Distamycins inhibit the binding of OTF-1 andNFE-1 transfactors to theirconservedDNA elements
Massimo Broggini, Mauro Ponti, Sergio Ottolenghil, Maurizio D'Incalci*, Nicola Mongelli2 and Roberto Mantovanil
Laboratory of Cancer Chemotherapy, Istituto di Ricerche Farmacologiche 'Mario Negri' Via Eritrea 62, 20157Milan, 1Dipartimentodi Genetica e di Biologia dei Microorganismi, Universiti di Milano, Milan and2Laboratorio di Recerca e Sviluppo, Farmitalia Carlo Erba, Milan, Italy
Received October 25, 1988; Revised and Accepted January 5, 1989
ABSTRACI'
We investigated the effects of the antiviral agent distamycin A and of a distamycin derivative (FCE 24517) which possesses antineoplastic activity on the binding of some regulatory proteins to DNA. Both compounds inhibited the binding to DNA of the ubiquitous octamerbinding factor OTF1 and of the
erythroid
specific GATAAG protein (NFE 1). This wasshownusing theelectrophoreticmobility shift assay on a DNA fragment of humany-globin
genepromoter(-156 to -201), on the samefragmentwith a point mutation (T to C mutation) known tohave an increased affinity of binding for NFE 1, on a DNA fragment of human histone H2B promoter and on a DNA fragment of mouse al globin promoter. The ability of distamycinorof FCE24517toinhibit the binding wasspecificfor AT-rich sequences since neither drug inhibited thebinding of nuclear protein factors to the sequence CCACACCC of the human Bglobin gene. Binding to DNA was investigated by evaluating the drugs' ability to protectselected sequences from DNase I digestion (DNase footprinting). Distamycins binding washighly preferential for DNA sequences containing stretches of AT. These studies indicate that chemicals which have ahigh degree of DNA sequence-specific binding can selectively inhibit the binding of regulatory proteins to DNA. These effects might be responsible for modificationof thetranscripion of specific genes and might to some extent account for these drugs' antiviralandantineoplastic activities. This approach offers potential for the investigation ofnewsuch drugs.INTRODUCTUIN
Distamycin A isan antibioticoriginally isolated fromStreptomyces
distallicus (1)
and subsequentlyobtainedbytotalsynthesis (2).
It has strongantiviralactivity (3).Recently
somedistamycinderivatives provedtobe potent
antiproliferative
agentswithactivity against
some murinetumors (4,5) ,buttheirmechanismof action is still unknown.They
formastrong reversiblecomplex with double helical B-DNAwithhigh selectivity
for AT rich sequences.DistamycinAbindsdeeplyinto the minor groove of B-DNA ; NH groups of each of the three
pyrrolecarboxamide rings
formhydrogen
bonds with N-3 of adenineor0-2 ofthymine
and the CHs of thearomaticpyrrolesareboundtothe C-2hydrogensof adeninesbyVan der Waalsinteraction(6)
.Distamycin
Abinding
toDNA widens the minor grooveby
several Angstromsbybendingthe DNAhelix andby inducing
conformationalchanges
inneighboring
DNA(6). Thesechangescanalterthechromatinstructure
(7,8)
andconsequently affect normal DNA-proteininteractions.Itis widelyacceptedthattranscriptionalinitiation is mediated
by
formation of stableNucleic Acids Research
complexes betweenDNAbinding proteins (trans factors) and sequences (cis elements) in promoterand enhancer regions. These elements contain short regulatory boxes that mediate DNA-protein interaction, leading totranscriptional activation (9). Byexploiting the gelshift assayand DNase Ifootprinting techniques, several sequence specific DNA binding proteins have been identified (10). The octanucleotide ATlTGCAT sequence has been shown to be important in trancriptional activation of several genes including human histone H2B, immunoglobin, U2 and Ul small nuclear RNA, and binds a ubiquitous (OTF 1) and a lymphoid specific (OTF2) protein (11-13); mutations of everysingle nucleotide (with thepossible exception of the first A)greatlyimpair binding of both proteins. Another conserved sequence (GATAAG)inpromotersand enhancers of several globin genes binds a protein (NFE 1) present only inerythroidcells ( 13,14).
SincedistamycinA and its derivatives bind to DNA containing AT sequences, these drugs might alter the binding of protein factors to boxes in which AT sequences are essential for recognition and stable binding, thus possibly interfering with the activation of several genes.
This study was undertaken toverifythis hypothesis.
Distamycin A and its derivative N-deformyl-N- (4-(N,N-bis-(2-chloroethyl) amino)benzoyl)-
distamycin
A(FCE 24517)
weresynthetized by
Farmitalia-CarloErba, Milan,
Italy anddissolved inwater or0.1%DMSO respectivelyforDNA orcell treatment.DNAfrget
Sequencesof DNAfragmentsused in theseexperimentswere asfollow(onlytopstrand is shown):human
y-globin:
from -156to-201(CCCTGGCAAAGTCTGTCTATAAACGTAACT
CTATCACACCCCTTCC) (13,14) -175 mutanty-globin:
same asabove exceptTtoC mutationat -175;H2B promoter: from -68 to -23 (CTGAAGTTGAGAAGTGGAATAAACGTATTCG
CTAAGATATATIC)
mouse alglobin promoter:(CGGGCAACTGATAAGGATCCC) (14).
Allfragments were
32p
labeledat5'endswithT4polynucleotidekinase and [ y32P]
ATP accordingtostandardprocedures.Nuclear extracts.
Nuclear extractsfrom human erythroleukemia cells (K562) were prepared according to Dignametal.(15).
DNAfragments labeledatthe 5'-end(0.1-0.5 ng) were preincubated for 30min at room emperaturewithdifferent concentrations of DistamycinA orFCE 24517 in the presence ofpoly (dI-dC) (2
jg)
and then incubated with nuclearextracts(5gg
ofproteins)forother30 min, electrophoresedin50mMTris borate pH 8.2 and autoradiographed (16).Nucleic Acids Research
a:E
NOUCLEARF EXTRACU 1 S 1.5
a a
:L.
cD C:>
30 4.5
2 3
_wt
a a az
1- Ln L,S 4r
1.5 3.0 4.5
4 5 6
U; U- U- U U- ... ...
...>.
2 o 2 2
2.5 1.5 3.G 4.5 1.5 30B .S5
7 B 9 10 1 1 I2 '3
45tm
NF F _ s
x..s.
:.,
Figure 1
Binding of nuclear factorstohuman y-globinfragment. Labeled DNA was preincubated with 50 (lanes 1,2,3)or250 jiM(lanes4,5,6) distamycinA (D) orwith 50 (lanes 8,9,10) or 250jM (lanes11,12,13) FCE 24517 (F)for30 min and then incubated for 30minwithK562nuclear extracts asindicated in thefigure. Lane 7 is untreated DNA.
Q I: a
2 3
a
..
a5 6o...a7L 4.3 ..9 10 .L11u NFEK'-
iB - a_ -.es2,: n3... .:..a4 5.C:IS 606-OIs7 8-a~ C,.flr-;:...aO1
n41~~~~~Wi~A
Figure2
A) Effect of distamycins on NFE 1 binding to -175 fragment; the -175 fragment was preincubated with 10 (lane 1) 25 (lane 2) 50 (lane 3) 100 (lane 4) and 200 jM (lane 5) DistamycinA(D)orwith 10 (lane 7) 25(lane8)50(lane 9)100(lane 10)and200
gM
(lane 11) FCE 24517 (F) for 30min before addition ofK562 nuclearextract(5jg).
Lane6 isuntreated fragment plus nuclearextract.B) Effect ofdistamycinsonNFE 1bindingto mouse alglobin fragment.
NFE -
::
,Nucleic Acids Research
Figure
3Effectof
distainycins
onOTF1binding
toanoligonucleotide
derivedfromthe sequence ofH2B promoter(from-68to-23); pretreatmentofDNAfragments
withdistamycins
andsubsequent
treatmnentwith K562 nuclearextract were asdescribed infigure
2.DNaseI
footrinting (17)
Thetop strand of each
oligonucleotide
was5'-end labeled withpolynucleotide
kinaseand[y2P]
ATP, beforeannealing
with the bottom strand. The double strandedfragment oligonucleotdde
wasthen incubated withthedrug
(see above)for 30minandtreatedwithDNase I (0.01 units) for 5minatroomtemperature. The reactionwasstopped by adding
tRNA(15gg),
ammoniumacetate(finalconcentration2.5M) and ethanol. Afterprecipitation
DNAwasresuspended
inloading
buffer andelectrophoresed
on 20%acrylamide-7M
ureagels
andautoradiographed.
Using
theelectrophoretic mobility
shift assay the32P
labeledBstNI-Apa
Ifragment
(from-201 to-156)of they-globin
genepromoter had been showntobind twoproteins
presentinnuclearextractsfromK562cells(12). Theseproteins
have been characterized in termsoftheir DNAbinding specificity
and correspondtotheubiquitous
octamerbinding
protein
(OT'F 1) (11,12,16)andtotheerythroid-specific
GATAAGprotein
(NFE1)(14,18and referenceswithin).Preincubation of the labeledfragment
withdistamycin
A and FCE 24517 clearly lowered theintensity
ofboththesebands(Fig.
1). This effectwasalready
observedat 50giM distamycin
A orFCE 24517and increasedathigher drug
concentrations(compare
~U. U. U. U.
a
a: ca
J uaW
:,- UL'LXLF x - x
I 2 3 4 5 6 7 8 9 10 11
B3 Z-iM
Figure4
Effectof distamycinsonnuclear factorsbindingtoahumanB-globinfragment;theBstNI-Hind III B-globin fragmentwasincubated with 200(lane 1)100(lane2)50(lane 3)25(lane 4)or 10 FM (lane 5) DistamycinA (D)orwith 200(lane 7)100(lane 8)50(lane 9)25(lane 10)and FM (lanel 1)FCE25417(F)for30minfollowedbyincubation withK562 nuclear extractfor 30min.Lane6 isDNAincubated with nuclearextractonly.
forexamplelane7 withlanes2,5,9and 12).Preincubation of the drug with DNA is essential for thiseffect; when the drug wasaddedtogether with DNA and proteinorpreincubatedwith protein alone, littleornoeffectwasobserved (datanotshown).
Inorder toinvestigate the effect of these drugs on the binding of thetwo proteins separately,weusedaDNAfragment containingapoint mutationintheoctamersequence( -175 TtoC);thismutation, abolishes the binding of OTF1and enhances thatofNFE 1 (12). As shown inFig.2 Athebinding ofNFE1wasseverely affected by both compoundsat50 .Mbut
asignificantreductionwasalready seenatlowerconcentrations, particularly in thecaseof FCE 24517. These resultswereconfirmedbyemployingadifferent oligonucleotide (14) derived from mouse a globin promoter and showing ahigh affinity binding site for NFE 1 (GATAAG),astheonly homologywiththepreviousone(Fig.2B).
Usinganoctaboxcontainingsyntheticoligonucleotide derived from human histoneH2B promoter (11) and shownto bindOTF 1, a single specific retarded band was generated.
Treatmentwith distamycin AorFCE24517 prevented protein binding inaconcentration dependentmannerfrom 25to200 tM(Fig. 3).
Nucleic Acids Research
4.:
.Mr
* w 4:
p:' 4 ..l*:..' :
..
A....
..:.. i1.
Figure5
DNase Ifootprintingof DNA fragments treated with distamycins:
(A) Human y -globin fragment (5'-end labeled on the top strand) was treated with 50 (lane 2) or250 ±M (lane 1)FCE24517 (F) or with 50 (lane 4) or 250
jM
(lane 5) distamycin A (D) for30minand thensubjected to cleavage by DNase I. Lane 3 is the untreated control; A+G is theMaxam-Gilbert sequencing reactions.The protected sequenceisindicated; the octamer is boxed.(B) Oligonucleotidederived from sequence of human H2Bpromoter treated with 10 (lane2) 25 (lane 3) 50 (lane 4) 100jM
(lane 5) FCE24517 (F) for 30 min before addition of DNase I. Lane 1is the untreated control. The sequence of the protected regions is indicated and theoctameris boxed.(C)-175mutant y-globinfragment.Treatments andlanes are the same asin panel B.
(D)The sequence (from -201 to -156) of human y-globingene isillustrated. The octamer (bindingsite of OTF 1) is indicated in bold type;onthe bottom strand the GA(T,C)AGA sequences(bindingsite of NFE 1)areunderlined; the region protected as in panel A is marked withazigzag above it.
Inordertoverify whether theabilityofdistamycin Aand FCE 24517 toinhibit protein bindingwas specificfor AT-containingDNAboxes, we
investigated
theeffect of thetwo drugs onthebindingof nuclearproteinsto apreviously characterizedhuman B-globinCACCC boxcontainingfragmentHind m -BstNI(seeref. 19). Incubation of thisfragmentwith nuclear extractsfromK562 cellsgeneratedseveral retarded bands(B1-B4)shown byDNase Ifootprint andmethylationinterferenceexperiments tointeract with the CCACACCC sequence(19);
they therefore do notrequireAT stretches forspecificrecognition. Fig.
4 shows thatneitherdistamycin A norFCE24517 had any detectable effect on binding to this DNA box even at very highconcentrations (200IM).
To establish the precise site of binding of distamycin A and FCE 24517 on the oligonucleotides we investigated these drugs' ability to protect selected sequences from DNase I digestion (DNase I footprinting) (17). When the normal globin fragment was employed, both compounds protected a sequence spanning the octa box from DNase I digestion (Fig.5A).Similar results were also obtained employing they-globinmutatedfragment and the H2Boligonucleotide (Fig. SC and SB). In both cases GC rich sequences were not protected (see-190/-200 region in y-globinfragment fig. SA and SC) and the corresponding bands were even enhanced. Significant protection was already evident at low drug concentrations (10-25
gM).
Inthe caseof the H2B oligonucleotide a second protection was observedin another stretch of AT present inthis fragment(-30/-20), corresponding to the histone H2B TATA box (11).DISCUSSION
Theantibiotic distamycin A has potent antiviral activity (3) and some of itsderivatives inhibit proliferation of certain murine tumors (4,5). The mechanisms of action of these compoundshave still to be elucidated.
Thespecific bindingof distamycin to AT-rich sequences has beenalready described (2,6) and the chemical basis for this interaction has been well characterized. However, to our knowledge the influence of distamycins interactions with DNA on the binding of regulatory proteins to DNA has not yetbeen investigated. To this aim we used as a model system two different sequences knowntobeimportant in gene regulation. The ATGCAAAT octamer is essential fortranscriptional regulation of several ubiquitously or tissue-specifically expressed genes(forareviewseerefs9,11,12,16)transcribed by either polIIorpol III(20); additionally, ithasbeenimplicatedinthestimulation of DNA replication byNF
1I
(21,22) .TheGATAAG sequence is presentinpromoterand enhancerelements of several globingenes,and isaffected bymutationsup-regulating y-globin expression inadulterythroid
cells(14,18).We found thatdistamycinAorits derivativeFCE24517inhibited thebindingofspecific nuclearproteins to theATGCAAATandGATAAGsequences. The effect of the drugs appears tobeselectivefor these sequences,asindicated bythe
following
observations:-the drugshavenoeffectonproteinbindingtothe C-rich CCACACCCsequence(Fig 4);
-footprintingexperimentsshow that the
drugs
interactpreferentially
with the AT richregion
including the ATGCAAAT motif (Fig 5), an effect that is
particularly
clearat lowdrug
concentrations;thattheoctamerisapreferred
targetis also shownby
the fact that thedrugs
inhibit thebinding of nuclearproteinstothis motifirrespective
of theflanking
sequences(see
for exampletheoctamotifinthe H2Bhistone andglobin
genesrespectively).
Asregards
the NFE 1 bindingsite,thefootprintshown infig
5indicates that the sequenceAGAT(G/A) (-171
toNucleic Acids Research
-175) reacted with the drug; this sequenceis known, from methylation interference experiments and from theeffects of the -175mutation on binding (14), to be an important part of theNFE 1 recognitionmotif;
-the drug's effect is not due to interaction with nuclear protein itself, as indicated by preincubation experiments and by itsinability toinhibit the binding of nuclear proteins interacting with other motifs(CCACACCC box, fig 4).
Considering that some distamycin derivatives, including FCE 24517, have recently shown potentantineoplastic activity(4,5) our results invite the speculation that these compounds might act by preventing the DNA-binding of specific regulatory proteins, thus inhibiting the transcription of genes which are important for neoplastic cell growth . This would be a novel mode of action for an anticancer agent. Indeed, recent results (unpublished) by this laboratory showthat in L1210 mouse leukemia cells these compounds lower (by more than 90%) the level of histone H2B mRNA(whose transcription is dependent on the octa motif) but not that of histoneH4 and actin mRNAs.
ACKNOWLEWMENTS
This work waspartially supported by CNRGrants No87.00866.51
Progetto
Finalizzato Ingegneria genetica e Basi Molecolari delle malattie ereditarie andProgetto
Finalizzato BiotecnologieeStrumentazionetoS.O., byCNR Grants No86.00653.44ProgettoFinalizzato Oncologiaand Progetto FinalizzatoBiotecnologie
eStrumentazionetoM.D. andby
Grantsfrom theItalianAssociationforCancerResearch(AIRC)toS.O. and M.D.. R.M. is supported bya fellowship from AIRC.*Towhomcorrespondence should beaddressed
REFERENCES
1. Di Marco,A.,Gaetani, M., Orezzi, P., Scotti,T.andArcamone,F.(1962) Cancer Chemother. Rep.18, 15-19.
2. Arcamone, F., Penco, S., Nicolella, V.,Orezzi P., andPirelli, A.M.(1964)Nature203, '1064-1065.
3.
Casazza,
A.M., Fioretti, A., Ghione, M., Soldati, M. and Verini, M.A. (1965) Antimicrob.Ag.Chemother. 5, 593-598.
4. Giuliani, F.C., Barbieri, B., Biasoli, L., Geroni, C., Menozzi, M. and Mongelli, N. (1988) Proc.Am. Ass. Cancer Res. 29, 330.
5. Barbieri, B., Giuliani, F.C., Pezzoni, G., Lazzari, E., Arcamone, F. and Mongelli, N. (1988) Proc.Am. Ass.Cancer Res.29, 330.
6. Kopka, M.L., Yoon, C., Goodsell, D., Pjura, P. and Dickerson, R.E. (1985) Proc. natn.
Acad. Sci. USA 82.1376-1380.
7. Low,C.M.L., Drew, H.R. and Waring M.J. (1986) Nucleic Acids Research 14,6785-6801.
8. Portugal, J. and Waring, M.J. (1987) Nucleic Acids Research 15, 885-903.
9.
Maniatis,
T.,Goodboum,S. and Fischer, J.A. (1987) Science 236, 1237-1244.10. Wingender E. (1988) Nucleic Acids Research 16, 1879-1902.
11. Sive, H.L. andRoeder, R.G. (1986) Proc.natn.Acad.Sci. USA 83, 6382-6386.
12. Staudt,L.M.,Singh,H.,Sen, R., Wirth, T., Sharp, P.A. and Baltimore, D. (1986) Nature323, 640-643.
13. Mantovani, R.,Malgaretti, N.,Giglioni, B., Comi, P.,Cappellini,N., Nicolis, S. and Ottolenghi, S. (1987) Nucleic Acids Research15,9349-9364.
14. Mantovani,R.,Malgaretti,N.,Nicolis, S., Ronchi,A.,Giglioni,B.andOttolenghi, S.
Nucleic AcidsResearch, 16,7783-7797.
15. Dignam,J.D.,Lebovitz, R.M. and Roeder R.G.(1983) Nucleic AcidsResearch11, 1475-1489.
16. Singh,H.,Sen,R.,Baltimore,D.andSharp, P.A. (1986)Nature319, 154-158.
17. Schmitz, A. andGalas, D.J. (1979) NucleicAcids Research 6, 111-137
18. Superti-Furga, G.,Barberis, A.,Schaffner, G. and Busslinger, M. EMBOJournal,in press.
19. Mantovani,R.,Malgaretti,N.,Nicolis, S.,Giglioni,B.,Comi,P.,Cappellini,N.,Bertero, M.T.,Caligaris-Cappio, F. and Ottolenghi, S. (1988) Nucleic Acids Research 16, 4299-4313.
20. Carbon,P.,Murgo,S., Ebel, J-P., Krol, A., Tebb, G., Mattaj,I.W.(1987) Cell51, 71-79.
21. DePamphilis, M.L.(1988) Cell52, 635-638.
22. Pruijn,G.J.M.,vanDriel, W.,vanMiltenburg,R.T.andvanderVliet, P.C.(1987) EMBO Joumal 6, 3771-3778.