B carbohydrate is not important for natural immunity , and the inability of Group B-specific antibodies to bind to the group B antigen on highly encapsulated isolates excludes the possibility of a Group B carbohydrate-based vaccine (12).
- Capsular Polysaccharide (CPS): With a few exceptions, all strains of GBS isolated from humans are encapsulated and can be classified on the basis of serology and CPS structure. Ten distinct GBS serotypes have been described: Ia, Ib, II, III, IV, V, VI, VII, VIII, and the recently identified serotype IX. GBS serotypes differ in the CPS structure. In fact, there is a high heterogeneity among the structures, despite the fact that each repeating unit contains four of only five sugars (glucose, galactose, N-acetylglucosamine, rhamnose and sialic acid). A critical role for CPS sialic acid in evading the host’s natural immune mechanisms and thus in modulating GBS virulence has been suggested. The presence of sialic acid on GBS, in fact, creates a surface that does not activate the alternative pathway of complement (13).
Protein antigens:
- Alphalike Proteins include Alpha C Protein, Rib protein and others. Alpha C protein was identified together with another antigen, the Beta C protein, of which the first was trypsin resistant and the second trypsin sensitive. Generally present in strains of Ia and Ib capsular serotype and frequently present in type II strains, these antigens are occasionally found in GBS of all serotypes.
The alpha C protein gene, bca, encodes many regions including a signal sequence with homology to other gram-positive surface proteins, followed by an amino-terminal domain, a nd a series of nine long tandem repeats, identical at the nucleotide level, which account for >75% of the mature protein. Antibodies to both the repeat region and the amino-terminal domain have been shown to be protective in animal models and to mediate
11
opsonophagocytic killing in vitro (14). A size discrepancy between the alpha C proteins of GBS isolates from mothers and those from their neonates suggested that a loss of repeats within the protein gene may occur during colonization or infection with GBS.
Rib is an alphalike protein, phenotypically similar but immunologically distinct from alpha C protein, that has been discovered in a type III GBS strain (15). The gene coding for Rib showed structural as well as sequence similarity to the alpha C protein. Antisera to Rib are fairly protective in mice but do not cross-protect the animals against infection by alpha-positive GBS (16).
Other alphalike genes, such as Alp2 and Alp3, have been identified, mostly in type V and VIII GBS. These genes preserved the overall structure found in alpha C protein. R proteins represent a group of four immunologically distinct protein antigens occurring in various combinations in streptococci of groups A, B and C. Subtypes R1 and R4 are the most frequently found in GBS, predominantly in type II and type III strains.
- Beta C protein is an antigen expressed on the surface of approximately 10 to 25% of GBS strains, with a predominance in Ib strains (17), which binds specifically to the Fc portion of the human IgA heavy chain (5). Antibodies against beta C protein appear to be highly protective and Fusco et al. have found an actual bactericidal activity of these antibodies, which are able to promote GBS killing in the absence of polymorphonuclear leukocytes (12).
- GBS80 is an antigen that assembles in a pilus-like structure extending from the bacterial surface, the length of which depends on the expression level of GBS80. This antigen, discovered only in 2005 by Lauer et al. (18) through genome analysis, has been shown to confer protection in a mouse model of maternal immunization, suggesting that pili may play an important role in GBS virulence.
- Other surface protein antigens have been found on GBS, such as the Sip protein, present in GBS of all serotypes; the BPS protein, that elicits protective antibodies; C5a peptidase, that inactivates human C5a, an important component of complement-mediated neutrophil chemoattraction which may also play a role in bacterial invasion of epithelial cells by binding to fibronectin (19).
12
1.4 Epidemiology
1.4.1 GBS emergence and the introduction of intrapartum antibiotic prophylaxis
GBS was at first identified in humans by Lanciefield and Hare in 1935. In 1938 three fatal cases were reported in post-partum women. While reports of GBS disease were sporadic until 1960s, by the early 1980s GBS had been recognized as the most common cause of neonatal sepsis and meningitis in a number of developed countries. Type III was the most frequent serotype among infants with GBS meningitis (7).
Due to its substantial perinatal morbidity, with 1-3 in 1000 neonates affected and >50% mortality (20), GBS was a major concern in the 1980s. As a result, intrapartum antibiotic prophylaxis (IAP) was attempted, and in 1986 it was first demonstrated that the administration of intravenous
penicillin or ampicillin to GBS-colonized pregnant women during delivery can prevent the mother-to-newborn transmission of GBS (1). The efficacy of IAP in preventing early-onset GBS disease is estimated at approximately 80% (21). In contrast, there are no preventive strategies for late-onset GBS disease because of its poor correlation with mother colonization.
In 1996 the first guidelines for GBS prevention were issued in the U.S. These guidelines
recommended the use of either a risk-based or a screening-based approach to identify mothers who are candidates for IAP. The risk-based approach provided IAP to women who had any risk factor. The screening-based approach proposed routine prenatal GBS screening between 35 and 37 weeks of gestation, and recommended IAP for all women who were either colonized, or whose
colonization status was unknown, and those with risk factors. In 2002 the universal screening-based approach was recommended (22).
Since the advent in the USA of routine screening for maternal GBS colonization and antibiotic prophylaxis for GBS carriers, the incidence of early-onset neonatal disease has declined from 1.7 cases per 1000 neonates in 1990 to 0.34-0.37 case per 1000 in 2008 (23). The incidence of early-onset GBS disease has reached a plateau for the past several years. In contrast, the incidence of late-onset disease has not decreased at all.
13
1.4.2 Infants
Approximately 50% of the neonates born from a GBS colonized mother become colonized, and 1% progress to develop invasive disease. Current global incidence of GBS disease in infants under three months was reviewed by Edmond et al. (24). The analysis, which was confined to data since the year 2000, provided an estimate of an overall incidence of 0.53 per 1000 live births (range 0.44-0.62) in the European region, 0.67 (range 0.54-0.80) in the Americas and 0.15 (range -0.03 to 0.07) in Australasia. Intrapartum antibiotic prophylaxis (IAP) was frequent in developed countries and associated to lower incidence figures. Countries reporting no use of IAP had a 2.2-fold higher incidence of early-onset GBS disease compared to those reporting IAP use. A study of causes of admission to neonatal intensive care units conducted in the USA in two periods, 1997-2001 and 2002-2010, showed that while incidence of early-onset disease declined from 3.5 to 2.6 per 1000 admissions, late-onset disease increased from 0.8 to 1.1 per 1000 admissions (25). These data show how even strict and universal implementation of IAP guidelines does not eliminate early-onset GBS disease. The current overall case fatality rates by region are 0.07 per 1000 live births (range 0.04-0.1) in Europe and 0.11 (range 0.6-0.16) in the Americas.
GBS incidence in infants has been studied also in developing countries, although
under-identification and under-reporting of cases and deaths appears very likely, especially where it is difficult to access modern healthcare. The overall incidence of GBS in resource-poor settings ranges between 0 and 3.06 per 1000 births, and the case fatality rates median is 20% (range 10-60%), as reported by Dagnew et al. (26). Differences in incidence were observed both between and within geographic regions. Potential explanations for these variations include fundamental differences in disease epidemiology due to differences in maternal GBS colonization, differences in strain virulence, maternal and infant antibody levels or genetic susceptibilities. However, differences in microbiological and sampling techniques may play an important role in differences in the reported incidences (7).
1.4.3 Adults
In developed countries an estimated 20-30% of women are colonized with GBS. Invasive disease can be associated with pregnancy and the majority occurs in the postpartum period. In a recent study the incidence was shown to be 0.02/1000 in non-pregnant women, compared to 0.49/1000
14
(range 0.36-0.64) in postpartum women. Pregnant women had a relative risk for GBS disease of 5.0 (range 2.9-8.7) compared to non-pregnant women. Among those for whom the pregnancy outcome was known (90%), 61% had a spontaneous abortion or stillborn infant, 30% had infants with no apparent illness, 5% had live-born infants who developed clinical infections, and 4% had induced abortion (27).
GBS disease incidence in non-pregnant adults shows a different trend. As reported by Skoff et al. (28) the incidence among non-pregnant adults increased significantly in the USA between 1990 and 2007, in contrast to neonates and pregnant women. Among people aged 15-64 years, the incidence increased from 3.6/100 000 in 1999 to 7.3/100 000 in 2007, with a relative increase of 48%. Among those 65 years or older, the incidence increased from 21.5/100 000 to 26.0/100 000, with a relative increase of 20%. These values translate to an increase in the overall incidence of adult disease from 6.0/100 000 in 1999 to 7.9/100 000 in 2005, that is a 32% increase. The case fatality rates, which are markedly higher in adults than in neonates (29), decreased from 23.7% in 1990 to 7.5% in 2007. GBS disease is therefore becoming an increasingly important issue in the elderly.
1.4.4 Serotype distribution
The serotype most frequently identified amongst infants in all regions with available data is type III (48.9%), followed by serotypes Ia (22.9%), V (9.1%), Ib (7.0%) and II (6.2%). In particular,
serotypes Ia, II, III and V are responsible for earlyt-onset disease, while late-onset disease is caused predominantly by serotype III. Region-associated frequencies of specific GBS serotypes must be highlighted in two cases: serotype VIII in Japan (7) (which is rather uncommon in other countries) and serotype IV as an emerging pathogen in the USA (30). Serotypes causing maternal GBS disease appear to be similar to those reported for early-onset GBS disease (31). In contrast to these data, in adults serotype V predominates (31%), followed by serotypes Ia (24%), II (12%), and III (12%) (32). Recently, however, a Portuguese study reported that serotype Ia was responsible for the majority of invasive infections in all age groups (33).
1.5 Vaccines
Maternal antibodies correlate with protection against serious GBS infection in neonates, possibly because of transplacental transmission of maternal immunoglobulins G (IgG) against GBS CPS that
15
provide serotype-specific protection (34). Moreover, lower degree of GBS colonization of the mother’s vaginal and rectal tracts reduce the risk posed by direct inoculation of the neonate during delivery. Thus, vaccination may be an effective way to prevent and reduce the incidence of early-onset and late-early-onset GBS diseases, since IAP is not sufficient to eliminate the bacteria.
The first approach used to develop a GBS vaccine focused on the use of purified native CPS as antigen. The first human clinical trials demonstrated the safety of the antigen but also highlighted the need to improve the immunogenicity of CPS, as only 60% of the recipients of the type III CPS vaccine showed significant IgG responses (35). However, this vaccine induced T cell-independent activation, which has its limitations, as it does not induce B-cell memory, and the response rate can be variable and sometimes rather low, especially in GBS- naïve individuals.
At a later stage, research focused on glycoconjugate vaccines, as they induce B-cell memory against the polysaccharide and yield a more robust and highly functional IgG response through antibody class switching. The first glycoconjugate vaccine trial conducted in humans involved a GBS III CPS-tetanus toxoid (III-TT) glycoconjugate (36). The results showed that the production of type III CPS-specific antibodies was higher, the proportion of recipients who responded to vaccination was substantially greater, with a more robust response compared to a carbohydrate-only vaccine.
Moreover, trials in pregnant women showed that type III CPS antibodies were elevated also in cord blood and persisted through at least two months of life. Further trials tested in humans, with a positive outcome, a bivalent vaccine consisting of II-TT and III-TT glycoconjugates (37), and a tetravalent vaccine consisting of Ia-TT, Ib-TT, II-TT and III-TT has been tested in mice (38). However, in order to achieve a 95% population coverage in Europe and North America, five serotypes would need to be included (Ia, Ib, II, III and V) in a multivalent vaccine (20).
Another strategy to produce vaccines against GBS is to use the bacterial surface proteins. Until quite recently, only a few surface GBS proteins, including the alfa and beta components of the C protein, Rib, Sip and C5a peptidase, have been investigated as vaccine candidates. However, these antigens have been found to be variable between strains and a broad coverage has not been
demonstrated.
Reverse vaccinology, a new and promising method for vaccine design that uses the information obtainable from whole-genome analysis, has been applied to GBS. In reverse vaccinology the starting point is to identify potential protein targets that may be immunogenic by sequencing the
16
genome and highlighting the open reading frames that encode for surface proteins. Next, a high-throughput screen is run to determine whether immune responses to these antigens are protective. These screens involve overexpression and purification of antigens from bacteria such as
Escherichia coli, vaccination of an animal model with the antigens, and assessment of whether sera
from vaccinated animals kill bacteria in vitro. Reverse vaccinology bypasses some problems of conventional vaccinology, such as the requirement of plentiful and isolatable antigens from the bacteria which hinders the development of vaccines against pathogens that cannot be grown in culture (20).
Reverse vaccinology has been applied to the design of a GBS vaccine. Maione et al. (39)
immunized female mice with 312 GBS surface proteins purified in E. coli. Pups born from these mice were initially challenged with a dose of one strain of GBS sufficient to cause a death rate of 80-90% and four of the vaccine candidates showed an increase in the survival of infant mice. At a later stage, pups immunized with the four antigens were challenged with six GBS strains. None of the four candidates individually conferred protection against all six strains, but a combination of the four antigens provided 87% protection overall against 12 clinical GBS strains. Further work found that three of the tested antigens were pilus components (18) and appeared to be highly conserved, a promising property in terms of the development of a universal GBS vaccine.
2. Characterizing GBS in a population
When studying GBS in a population, the aim is the description of the characteristics and strains distribution of the bacterium. Usually the description includes the study of antibiotic resistance, as well as the analysis of the distribution of serotype and sequence type in the target population.
2.1 Antibiotic resistance
The use of antibiotics has revolutionized the human infective disease scene, drastically reducing the incidence of many common diseases caused by bacteria. As the result of the frequent use of
antibiotics, the important issue of antibiotic resistance emerged. It is important to test bacterial samples in vitro to measure the sensitivity or resistance to different antibiotics. This is instrumental for the prescription of the most effective therapy to treat the patient, avoiding usage of non-specific
17
antibiotics that can enhance the resistance phenomenon. It also permits the study of the antibiotic resistance evolution of the bacterial strains in different populations, and furthermore the
identification of the mechanisms of resistance acquisition.
To treat GBS, penicillin G is the most active antibiotic and no resistance has been reported to date; erythromycin and clindamycin are the second choice antibiotics.
GBS can develop two mechanisms of antibiotic resistance that are shared for macrolides,
lincosamides and streptogramin B (MLS). Cross-resistance to all MLS (MLSB Phenotype) is due to the expression of the erm (Erythromycin Resistance Methylase) gene which encodes for a
methyltransferase. This enzyme catalyzes the methylation of the 23S rRNA, blocking the binding of MLS to the 50S ribosomal subunit and thus preventing the inhibition of protein synthesis caused by the antibiotic. A second mechanism of resistance (M Phenotype) is due to the mef (macrolide efflux) gene, which encodes for a proton-dependent active drug-efflux pump system (40). erm expression can be induced by the usage of another antibiotic, conferring an inducible MLS
resistance phenotype. For example, treating with erythromycin an erythromycin-resistant strain can induce clindamycin resistance. This phenomenon can be revealed with the D-test: two
drug-impregnated disks (one with erythromycin, one with clindamycin) are placed 15–20 mm apart on the inoculated agar plate. If the area of inhibition around the clindamycin disk is "D" shaped, the test result is positive and clindamycin should not be used due to the possibility of resistance induction and therapy failure. If the area of inhibition around the clindamycin disk is circular, the test result is negative and clindamycin can be used.
GBS resistance to erythromycin and clindamycin is rather common. In the United States, according to reports published during 2006-2009, the prevalence of resistance among invasive GBS isolates ranged from 25 to 32% for erythromycin and from 13 to 20% for clindamycin. However, a recent study reported 50.7% resistance to erythromycin and 38.4% resistance to clindamycin in the USA. Moreover, dual resistance to both antibiotics was 94.3% of clindamycin-resistant isolates being also resistant to erythromycin and 71.5% of erythromycin-resistant isolates also resistant to clindamycin (41).
Due to the risk of serious pathologies in the infants, chemoprophylaxis is essential in GBS-positive mothers, as the efficacy of intrapartum prophylaxis of colonized women in preventing neonatal GBS is 89% (42). Maternal chemoprophylaxis is indicated when positive for GBS cultures at 35 to
18
37 weeks of gestation. First choice antibiotic is intravenous penicillin G, because of its narrow spectrum profile, although ampicillin can be used as an alternative. When penicillin allergy occurs, cefazolin can be chosen because its transplacental transfer is similar to that of ampicillin, but both penicillin G and cefazolin must be avoided in women at high risk of anaphylaxis. In these cases, clindamycin or erythromycin can be administered, although erythromycin is a least suitable alternative due to the higher resistance rates. If GBS antibiotic susceptibility testing reveals resistance to clindamycin and erythromycin, vancomycin can be used (42). In the newborn, chemoprophylaxis is recommended when a GBS-positive mother has been given less than four hours of antibiotic prophylaxis or signs of neonatal sepsis are present (43).
2.2 GBS capsular serotype identification
GBS serotyping is important to characterize properly a sample, and is an essential part of epidemiologic studies where GBS serotypes frequencies and distributions are evaluated. As
discussed above, CPS is the major known protective antigen, and multi-serotype capsular conjugate vaccines are in clinical trials. Therefore, correct serotyping of clinical isolates is necessary to predict vaccine coverage. GBS serotyping can be achieved with several techniques that differ in accuracy and timing, the most used being latex agglutination and multiplex PCR.
- Latex agglutination: This method allows GBS serotyping using latex particles coated with GBS type antibodies raised in rabbit against the CPS present in each solution. Bacteria grown on blood-agar plate are mixed with each serotype-specific solution: a positive reaction is indicated by an agglutination appearing within 15-20 seconds. Although latex agglutination represents a reliable method for serotype identification and is widely used, it tends to be problematic with serotypes V and IX, and the accuracy of the results is highly dependent on the experience of the operator. Yao et al. demonstrated that while a negative result with the latex assay may be due to lack of gene expression, approximately one-half of the strains identified as nontypeable with this test express type-specific polysaccharides (44).
- Multiplex PCR: Molecular techniques solve several problems associated with latex
agglutination, being reproducible, specific and easy to perform. This method is based on the search in the DNA samples of sequences of GBS capsular genes cps, that are specific for
19
each capsular serotype, using selected primers, which makes it possible to distinguish all known GBS serotypes by a single PCR reaction. As the genes of the cps operonof all GBS CPSs have been sequenced, common and distinctive CPS-specific primers have been designed, which resulted in the identification of primers that enables the amplification of fragments of different sizes specific for sequences corresponding to CPS types Ia, Ib, II, III, IV, V, VI, VII, VIII that can be easily discriminated by agarose gel electrophoresis.
The First step in GBS serotyping with Multiplex PCR is purifying DNA from the sample. In the next step, a PCR is carried out using two different primer mixes. Mix I contains primer pairs specific for CPS types Ia, Ib, II, III, IV; mix II contains primer pairs specific for CPS t ypes V, VI, VII, VIII (45). The use of two mixes avoids cross-reactions between different primers, and allows a clear and unambiguous interpretation of the results. It provides moreover an internal negative control, as only one mix should produce a PCR fragment. A positive control, the GBS-specific dltS gene, is also included. PCR products are analyzed by horizontal electrophoresis on agarose gels and the capsular serotype is established using a DNA molecular marker. Multiplex PCR serotyping is more reliable than latex agglutination, allowing the typing of some strains that are nontypeable with the latter. However, as GBS serotyping with Multiplex PCR was developed before the discovery of serotype IX, it does not distinguish serotypes VII and IX. Serotype IX strains were in fact found to yield a PCR product of the same size as those of serotype VII (44).
2.3 GBS sequence type identification by Multilocus Sequence Typing (MLST)
Multilocus Sequence Typing (MLST) is an unambiguous sequence-based typing method, which uses internal fragments (approximately 500 bp) of house-keeping genes of a bacterial isolate. The great advantage of MLST is that sequence data are unambiguous and the isolates allelic profiles can be easily compared between laboratories or to those in a central database over the Internet. Allelic profiles can be obtained by PCR amplification of the seven house-keeping loci from bacterial cultures or directly from samples such as cerebral-spinal fluid or blood, allowing characterization even when isolates cannot be cultured.
Seven GBS loci, encoding enzymes involved in intermediary metabolism, were identified for MLST based on chromosomal location and sequence diversity observed in pilot studies. These included alcohol dehydrogenase gbs0054 (adhP), phenylalanyl tRNA synthetase (pheS), amino acid
20
transporter gbs0538 (atr), glutamine synthetase (glnA), serine dehydratase gbs 2105 (sdhA), glucose kinase gbs0518 (glcK) and transketolase gbs2105 (tkt). The minimum distance between the
chromosomal location of two loci was 20 kb, suggesting that it was unlikely for any of them to be co-inherited in the same recombination event (46).
For each locus, every different sequence was assigned a distinct allele number. Any change in the nucleotide sequence, whether or not the amino acid sequence was altered, was defined as a new allele. Each isolate was therefore designated by seven-integers constituting its allelic profile. Isolates with the same allelic profile were assigned to the same sequence type (46).
To carry out MLST, bacterial DNA is extracted from the isolate and the seven house-keeping genes fragments are amplified by PCR. Electrophoresis on agarose gel can be used to prove the efficacy of the amplification reaction. Eventually amplification products are purified and sequenced using specific nested primers. Sequences are then analyzed to identify the allelic profile.
2.3.1 Frequent Sequence Types and hypervirulent ST-17
Some STs can be found more frequently, and it is of interest to study a possible association between capsular serotypes and STs, or between STs and a specific virulence factor, clinical manifestation or asymptomatic colonized state. Literature data show that the most common STs are ST-1 and ST-19, containing several different capsular serotypes and mainly associated with the carrier state, and ST-17, which is more homogenous and consists mainly of strains of serotype III (46).
ST-17 is frequently associated with neonatal invasive disease. A study demonstrated that ST-17 GBS account for >80% of neonatal meningitis, especially in late-onset disease, strongly suggesting an enhanced virulence of this sequence type in the neonatal context. ST-17 GBS express a strictly specific protein, Gbs2018C, subsequently renamed HvgA for hypervirulent GBS adhesin. HvgA is a ST-17 surface-expressed protein that represents a major determinant of hypervirulence in
neonates. Two main characteristics associated with ST-17 GBS isolates have been studied by Tazi et al (47), i.e. their close association with LOD, linked to HgvA-mediated intestinal colonization and subsequent crossing of the intestinal barrier, and their close association with meningitis due to the HvgA-mediated crossing of the brain-blood barrier. The authors provide evidence that a bacterial factor implicated in intestinal colonization represents a virulence factor in the neonates,
21
when the intestinal microflora is not yet established and cannot exert its buffering effect on potential pathogenic bacteria
2.3.2 Study of GBS clustering
MLST data can be used to analyze the genetic relationships between isolates. This can be done with various softwares, such as UPGMA, a simple and hierarchical clustering method, or eBUSRT. eBURST was developed as a way of displaying the relationships between closely-related isolates of a bacterial species or population. It uses a model of bacterial evolution in which an ancestral
genotype increases in frequency in the population and, while doing so, begins to diversify to produce a cluster of closely-related genotypes that are all descended from the founding genotype. Isolates that share 6/7 alleles are defined as a group, and they are considered to belong to a single clonal complex (CC).
As mentioned before, this method allows the study of genetic relationships between isolates. For example, Bellais et al. (30) studied the case of three CC17 clones that were serotype IV, in contrast to the expected serotype III. Their results strongly suggested a capsular switching from a CPS type III to a CPS type IV in a CC17 genetic background, due to the exchange of an approximately 35.5 kb segment containing the whole cps operon. It is noteworthy that, while serotype IV was
considered rare among invasive strains, it was recently reported to be an emerging pathogen in the United States. Since serotype III is one of the main targets for GBS vaccination due to its
prevalence and association with virulence, a capsular switch from vaccine to nonvaccine serotype may compromise the success of vaccination programs and is therefore a major concern.
22
AIM OF THE THESIS
The objective of this thesis was to study group B Streptococcus colonizing post-menopausal women. The genetic characteristic of strains colonizing pregnant women have been thoroughly studied and compared with those causing neonatal disease. However, in the elderly, while there are many studies on GBS strains causing invasive disease, few data are available on the characteristic of strains colonizing healthy individuals. Our data will contribute understanding the spreading colonization and disease in adults.
In our study, group B Streptococcus colonization among post-menopausal women was defined analyzing:
- The percentage of GBS colonization in post-menopausal women;
- The rates of GBS antibiotic resistance to penicillin, the first choice antibiotic for prophylaxis, and erythromycin and clindamycin, used in those patients that present
penicillin allergy. Disc diffusion testing were used, and E-test was performed when results were intermediate;
- The distribution of GBS serotype through Strep-B-latex agglutination test, which reveals the presence of a specific capsular polysaccharide, and Multiplex PCR, which allows serotyping based on cps operon expression;
- The distribution of GBS sequence types (ST) and association between serotype and ST in our population. Multilocus Sequence Typing (MLST) was used for sequencing seven house-keeping genes, allowing the identification of the STs.
23
MATERIALS AND METHODS
1. Sample collection
The study was conducted on 25 vaginal samples isolated from asymptomatic post-menopausal women that resulted positive for Group B Streptococcus (GBS). The samples were collected in Hospital Virgen de las Nieves, Granada, Spain.
To identify GBS, isolates were grown in Granada medium, under anaerobic conditions obtained with AnaeroGen Oxoid, at 37° C.
Granada medium composition:
Protreose peptone no. 3 (Difco) 25 g
Soluble starch (1253, Merk) 10 g
MOPS hemisodium salt (M9027, Sigma) 11 g
Na2HPO4 8.5 g
Glucose 2.5 g
Sodium Pyruvate 1 g
MgSO4 0.2 g
Methotrexate sodium salt (Lederle) 6 mg
Colistin sulfate 5 mg
Crystal violet (15940, Merk) 0.2 mg
Metronidazole (Sigma) 10 mg
Horse serum 50 ml
Agar 10 g
Distilled water 1000 ml
GBS identification followed the criteria of presence of pigmented colonies, which appeared orange. The GBS isolates were then grown on Columbian agar plates containing 5% horse blood.
2. Antibiotic susceptibility testing
2.1. Penicillin-Erythromycin-Clindamycin antibiogram
GBS isolates were suspended in 1 ml saline solution to obtain a concentration of 0.5 McFarland. Blood agar plates were then inoculated with the solution. Discs of cellulose with penicillin (10 IU),
24
erythromycin (15 µg) and clindamycin (2 µg) were placed on the plates; erythromycin and
clindamycin discs were placed at a the specific distance of 12 mm to identify the possible D-effect, which would demonstrate the erythromycin-induced clindamycin resistance of the strain. Samples were incubated for 16-18 hours at 37° C, before reading the results by measuring the diameter of the inhibition halo. The results were then interpreted using the following parameters:
Sensitive Intermediate Resistant
Penicillin ≥ 24 mm - -
Erythromycin ≥ 21 mm 16-20 mm <15 mm
Clindamycin ≥ 21 mm 16-20 mm <15 mm
2.2 Epsilon test (E-test)
For the strains that were found to have an intermediate resistance to one of the antibiotics we carried out the e-test, which allows to determine the minimal inhibitory concentration (the lowest concentration of an antimicrobial compound that will inhibit the visible growth of a
microorganism).
GBS isolates were suspended in 1 ml saline solution to obtain a concentration of 0.5 McFarland. Blood agar plates were then inoculated with the solution. Strips impregnated with a continuous concentration gradient (0.016 - 256 µg/ml) of the antibiotic were laid on the plate. After 24 hours of incubation at 37° C, an elliptical halo of inhibition was produced and the point where this met the strip gave a reading of the minimal inhibitory concentration, which was read using the exponential scale printed on the strip. The results were interpreted using the following parameters:
Sensitive Intermediate Resistant
Penicillin ≤ 0.12 µg/ml - -
Erythromycin < 0.25 µg/ml 0.5 µg/ml ≥ 1 µg/ml
25
3. Capsular serotyping of GBS strains
3.1 Agglutination with Strep-B-Latex (Staten Serum Institut)
Starting from GBS isolates grown on blood agar plates, a bacterial suspension from individual colonies was prepared in 250 µl saline solution. 20 µl were placed on a microscope slide and 1 µl of Strep-B-latex reactive was added (to every drop of bacterial suspension the latex reactive with one specific capsular serotype was added). After shaking for 15-20 seconds the reaction was considered positive if the agglutination appeared and the strain was considered of that capsular serotype.
3.2 Multiplex PCR
With Multiplex PCR, specific parts of the DNA isolates were amplified. Primers that were specific for each serotype were used. By revealing the amplification with an electrophoresis, sample
serotype could be detected based on the genes that were amplified. The procedure includes DNA extraction, amplification by Polymerase Chain Reaction and electrophoresis.
3.2.1 DNA extraction
Starting from GBS isolates grown on blood agar plates, 100 µl of suspension in H2O were prepared. 20 µl of this suspension were transferred to a microfuge test tube and 80 µl NaOH 0.05 M were added to lyse the cells. The resulting suspension was mixed and incubated for 45 minutes at 60° C, followed by the addition of 9.2 µl Tris-HCl 1 M pH 7 to neutralize the NaOH. The solution was mixed and centrifuged for 1 minute (TDxTM centrifuge, Abbot). The supernatant containing DNA was stored at -20° C.
3.2.2 Multiplex PCR
There are ten GBS serotypes, of which serotype IX was only recently identified. In this study serotype from I to VIII were analyzed. To reduce the possibility of cross-reaction between the reagents and to facilitate the reading of the results, two mixtures were prepared, one containing the primers for five serotypes, the other for four and for dltS, the control gene.
Mixture 1: primers for serotypes Ia, Ib, II, III, IV Mixture 2: primers for serotypes V, VI, VII, VIII, dltS
26
REAGENT QUANTITY
Buffer (ABI gene Amp 10x Buffer 2) 2.5 µl
MgCl2 (ABI 25 mM) 2.5 µl
dNTPs (0.2 mM) 2.0 µl
Primers F y R (10 mM) 0.5 µl (of each primer)
Taq (Applied Biosystems) (5 U/ µl) 0.5 µl
Water 7.5 µl
5 µl of the DNA solution obtained as described above were added to the 20 µl of the mix, to reach a total volume of 25 µl.
The DNA was amplified by PCR in a thermal cycler (GeneAmpTM PCR System 9700, Applied Biosystems) using the following settings:
MIXTURE No. 1 - 2
Phase T (°C) Time No. of cycles
Initial activation 94 2 min 1
Denaturation 94 1 min 30
Hybridization 57 45 sec 30
Extension 72 2 min 30
72 2.5 min 1
Maintenance 4 ∞
3.2.3 Separation and detection of amplified DNA
For the detection of the amplifications products, the PCR products were separated by
electrophoresis on a 1.5 % horizontal agarose in Tris-Borate-EDTA (TBE) 0.5x (prepared from TBE 5x stock solution), 10 µg/ml Ethidium bromide gel. TBE 0.5x was used as electrophoresis buffer.
TBE 5x stock 1 L: 54 g Trizma base minimum (Sigma), 27.5 g Boric acid (Merck), 20 ml EDTA (Ethylenedinitrilo tetraacetic acid, disodium salt dehydrate, Merck) 0.5M, H2O.
The samples to be loaded in the wells were prepared on a piece of Parafilm as follows: 8 µl of the amplified products were added to 3 µl loading buffer (Bromophenol blue 0.25%, Xylen Cyanol
27
0.25%, Glycerol 30% in H2O) and loaded in each well. A DNA molecular marker (MWM 150 – 2100 pb, Roche) was loaded in one well as a mix of 3 µl MWM and 3 µl loading buffer.
Electrophoresis was run at 80 mV for approximately 1 hour.
Results were read by visualizing the gel on a UV transilluminator. Bands of each serotype’s characteristic molecular weight were obtained, that could be interpreted as shown in the following figure: Serotype Dimension of amplicon (bp) Ia 521 and 1826 Ib 770 II 397 III 1826 IV 578 V 701 VI 487 VII 371 VIII 282 dltS 952
3.3 Multilocus Sequence Typing System (MLST)
DNA samples were sequenced by MLST, using DNA extracted as described above for the Multiplex PCR.
3.3.1 DNA amplification
The primers used to amplificate DNA are designed for the GBS sequence MEM16 and are the following:
28
LOCUS FORWARD (5’ to 3’) REVERSE (5’ to 3’) AMPLICON
SIZE (bp)
adhP amplification GTTGGTCATGGTGAAGCACT ACTGTACCTCCAGCACGAAC 672
pheS amplification GATTAAGGAGTAGTGGCACG TTGAGATCGCCCATTGAAAT 723
atr amplification CGATTCTCTCAGCTTTGTTA AAGAAATCTCTTGTGCGGAT 627
glnA amplification CCGGCTACAGATGAACAATT CTGATAATTGCCATTCCACG 589
sdhA amplification AGAGCAAGCTAATAGCCAAC ATATCAGCAGCAACAAGTGC 646
glcK amplification CTCGGAGGAACGACCATTAA CTTGTAACAGTATCACCGTT 607
tkt amplification CCAGGCTTTGATTTAGTTGA AATAGCTTGTTGGCTTGAAA 859
For each of the 7 genes of each isolate a mixture of the components listed in the table below was prepared in PCR tubes, and 2 µl of the sample were added.
COMPONENT VOLUME (µL) x1
Buffer 10X (Applied Biosystems) 2.5
MgCl2 25 mM (Applied Biosystems) 2.0
dNTPs (mixture 10 mM, Applied Biosystems) 4.0
Primers (100 pM/µl) 1 x primer
Taq (5U/µl, Applied Biosystems) 0.1
PCR water 12.4
TOTAL (mixture) 23
The PCR was carried out in a thermal cycler using the following settings:
Temperature (°C) Time No. of cycles
Activation 94 5 min 1 Denaturation 94 1 min 30 Annealing 55 45 sec Extension 72 60 sec 72 7 min 1
29
The effectiveness of the PCR was assessed by agarose gel electrophoresis as described above. The electrophoresis was run for 45 minutes at 100 mV.
3.3.2 Purification of the amplification products
5 µl of the amplified DNA and 2 µl of EXO-SAPTM (USB), were mixed in PCR tubes. Exo-SAPTM is a solution containing an exonuclease that removes any unconsumed dNTPs and primers
remaining in the PCR products when the amplification is complete and that could interfere with DNA sequencing. The resulting solution was briefly centrifuged (Rotina 420, Hettich Zentrifugen) and the tubes were placed in a thermal cycler with the following settings:
Stage Temperature Time
Purification 37° C 15 min
Deactivation 80° C 15 min
Preservation 4° C ∞
3.3.3 DNA sequencing
The purified DNA sequence was determined using the nested primers and the reaction mixture ABI prism BigDye terminators version 3.0 (Applied Biosystems) was prepared using BigDye
terminators and BigDye buffer.
Sequencing primers used:
LOCUS FORWARD (5’ to 3’) REVERSE (5’ to 3’) AMPLICON
SIZE (bp)
adhP sequencing GGTGTGTGCCATACTGATTT ACAGCAGTCACAACCACTCC 498
pheS sequencing ATATCAACTCAAGAAAAGCT TGATGGAATTGATGGCTATG 501
atr sequencing ATGGTTGAGCCAATTATTTC CCTTGCTCAACAATAATGCC 501
glnA sequencing AATAAAGCAATGTTTGATGG GCATTGTTCCCTTCATTATC 498
sdhA sequencing AACATAGCAGAGCTCATGAT GGGACTTCAACTAAACCTGC 519
glcK sequencing GGTATCTTGACGCTTGAGGG ATCGCTGCTTTAATGGCAGA 459
30
The following mixture was prepared in PCR tubes:
Component Volume (µl) x1
Primer (3.2 pM/µl) 2.5
ABI prism BigDye terminators (AB) 2.0
ABI prism BigDye Buffer 5x 2.0
PCR water 1.5
DNA (25/30 ng) 2.0
Total volume 10
The sequencing reaction was carried out in a thermal cycler with the following settings:
Temperature Time No. of cycles
96° C 1 min 1 96°C 10 sec 25 50°C 5 sec 60° C 4 min 4° C ∞
3.3.4 Precipitation of sequencing products
Sequenced DNA must be precipitated to be analyzed by chromatography. This permits to obtain a chromatogram with which the sequences can be read and analyzed.
The PCR tubes containing 10 µl of the sequenced DNA solution were added with 2.5 µl of Sodium Acetate-EDTA and 50 µl absolute ethanol to precipitate DNA. The solution was centrifuged for 30 minutes at 2500 x g (Rotina 420, Hettich Zentrifugen). The tubes were then turned upside down to remove the supernatant, and centrifuged, still turned upside down, for 10 second at 100 x g (Rotina 420, Hettich Zentrifugen).
50 µl 80% ethanol were then added to wash away the remaining solution that is no longer containing DNA, and the tubes were centrifuged for 5 minutes at 2000 x g (Rotina 420, Hettich Zentrifugen). The tubes were again turned upside down and centrifuged for 10 seconds at 100 x g (Rotina 420, Hettich Zentrifugen).
31
10 µl Hi-Di Formamide were added to the DNA pellets and the samples were subjected to automatic sequencing.
The sequence analysis were carried out with ABI Prism 3130xl- Avant Analyzer (Applied Biosystems).
3.3.5 Sequence analysis
The sequences and the chromatograms were read and analyzed using the software ChromasPro, and compared to the Group B Streptococcus MLST sequence type contained in the database that can be consulted on the web: http://pubmlst.org/sagalactiae/.
32
RESULTS AND DISCUSSION
Samples were collected within a study of whose aim was to discover the prevalence of GBS colonization and serotype distribution among post-menopausal population. The study was carried out on vaginal swabs of post-menopausal women, collected during visits that were not related to gynecological issues at the emergency department of Virgen de las Nieves Hospital (Granada, Spain). Of 600 women tested, 107 resulted GBS positive (17.8%).
Our study was carried out on a sample of 50 of the 107 GBS positive women randomly chosen, and their samples were further analyzed for antibiotic resistance, serotype and sequence type
distribution. The mean age of the sample was 64 years (range 50-88).
To identify GBS positive swabs, samples were grown on Granada medium, and the presence of GBS was detected with the growth of pigmented colonies. The characteristic orange color shown by GBS colonies is due to the pigment ornithine glycopolyene produced by the bacteria, which is enhanced by methotrexate contained in the Granada medium.
Figure 1. GBS grown on Granada medium. Plate 1: two GBS-positive samples; Plate 2: one GBS-positive and one GBS-negative samples.
1.Antibiotic resistance
To test bacterial resistance to antibiotics, for each sample a disc diffusion test was carried out. GBS isolates were suspended in saline solution to obtain a concentration of 0.5 McFarland units and blood agar plates were inoculated with the solution. Discs of cellulose with penicillin (10 IU),
33
erythromycin (15 µg) and clindamycin (2 µg) were placed on the plates. Erythromycin and
clindamycin discs were placed at a the specific distance of 12 mm to identify the possible D-effect. Samples were incubated for 16-18 hours at 37° C, before reading the results by measuring the diameter of the inhibition halo.
Figure 2: Disc diffusion test on blood agar plates with penicillin (down), erythromycin (up, right), clindamycin (up, left). The inhibition halo is marked with a broken line.
When disc diffusion test results were intermediate (halo diameter 16-20 mm for erythromycin and clindamicin), E-test was carried out to determinate the minimal inhibitory concentration and therefore verify the resistance to the antibiotic in question. A strip impregnated with a continuous concentration gradient of the antibiotic was laid on a blood agar plate inoculated with a 0.5 McFarland units of bacterial solution. After 24 hours of incubation at 37° C, an elliptical halo of inhibition was produced and the point where this met the strip gave a reading of the minimal inhibitory concentration, which was read using the exponential scale printed on the strip.
Figure 3: E-test for erythromycin. Minimal inhibitory concentration can be read where the lower edge of the inhibition halo meets the strip. The exponential scale printed on the strip reports the antibiotic concentrations in µg/ml
34
Penicillin: All samples were susceptible to penicillin as measured by the disk diffusion method. However, in the disc diffusion test of sample 453 the halo diameter was 22 mm, when < 24 mm indicates some level of penicillin resistance. The E-test was therefore carried out to verify the resistance. Sample 453 resulted to have a MIC of 0.064 µg/ml, which indicates penicillin
sensibility, as the reference value for susceptibility is ≤ 0.12 µg/ml. Nevertheless, it is important to report this data since most of Group A and B Streptococci are susceptible to penicillin, which make it an important and powerful antibiotic to treat hazardous diseases caused by these bacteria. As isolated cases of reduced penicillin susceptibility GBS strains are reported (48), the scenario of penicillin resistance spreading becomes more and more frightful. It is therefore important to keep testing resistance to penicillin in GBS strains from different populations.
Erythromycin and Clindamycin: erythromycin resistance was 26 %, and clindamycin resistance was 22%. Our data are consistent with the literature, which reports erythromycin resistance rates of 25-32% and clindamycin resistance rates of 13-20% (30).
Most of the isolates were resistant to both antibiotics and were likely to be erm constitutive strains. However, two isolates resulted erythromycin resistant and clindamycin susceptible. In these two cases we carried out the D-test for induced clindamycin resistance. One strain showed the D-effect on the erythromycin-clindamycin disc diffusion test, which likely indicates an erm inducible phenotype, where exposure to erythromycin induces erm gene expression, conferring clindamycin resistance to the strain. The other isolate was D-negative, and thus probably expresses the mef resistance gene, which codes for a macrolide specific effusion pump and is ineffective on clindamycin.
A positive D-test is shown in Figure 4, where the deformation of the usually round-shaped halo is marked with a broken line and arrows. Erythromycin administration induce clindamycin resistance to the strain, allowing the bacteria to grow on the edge of the two halos and therefore modifying the shape of the clindamycin halo, which tend to become D-shaped.
35
Figure 4: positive D-test. Deformed clindamycin halo, on the left, is marked with a broken line and arrows.
A study in the USA reported 71.5% of erythromycin-resistant isolates also resistant to clindamycin (30), which presumably show the erm constitutive phenotype. The other 28.5% are erythromycin-resistant and clindamycin susceptible, and more likely express mef gene for antibiotic resistance. Our data, even though referred to small numbers, are therefore consistent with those reported in literature. Antibiotic resistance among GBS strains anyhow depends on different resistance mechanisms expressed by isolates as well as antibiotic type and usage frequency in the different regions.
2. Capsular serotypes
Capsular serotype was at first determined both with latex agglutination test and multiplex PCR for a sample of 25 strains. To carry out the latex agglutination test, a bacterial suspension in saline
solution was prepared and a drop was placed on a microscope slide, then mixed with 1 µl of Strep-B-latex reactive for a specific capsular serotype. After shaking for 15-20 seconds the reaction was considered positive if agglutination appeared. Multiplex PCR was carried out to perform capsular serotyping. Fragments of the DNA isolates were amplified using primers that were specific for each capsular serotype. Amplification was then revealed with electrophoresis on a 1.5% horizontal agarose in TBE 0.5x gel, and sample serotype could be detected based on the cps gene expressed by the strain.
In figure 5, and example of serotype detection through PCR is shown. On the right we can see the DNA molecular weight marker, which allow us to identify the size of our sample DNA fragments.
36
Sample 454 cps gene fragment shows a band between 1766 and 2176 bp. This is recognizable as a 1826 bp fragment specific for serotype III amplified by the type III specific primers included in mix 1 (M1) during the PCR preparation. Sample 454 is therefore identified as a serotype III strain. A serotype Ia strain (two bands, 521 and 1826 bp) was used as a positive control to verify the occurred amplification.
Figure 5: Electrophoresis on a 1.5% horizontal agarose in TBE 0.5x gel of the amplification products of the cps gene, used to identify the serotype of strain 454 using PCR mix M1. Pos ctr: positive control. M: DNA molecular weight marker. Band sizes (bp) of the molecular weight marker are reported on the right.
With Multiplex PCR we could identify the serotype of all the strains. Three samples resulted non-typable with latex agglutination test (12%), while the other 22 gave a positive result which was congruent with those of the PCR in 100% of the cases. As PCR resulted more sensitive, we
therefore decided to proceed with capsular serotyping using just the latter technique. This decision was also supported by the high degree of agreement between results obtained with the two
techniques reported by Yao et al. (32).
Capsular serotype data show that in our population of post-menopausal women the most frequent serotypes are III (34 %), Ia (22 %), V (20 %) and II (14 %), while other serotypes are present in less significant percentages.
37
Figure 6: GBS serotype distribution in post-menopausal women. Serotype was determined for GBS isolates collected from vaginal swabs from post-menopausal women at the emergency department, Hospital Virgen de las Nieves, Granada (Spain). Percentages refer to serotype frequency in 50 total isolates screened. NT, non-typable.
GBS serotype rates in invasive disease in infants and adults, reviewed by Le Doare K. and Heath P., were compared to our data, as shown in table 1. The serotypes causing maternal GBS disease appear to be similar to those found in infants (6) and are not reported below.
Infants (%) Adults (%) Post-menopausal (%)
Ia 23 24 22 Ib 7 ND 4 II 6 12 14 III 49 12 34 V 9 31 20 Ref 24 32
Table 1: GBS most frequent serotype frequencies in infants, non-pregnant adults and post-menopausal women. Infants and non-pregnant adults data from literature. ND: not determined.
The most frequent serotypes in invasive neonatal and maternal GBS disease and in colonized post-menopausal women are the same, serotype III being the most frequent, followed by Ia and V. Serotype III appears the most common in colonized post-menopausal women, similarly to neonatal EOD and LOD, where it cause invasive disease and meningitis (25). In non-pregnant adults,
serotype V is the most recurring: in the last three decades serotype V has been emerging as a major cause of GBS colonization and disease among adults (10,11), becoming a significant concern. However, our data do not show this shifting toward serotype V.
