• Non ci sono risultati.

Analisi di sequenza del DNA mitocondriale di individui di tartarughe comuni (Caretta caretta) campionati nelle acque dell'isola di Linosa

N/A
N/A
Protected

Academic year: 2021

Condividi "Analisi di sequenza del DNA mitocondriale di individui di tartarughe comuni (Caretta caretta) campionati nelle acque dell'isola di Linosa"

Copied!
60
0
0

Testo completo

(1)

Dipartimento di Biologia

Corso di Laurea Magistrale in

Biologia Marina.

Analisi di sequenza del DNA mitocondriale di

individui di tartarughe comuni (Caretta caretta)

campionati nelle acque dell’isola di Linosa

Relatore: Prof. Paolo Luschi

Relatore esterno: Prof Claudio Ciofi

Candidata: Silvia Guarnieri

(2)
(3)

Sommario

Abstract

...pag.4

Riassunto

...pag4 1

. Introduzione

1.1 Biologia della tartaruga marina Caretta caretta ...pag5 1.2 Attuali minacce riguardanti la specie Caretta caretta...pag.8 1.3 Stato di conservazione della specie Caretta caretta nel mondo...pag.9 1.4 Attuale distribuzione di C.caretta nel Mar Mediterraneo e migrazioni al suo interno..pag10

1.5 Distribuzione storica e attuale in Italia e demografia alle Isole Pelagie...pag14 1.6 Struttura del DNA mitocondriale...pag16 1.7 Database degli aplotipi del genoma mitocondriale di Caretta caretta...pag19 1.8 Scopo del lavoro...pag25

2. Materiali e Metodi

2.1 Campionamento...pag26 2.2 Estrazione del DNA da campione di sangue con l’ausilio di solventi organici...pag29 2.3 Reazione a catena della polimerasi...pag30 2.4.1 Preparazione del gel di agarosio...pag34 2.4.2 Elettroforesi di molecole di DNA su gel di agarosio...pag36

2.5 Reazione di terminazione a catena...pag39 2.6 Elettroforesi capillare...pag41 2.7 Analisi dei dati...pag42

3. Risultati e Discussione

3.1 Frequenze aplotipiche...pag44 3.2 Diversità aplotipica e nucleotidica...pag51 3.3 Network aplotipico………pag52 3.4 Mixed stock analysis ………..……….. pag53

4. Conclusioni

……….……... pag 57

(4)

Abstract

The main object of this study isthe characterization of the mitochondrial DNA control region (mtDNA) of loggerhead turtles (C.caretta) sampled at the Turtles Rehabilitation Center in Linosa. The following molecular genetic analyses were made to describe the degree of genetic variability of

C. caretta in Tunisian Basin and to determine the areas from which individuals came: 1) extraction

of DNA from blood samples through the use of organic solvents; 2) verification of the quality of the DNA extracted by electrophoresis on agarose gel; 3) amplification of the mitochondrial DNA control region using polymerase chain reaction; 4) estimation of the quality and quantity of the PCR amplification products by electrophoresis on agarose gel and spectrophotometer; 5) determination of the sequence using the chain termination reaction; 6) resolution of sequencing products by capillary electrophoresis on an automated nucleic acid analyzer. Through the program Arlequin 3.5.2.2 it’s been possible to assignto each individual, the haplotype of belonging by comparing the sequence obtained with an international database in which the known sequences of the mtDNA control region of C. caretta are filed. In the sample analysed, A2.1 haplotype represents 70% of the total; haplotypes A1.1 and A3.1 represent 6.5% and 5 haplotypes were identified minors. The haplotype and nucluotidic diversity values are respectively 0.496 ± 0.077 and 0.010 ± 0.005. By using the Bayes software the composition of the stock coming from the Tunisian basin was estimated, using as haplotypes reference sequences detected from sampled turtles nesting on 23 beaches, Mediterranean and Atlantic. In confirmation of previous studies on region of provenance of sampled common turtles in Linosa and Lampedusa, it was estimated that the most likely the rookeries of tested sample correspond to the coasts of Israel and Libyan.

Riassunto

L’oggetto di studio di questa tesi è stato la caratterizzazione della regione di controllo del DNA mitocondriale (mtDNA) di tartarughe marine comuni (C.caretta) campionate al centro di recupero tartarughe marine di Linosa, a seguito di spiaggiamento o cattura accidentale da parte di palangari o reti a traino. Con lo scopo di descrivere il grado di variabilità genetica di C. caretta nel Bacino Tunisino e di determinare le aree di provenienza degli individui che compongono questo stock, sono state effettuate le seguenti analisi di genetica molecolare: 1) estrazione del DNA da campioni di sangue mediante l’utilizzo di solventi organici; 2) verifica della qualità del DNA estratto

attraverso elettroforesi su gel d’agarosio; 3) amplificazione della regione di controllo del DNA mitocondriale mediante reazione a catena della polimerasi; 4) stima della qualità e quantità dei prodotti di amplificazione PCR tramite elettroforesi su gel d’agarosio e spettrofotometro; 5)

(5)

determinazione della sequenza mediante reazione di terminazione di catena; 6) risoluzione dei prodotti di sequenziamento mediante elettroforesi capillare su un analizzatore automatico di acidi nucleici. Mediante il programma Arlequin 3.5.2.2è stato possibile assegnare, a ciascun individuo, l’aplotipo di appartenenza confrontando la sequenza ottenuta con una banca dati internazionale in cui sono depositate le sequence conosciute della regione di controllo dell’mtDNA di C. caretta. Nel campione analizzato, l’aplotipo A2.1 rappresenta il 70% del totale, gli aplotipi A1.1 e A3.1

costituiscono il 6,5% e sono stati individuati 5 aplotipi minori. I valori di diversità aplotipica e nucluotidica sono rispettivamente 0,496±0.077 e 0.010±0.005.

Utilizzando il software Bayes, è stata stimata la composizione dello stock del bacino Tunisino, utilizzando come aplotipi di riferimento le sequenze rilevate da tartarughe campionate su 23 spiagge di nidificazione, mediterranee e Atlantiche. A conferma di precedenti studi sull’origine di

tartarughe comuni campionate a Linosa e Lampedusa, è stato stimato che le più probabili località natali del campione studiato corrispondono alle coste di Israele e Libiche.

1. Introduzione

1.1 Biologia della tartaruga comune Caretta caretta

La Caretta caretta è una specie la cui distribuzione comprende le acque temperate-calde,

subtropicali e talvolta tropicali di mari e oceani (Pritchard, 1997). Si distingue dalle altre specie per la presenza di più di un paio di scudi prefrontali, 5 scudi vertebrali

affiancati da 5 scudi costali, e 3 scudi inframarginali. C. caretta ha due artigli per arto e una

colorazione bruno-marrone del carapace (Rivera et al. 2011). Questa specie ha una testa massiccia e in proporzione più grande che nelle altre specie e per questo le è stato attribuito il nome comune di loggerhead turtle, “tartaruga dalla testa di legno”. Un esemplare adulto raggiunge una lunghezza di 85-124 cm, per un peso che può arrivare a 200 kg. La sua corazza è fusa con le vertebre

toraciche e le costole, non permettendo l’espansione della gabbia toracica per la respirazione. Il carapace è ricoperto da cinque coppie di placche cornee costali e da cinque scudi vertebrali di colore rosso-marrone. Il piastrone, invece, è generalmente di colore giallastro pallido e collegato al carapace mediante gli scudi marginali. Il numero delle piastre cornee sia della corazza che della testa costituiscono una caratteristica distintiva delle varie specie di tartaruga marina. Una delle singolarità delle tartarughe marine è il fatto che queste, diversamente da quelle terrestri, non possono ritirarsi all’interno della corazza, per cui gli arti e la testa sono facili bersagli dei predatori del mare, in particolar modo degli squali (Jones et al. 2012).

La respirazione avviene attraverso i polmoni di forma appiattita. Essi aderiscono internamente alla curva del carapace e hanno una limitata capacità di espansione. Attraverso il movimento di collo e arti, ma soprattutto, con l’aiuto di muscoli situati tra le zampe e l’intestino, avvengono sia la dilatazione che la contrazione di questi organi. Tra i vertebrati marini in grado di compiere

(6)

immersioni prolungate e in profondità, questi animali possiedono una serie di caratteri peculiari quali un efficiente sistema di trasporto dell’ossigeno, un metabolismo modificabile in base alle esigenze e una straordinaria tolleranza all’ipossia e all’ipercapnia (rispettivamente, la diminuzione dell’ossigeno e l’aumento dell’anidride carbonica nel sangue) (Craig et al. 2001).

Il cranio delle tartarughe è di tipo anapside, cioè senza fosse temporali, indice della loro scarsa storia evolutiva.La massa cerebrale è ridotta ed occupa ben poco spazio rispetto al volume del cranio. Le tartarughe marine non hanno denti ma riescono ugualmente a tranciare l’alimento grazie a taglienti astucci cornei, chiamati ranfoteche che rivestono mascella e mandibola. Essi sono come una guaina cornea affilata e leggermente ricurva anteriormente, che va a costituire il caratteristico “becco”, che consente di afferrare e triturare il cibo, costituito principalmente da molluschi, crostacei, echinodermi, alghe e meduse (Jones et al. 2012).

Gli occhi sono grandi ed adattati alla visione in acqua; una porzione delle ghiandole lacrimali si è trasformata in una particolare struttura, detta ghiandola del sale che serve ad eliminare il cloruro di sodio in eccesso ingerito dall'animale con l'acqua di mare. L’anatomia delle tartarughe marine è altamente specializzata per la vita acquatica. Esse presentano arti con forti modificazioni per il nuoto e la locomozione vera e propria: in particolare, quelli anteriori, molto sviluppati, si sono modificati in vere e proprie pinne natatorie, dotate di una forte capacità propulsiva, mentre le pinne posteriori esplicano una funzione timoniera (Pritchard, 1997). Come in tutte le altre specie di chelonidi, è presente un dimorfismo sessuale che permette la distinzione tra maschi e le femmine sessualmente maturi. In generale le femmine adulte raggiungono dimensioni maggiori, in termini di lunghezza del carapace e di peso, rispetto ai maschi adulti; mentre questi, al raggiungimento della maturità sessuale mostrano una lunga coda e due grandi resistenti unghie negli arti anteriori, con cui si aggrappano alla femmina durante l’accoppiamento (Casale et al. 2005).

Come la maggior parte delle altre tartarughe, le tartarughe comuni sono animali migratori, che compiono vari tipi di spostamento durante il loro ciclo vitale, le cui modalità e la distanza percorsa dipendono dal periodo del ciclo vitale considerato. Il ciclo vitale della Caretta caretta, quindi, si svolge in ambienti diversi: la spiaggia, nelle fasi di deposizione e di sviluppo embrionale, le zone pelagiche di mare aperto caratterizzate da grandi profondità (stadio oceanico o pelagico) e aree in cui la profondità non supera i 200 m, generalmente vicino alla costa o comunque comprese nella piattaforma continentale (stadio neritico). Generalmente le zone di foraggiamento sono condivise sia da individui giovani sia adulti, tuttavia vi sono casi in cui i giovani frequentano anche specifiche aree di foraggiamento intermedie e solo in un secondo momento, si spostano nei siti condivisi con gli adulti. Questi habitat di foraggiamento neritici costituiscono la zona, dove le tartarughe trascorrono gran parte del loro tempo, anche una volta diventate adulte, nutrendosi di varie prede rinvenute in genere vicino al fondo del mare (alimentazione bentonica), anche se è possibile la predazione a livello della colonna d’acqua e/o vicino alla superficie (alimentazione epi-pelagica). Da queste aree, le femmine adulte compiono una migrazione pre-riproduttiva, dirigendosi verso le zone di riproduzione, che sono specifiche per ciascun animale e che si ritiene corrispondano alle

(7)

aree natali dei singoli individui. Si hanno poche conoscenze sul comportamento migratorio degli esemplari maschi, tuttavia si ritiene che anch’essi compiano le migrazioni pre-riproduttive simili a quelle delle femmine, e che arrivino nelle aree di riproduzione in anticipo rispetto alla stagione di nidificazione per accoppiarsi. L’accoppiamento avviene prevalentemente nelle acque antistanti alle spiagge di nidificazione, che presumibilmente sono il posto in cui l’incontro tra i sessi è più

probabile, ma non è escluso che avvenga anche lontano da esse. La copula avviene in mare e può durare fino a tre ore. La femmina riceve una serie di morsi e colpi diretti al carapace e al collo, inferti dal maschio mediante l’ausilio delle lunghe unghie ricurve presenti nelle pinne anteriori. In seguito avviene la monta, durante la quale il maschio, trattenendosi con le pinne anteriori al

carapace della femmina, trasferisce il proprio sperma all’interno della cloaca della partner mediante il proprio organo copulatorio, costituito da una doccia ermetica ripiegata. Per la Caretta caretta quest’ultima fase può durare anche diverse ore. Le femmine possono immagazzinare gli spermatozoi all'interno del loro apparato riproduttivo, anche per lungo tempo. Dopo

l’accoppiamento, i maschi tornano alle zone di foraggiamento precedentemente occupate, e le femmine si dirigono verso le spiagge per deporre, iniziando un ciclo di deposizioni successive di uova, da 2-3 fino anche a 7, intervallate da circa due settimane, per poi ritornare all’area neritica una volta completato il ciclo di deposizioni, compiendo questa volta una migrazione post-riproduttiva. Le femmine, che mostrano notevole fedeltà ai siti di deposizione, durante la notte, raggiungono la spiaggia prescelta per la deposizione e trascinandosi con le pinne, si portano a circa 10-15 m oltre la battigia; quindi, trovato il luogo adatto, iniziano a scavare con gli arti posteriori una buca profonda a forma di anfora di circa 50-60 cm, dove depongono sino a 190, mediamente 110 uova sferiche e di colore bianco. Terminata la deposizione, che può durare fino a due ore, le

femmine ricoprono la buca con sabbia umida avendo cura di nascondere l’entrata e abbandonano le spiaggia sino alla successiva deposizione: una femmina può raggiungere sette deposizioni a

stagione. Il periodo di incubazione cambia al variare delle latitudini oscillando tra i 50 ed i 70 giorni con una temperatura ottimale di 26°-32°C. Come per altre specie di rettili, la temperatura determina il sesso dei nascituri: ad alte temperatura (intorno ai 32°) nascono individui di sesso femminile, al di sotto dei 28° nascono solo maschi. A temperature intermedie la sex ratio è circa 1:1 (Delgado et al. 2010). I piccoli appena nati raggiungono velocemente il mare, in genere di notte, per evitare di essere catturati da uccelli marini, granchi e altri predatori.(Maffucci et al. 2013). Le migrazioni riproduttive sono cicliche e a cadenza generalmente poliennale (2 o 3 anni di solito) e avvengono quindi tra aree di foraggiamento e di riproduzione definite e individualmente specifiche, e si

svolgono su una scala spaziale inferiore rispetto ai movimenti oceanici compiuti dai giovani durante le loro migrazioni di sviluppo, anche se non mancano casi di migrazioni di varie centinaia di

chilometri. Si possono quindi individuare tre principali movimenti durante il ciclo vitale di una tartaruga comune. L’iniziale dispersione dalla spiaggia di nascita all’habitat pelagico di sviluppo, in gran parte a carico delle correnti; gli spostamenti dall’habitat di sviluppo all’area neritica di

foraggiamento, che avviene una volta nella vita, e la migrazione riproduttiva pendolare ciclica a periodicità poliennale dall’area di foraggiamento verso i siti di nidificazione (Luschi e Casale, 2014).

(8)

1.2 Attuali minacce riguardanti la specie C.caretta.

Caretta caretta, attualmente classificata a livello mondiale come specie “vulnerable” della Red List

dalla IUCN, nonostante sia la più diffusa nel bacino Mediterraneo, ha una popolazione nidificante considerata scarsa o molto scarsa già da due decenni (Goombridge, 1990).

C’è una chiara evidenza dell’impatto negativo delle attività umane su queste specie. Fra queste le principali sono: 1) il deterioramento degli habitat di nidificazione, 2) l’impatto diretto dell’uomo (catture accidentali nella pesca, uccisioni volontarie e collisioni con le imbarcazioni), 3) l’ingestione di materiali plastici, polistirolo, legno, corde e attrezzatura da pesca, presenti in mare, e 4)

l’inquinamento antropico, con influenza sia sulla popolazione che sugli habitat.

Il lungo periodo di vita di questi Rettili (long-living species) e la loro posizione nella catena trofica marina con un’alimentazione basata principalmente su crostacei, molluschi e pesci, rende le

tartarughe marine particolarmente soggette agli effetti dei tossici presenti. Inoltre, diversi studi hanno dimostrato che i livelli di metalli pesanti rilevati nel materiale biologico di esemplari di C.

Caretta del Mar Mediterraneo sono spesso significativamente più elevati rispetto a quelli riscontrati

in esemplari della stessa specie campionati in altre aree marine (Aguilar et al. 2002).

La Convenzione di Barcellona ha adottato un piano d’azione per la conservazione delle tartarughe marine in Mediterraneo nel 1989, rivisitato poi nel 1998-1999 e nel 2007, riconoscendo che l’attività da pesca è uno dei più impattanti fattori antropici responsabile della morte di molte tartarughe marine in Mediterraneo, e che la conservazione di questi rettili, necessita di speciali priorità.

C.caretta presenta tre distinte fasi ecologiche di vita: una fase pelagica, quando soprattutto le

giovani tartarughe frequentano prevalentemente le acque a largo, nutrendosi di prede pelagiche; una fase demersale, quando esemplari giovanili, sub-adulti e adulti migrano vicino al fondo marino per nutrirsi di prede bentoniche; una fase neritica intermedia. L’impatto delle diverse attività di pesca sugli esemplari di C.caretta in Mediterraneo, è strettamente dipendente dalle fasi ecologiche di vita della specie e dall’ambiente in cui queste attività vengono condotte. La distribuzione degli individui di Caretta caretta in Mediterraneo non è omogenea. Sono la batimetria e le caratteristiche

ambientali di aree differenti (temperatura, disponibilità di cibo) che determinano la distribuzione della specie e la sua abbondanza.

I differenti tassi di cattura registrati per ciascun tipo di attrezzo da pesca dipendono dalla modalità di utilizzo dello stesso e dalle caratteristiche ecologico-comportamentali di Caretta caretta, anche in relazione alle diverse fasi del ciclo vitale. Questo fa si che attrezzi diversi determinano anche tassi di mortalità diretta e ritardata differenti (Casale et al. 2007a).

(9)

1.3 Stato di conservazione della specie Caretta caretta nel mondo.

Le specie ad oggi, più minacciate a livello mondiale sono: la tartaruga embricata (Eretmochelys

imbricata, nell’oceano Pacifico Orientale, i cui principali siti di nidificazione sono localizzati a El

Salvador, Nicaragua e Ecuador, e la Tartaruga liuto (Dermochelys coriacea) una tra le più grandi di questa famiglia che nidifica in Messico, Nicaragua e Costa Rica. A mettere a repentaglio la loro sopravvivenza, il furto di uova, la perdita di habitat e le catture accidentali. Nelle undici popolazioni rientrano anche due specie che vivono nell’oceano Indiano settentrionale: la tartaruga bastarda olivacea (Lepidochelys olivacea) e latartaruga comune (C.caretta). In queste zone, sebbene siano presenti diversi esemplari, la caccia ne uccide migliaia ogni anno.Tra le dodici popolazioni non a rischio di estinzione ci sono la tartaruga verde (Chelonia mydas) che vive nel sud-est dell’oceano Atlantico, in Brasile, Europa, nel Pacifico orientale, nelle isole Galapagos, in Ecuador e Messico (Scheyer et al. 2014).

Dallo studio di Wallace et al. 2011 si evince che C.caretta è una specie che in alcune aree (figura1) come il Nord e Sud Pacifico, è classificata ad alto rischio, ma all’interno del Mar Mediterraneo, viene classificata come specie a basso rischio e alta minaccia.

Figura 1 Piano di conservazione a livello globale della tartaruga marina C. caretta. Le aree rosse sono quelle dove C.caretta è ad alto rischio e alta minaccia, quelle gialle caratterizzano aree ad alto

rischio e bassa minaccia, le e verdi sono aree a basso rischio e bassa minaccia, quelle blu sono a basso rischio ed alta minaccia (Wallace et al. 2011)

Proprio perchè la specie C.caretta è considerata "vulnerabile" dalla IUCN (International Union for Conservation of Nature) è protetta da normative internazionali e, in particolare, da numerose convenzioni tra le quali la Convenzione di Barcellona e il relativo protocollo aggiuntivo che

(10)

e il disturbo durante i periodi di riproduzione, migrazione e svernamento. Inoltre a partire dal 1992 è in vigore la “Direttiva Habitat” (n.92/43/CEE), conosciuta anche come "Natura 2000", che include le tartarughe marine tra le specie “prioritarie” e mira alla costituzione di una rete ecologica di siti protetti su tutto il territorio dell’Unione (Davis 2005). Per specie cosmopolite e migratrici su lunghe distanze, quali appunto le tartarughe marine, che hanno un potenziale di dispersione naturale molto elevato, definire le unità gestionali (Management Units) è possibile grazie alla filopatria riproduttiva delle femmine, che tornano a deporre le uova alla spiaggia natale: i nidi documentano linee di discendenza femminile, ma dal momento che risulta assai complicato studiare il

comportamento di natal homing attraverso una marcatura diretta con tags sulle tartarughe, si ricorre

ad un marcatore molecolare ad eredità materna, il DNA mitocondriale. Le MU (Management Units) per le tartarughe marine sono definite come nidi che differiscono

significativamente nelle frequenze aplotipiche di mtDNA e sono da ritenersi popolazioni indipendenti e isolate rispetto alla linea materna (Garofalo et al. 2013).

1.4 Attuale distribuzione di C.caretta nel Mar Mediterraneo e migrazioni al suo interno.

La specie C.caretta è distribuita nelle acque temperate e tropicali degli Oceani Atlantico, Pacifico e Indiano. E' la specie di tartaruga marina più abbondante del Mar Mediterraneo. Le sue aree di riproduzione più importanti sono nel Mediterraneo orientale, mentre le principali zone di alimentazione attualmente note sono la piattaforma continentale tunisina, il mar Adriatico, e in maniera minore lo Ionio, l'area tra le isole Baleari e il mare di Alboran, la piattaforma continentale egiziana e la costa turca. Le prime due aree sono caratterizzate da una piattaforma continentale molto ampia dove le tartarughe sono trovano habitat ottimali a causa delle basse profondità e dell’abbondanza di cibo. Tuttavia anche lungo le coste dell’Egitto, Spagna e Grecia e Italia sono state individuate zone di foraggiamento: in questi casi le piattaforme continentali, sono

generalmente ristrette, dunque in queste aree la concentrazione di individui è maggiore e maggiori risultano anche le catture accidentali (Snape et al. 2016). I principali siti di nidificazione per questa specie, sono concentrati a Cipro, in Grecia, Libia e Turchia; alcune aree di nidificazione, meno abbondanti, si registrano anche in altri paesi del Mediterraneo come Egitto, Israele, Libano, Tunisia e Italia.

In Italia l'area principale di nidificazione è la parte ionica della Calabria meridionale, siti minori si trovano nelle isole Pelagie e in Sicilia meridionale, mentre nidificazioni sporadiche possono aver luogo nell'Italia meridionale (Mingozzi et al. 2007). Per quanto riguarda le zone di alimentazione nei mari italiani, l'Adriatico settentrionale rappresenta la zona maggiormente frequentata e le zone dell'Adriatico meridionale e del Mar Ionio sono areee particolarmente importanti per i giovani nei loro primi anni di vita, assieme allo Ionio meridionale e la zona tra la Sicilia e la Tunisia, che confina con una tra le zone più frequentate del Mediterraneo: la piattaforma tunisina.

(11)

Le migliori informazioni sui movimenti delle tartarughe comuni mediterranee sono state ottenute da studi di telemetria satellitare, in particolare per le femmine seguite durante la migrazione post-riproduttiva verso i luoghi di foraggiamento (Luschi e Casale 2014). La maggior parte delle informazioni si hanno per individui adulti rilasciati in Grecia e Cipro (figura 2), mentre dati

rilevanti sono stati recentemente ottenuti anche per femmine nidificanti a Creta (Patel et al. 2015) e sulla costa ionica della Calabria (Mingozzi et al. 2016).

Mentre il percorso geografico e l'estensione di queste migrazioni possono essere molto variabili, anche all'interno della stessa colonia (Schofield et al. 2013), il modello di comportamento generale è fondamentalmente lo stesso, ed è condiviso anche dai maschi (Casale et al. 2013). Tipicamente, le femmine lasciano la spiaggia di nidificazione per muoversi rapidamente verso le zone di

foraggiamento, che sono spesso situati abbastanza lontano dalla zona di riproduzione, e sono in acque neritiche (spesso costiere), in linea con la tendenza della specie di nutrirsi principalmente di prede bentoniche (Bjorndal 1997). Questo comportamento migratorio è pienamente corrispondente a quello delle femmine di C.caretta osservate in altre aree (ad es. Papi et al 1997).

Figura 2 Schema del decorso generale delle rotte migratorie di 63 individui adulti, rilasciati da Grecia e Cipro e seguiti tramite telementria satellitare.

Nell’insieme i risultati della telemetria satellitare hanno confermato l’importanza della aree neritiche dell’Adriatico settentrionale e della piattaforma continentale tunisina (Luschi & Casale 2014). Ciò non è sorprendente, dato che nel Mediterraneo la più grande estensione di aree poco profonde adatta al foraggiamento, è offerta proprio da queste zone. Altri fattori possono, tuttavia, avere un ruolo nel determinare i modelli di movimento osservati. Per esempio, recenti evidenze suggeriscono che le posizioni di foraggiamento delle tartarughe adulte potrebbero essere influenzate dagli scenari di movimento dei neonati (Hays et al. 2010), e questo spiegherebbe, ad esempio, il

(12)

motivo per cui pochi adulti foraggino nella parte occidentale del Mediterraneo, dato che le rookeries si limitano al bacino orientale.

Un altro studio basato sulla telemetria satellitare (Mingozzi et al. 2016) ha potuto ricostruire le rotte seguite da da femmine adulte nei 2-3 anni comprendenti il periodo riproduttivo. Le rotte

postriproduttice di queste 8 femmine, tutte nidificanti sulle coste della Calabria Ionica, avevano come meta, la piattaforma continentale tunisina, mentre le rotte pre-riproduttive ricostruite in 3 individui erano molto variabili e non sempre direzionate verso l’area di nidificazione.

Per quanto riguarda gli spostamenti dei giovani, all’interno del Mediterraneo le informazioni disponibili dagli studi di telemetria satellitare di riferiscono a individui con lunghezza del carapace inferiore ai 40 cm (Luschi e Casale 2014). Come esemplificato dalle

le rotte riportate in figura 3, i giovani si muovono all’interno del Mediterraneo esibendo movimenti non direzionati verso una specifica meta e molto variabili tra individui differenti (Luschi and Casale 2014).

Figura3 Ricostruzione tramite telemetria satellitari di individui giovani (“Large-Juvenile”) di

C.caretta. In blu e fucsia sono segnati i movimenti di individui rilasciati a Lampedusa. Quelli

marroni, arancioni e verdi, sono invece i movimenti delle tartarughe rilasciate da vari siti sulle coste italiane del Mar Tirreno e Adriatico.

Questa variabilità nei movimenti ricostruiti è in accordo generale con dati recenti ottenuti in altre aree che mostrano come il comportamento spaziale degli adulti di C.caretta sia, in realtà

caratterizzato da una notevole complessità. Questa variabilità è probabilmente legata alle abitudini opportunistiche di foraggiamento, che consentono loro di sfruttare aree di foraggiamento neritiche e oceaniche (Narazaki et al. 2013).

La difficoltà maggiore nell’ottenere informazioni sui movimenti di questa specie, sta nel caso degli individui molto giovani (small juveniles, sotto i 40 cm circa di lunghezza del carapace), che

(13)

trascorrono tutto il tempo in mare aperto, rendendo così difficile la loro osservazione, e sono troppo piccoli per essere equipaggiati con strumenti elettronici. Quindi, i movimenti delle tartarughe nella prima fase della loro vita sono impossibili da rilevare con tecniche di telemetria, satellitare e non. Subito dopo la nascita, si ritiene che i piccoli di tartaruga abbandonino l’area delle spiagge dove sono nati e inizino un periodo di vita prettamente pelagica, all’interno dei grandi sistemi di correnti. Solo dopo alcuni anni si trasferiscono, in ambienti costieri dove rimangono generalmente per la gran parte della loro vita (Bowen et al. 2004). Le uniche informazioni disponibili derivano dai risultati di simulazioni dei loro movimenti ottenute considerando i modelli di circolazione oceanica disponibili, che forniscono informazioni sul campo di correnti marine di una data area (Luschi and Casale 2014).

Le modalità con cui avviene il passaggio delle tartarughe giovani dall’ambiente pelagico a quello costiero/neritico sono praticamente sconosciute. Sulla base dell’ecologia giovanile riguardante il foraggiamento (Casale et al. 2008a) è stato proposto un modello ecologico-comportamentale che propone un graduale piuttosto che un brusco passaggio da uno stile di vita pelagico a bentonico.

Figura 4 Neonato di Caretta caretta ancora sulla spiaggia nativa.

(14)

1.5 Distribuzione storica e attuale in Italia e demografia alle Isole Pelagie

Fino al 2007 si credeva che l’area di nidificazione delle tartarughe comuni italiane fosse circoscritta alle isole Pelagie e che esse si riproducessero solo sporadicamente altrove. Sulle Pelagie la

nidificazione della specie risultava accertata, se pur non tutti gli anni, sin dal 1975, ma sempre con un numero esiguo di casi (2-3 nidificazioni/anno, nel ventennio 1980-1999) (Mingozzi et al. 2007).

L’ovodeposizione di C.caretta in Sicilia era nota fin dal XIX secolo. Da interviste fatte ai pescatori locali di Lampedusa e ai più anziani, è risultato che il numero di

tartarughe nidificanti è in netto declino e che le deposizioni venivano fatte su altre spiagge oltre a quella dell’Isola dei Conigli (Casale et al. 2007b). Nel corso degli ultimi 25 anni del secolo scorso, sono stati poi registrati casi di nidificazione sulle isole e le coste siciliane, in Sardegna, lungo le coste pugliesi e quelle ioniche di Basilicata e Calabria (Fig. 6), ed è stato accertato che la Caretta si riproduce anche lungo la costa ionica della Calabria (Mingozzi et al. 2007). In totale, comunque, si stima un numero di nidi limitato, tra i 30 e i 40 all'anno in Italia, a fronte di oltre 7200 in tutto il Mediterraneo (Casale e Margaritoulis, 2010). La nostra penisola si colloca quindi ai limiti occidentali dell’areale riproduttivo mediterraneo della specie, ma i suoi mari costituiscono aree strategiche di sosta e migrazione.

Figura 6. Distribuzione dei nidi di tartaruga C.caretta in Italia negli ultimi 40 anni (1965-2004). I dati sono stati raggruppati in tre periodi principali: (a) nidi registrati negli ultimi 5 anni (2000-2004); (B) i nidi registrati nei precedenti 15 anni (1985-1999); (C) i nidi registrati nel corso dei primi 20 anni (1965-1984) (Casale et al. 2012).

(15)

Anche nei periodi invernali è stata constatata una forte e regolare presenza di individui di Caretta

caretta nell’arcipelago delle Pelagie e l'area circostante Lampedusa è considerata anche un luogo di

svernamento. Le uniche spiagge note come siti usuali di deposizione sono la Pozzolana di Ponente a Linosa e la Spiaggia dei Conigli a Lampedusa. A Linosa, presso la spiaggia Pozzolana di Ponente, sono state registrate 18 deposizioni dal 1994 al 2004, (pari a 1,6 nidi/anno); a Lampedusa presso la Spiaggia dei Conigli sono state registrate 33 deposizioni dal 1990 al 2004 (pari a 2,2 nidi/anno) (Mingozzi et al. 2007). Considerando che su entrambe le isole vi è un’unica spiaggia in cui le tartarughe nidificano (la Spiaggia dell’isola dei Conigli ha una lunghezza di 150 m, quella di Pozzolana di ponente 100m), queste risultano avere la più alta densità di nidificazione rispetto alle restanti aree italiane. Lungo il resto delle coste italiane, soprattutto nel Mar Ionio, le nidificazioni sono disseminate lungo chilometri di spiagge e non concentrate.

(16)

1.6 Struttura del DNA mitocondriale

I mitocondri sono organuli presenti nel citoplasma di tutte le cellule degli animali aerobi e dei vegetali. Essi rappresentano le strutture cellulari deputate a fornire la maggior parte dell’energia. In essi avviene la trasformazione del piruvato in acetilCoA; ciclo delll’acido citrico (Krebs); catena respiratoria accoppiata alla sintesi di ATP; catabolismo degli acidi grassi (β ossidazione); parte del ciclo dell’urea; deposito di calcio e omeostasi del calcio citoplasmatico. Il DNA mitocondriale è formato da un cromosoma circolare avvolto a doppia elica e privo di istoni, quindi, non organizzato in nucleosomi. Le sue dimensioni sono costanti all’interno di ogni specie. Paradossalmente, i cromosomi mitocondriali di animali superiori, sono di dimensioni minori rispetto a quelli di funghi o vegetali, che sono costituiti da 16.775 coppie di basi, mentre quello di Drosophila è circa 18.000 bp, quello di Neurospora crassa, una muffa del pane, è di circa 60.000 bp e quello di lievito di circa 75.000 bp. I genomi mitocondriali delle piante sono ancora più grandi e sono compresi tra 250.000 e 2 milioni di bp (80÷800 mm), a seconda delle specie. In ogni mitocondrio si trovano da due a dieci copie di mtDNA che differisce strutturalmente dal DNA nucleare in quanto è formato da una singola macromolecola circolare. I marcatori molecolari, come il DNA mitocondriale, sono di grande importanza per la descrizione e il monitoraggio delle migrazioni di popolazioni di tartarughe. La sequenza completa del genoma mitocondriale di C.caretta comprende 16,440 bp contententi 37 geni, dei quali 13 codificano per proteine e partecipano alla fosforilazione ossidativa, 22 codificano per tRNA, 2 codificano per rRNA e la regione di controllo.

Figura 8. Genoma Mitocondriale di Caretta caretta. (The complete mitochondrial genome of the

loggerhead turtle Caretta caretta.2012)

Il mtDNA è formato da due filamenti: strand H (Heavy)che comprende 28 dei 37 geni

(17)

codificante, è detta Control Region nei vertebrati e AT-Rich Region negli insetti (Drosopoulou et al. 2012). La control region (D-loop) nella specie C.caretta è localizzata tra il gene codificante per il tRNA della Prolina C5H9NO2 e quello per la Fenilalanina C9H11NO2. Due amminoacidi, di cui il

primo polare e il secondo non polare, costituente le più comuni proteine alimentari. All’interno della regione di controllo vi sono diversi elementi regolatori della trascrizione genica, più o meno lunghi da un minimo di 5 basi ad un massimo di 34 basi. Di seguito è riportata una tabella con le loro sequenze specifiche.

Tabella.1 Sequenze e posizioni degli elementi regolatori nella regione di controllo del genoma mitocondriale di C.caretta (Drosopoulou et al. 2012).

Le sequenze degli elemnti regolatori riportati in tabella 1, sono maggiormente conservate in quanto fondamentali per la trascrizione genica. Eventuali mutazioni possono non essere compatibili con la sopravvivenza dell’individuo

Sempre dallo studio di Drosopolou del 2012 risulta che nel genoma mitocondriale di C.caretta, tutti i geni codificanti usano ATG come un codone di inizio tranne COI, che utilizza GTG. Quattro geni codificanti (COII, ATP8, ND4L, e ND5) terminano con TAA, mentre due geni codificanti (COI e ND6) terminano con AGG. I restanti geni (ND1, ND2, ATP6, COIII, ND3, ND4, e CYTB) non possiedono codoni stop corretti, ma mostrano una T terminale o TA. Questo è abbastanza comune e tipico tra i geni del mtDNA dei vertebrati (Drosopoulou et al. 2012). Il gene ND3 presenta una base extra in posizione 175. La stessa mutazione è stata segnalata per molte tartarughe e rettili ed è

Regulator y element Sequence (5’-3’) Position TAS-1 TACAT 15,594-15,598 TAS-2 TACAT 15,692-15,696 CSB-D ATTCTGGCCTCTGGTTGGTTTTTTCA 15,889-15,914 CSB-C ATGAGTTCTATACATTAAATTTATAACCTGGCATA 15,975-16,009 CSB-B TTACTTGCATGTGGTAGTCTTTTTTTTCTCTTTG 16,018-16,051 CSB-1 TTAATTAATGCTTTTAGGACATA 16,146-16,168 CSB-2 AACCCCCCCACCCCC 16,235-16,250 CSB-3 GTCAAACCCCTAAATCC 16,289-16,305

(18)

considerata relativamente antica. Sono state segnalate simili inserzioni di singoli nucleotidi in altre posizioni del gene ND3, così come nei geni ND4 e ND4L di diverse specie di tartarughe, ma non per la specie C.caretta.

Le regioni non codificanti del mtDNA dei vertebrati sono limitate all’origine della replicazione del filamento light (OL), e della regione di controllo che regola la replicazione e la trascrizione (Shadel e Clayton 1997). Nel genoma mitocondriale di C.caretta, l'origine della replicazione del filamento light (OL) è stata identificata con il frammento di 28-bp (5'-TTT TCC CGC TCT ATA AAA AGC GGG AAA A-3') che si trova tra i geni e tRNAAsn e tRNACys. La lunghezza della regione di

controllo in C.caretta, che si trova tra i geni tRNAPro e tRNAPhe, varia a causa della presenza di un

microsatellite presso il 3' finale. Quando questa ripetizione è esclusa, la dimensione della D-loop è stimata a 937 bp. Diversi frammenti conservati, che sono presenti nella maggior parte dei vertebrati e si ritiene abbiano un ruolo di regolamentazione, sono stati identificati anche nella zona di

controllo di C.caretta.

Un microsatellite con la sequenza ripetuta pentanucleotide 5'-TATAT-3', risiede alla fine della regione di controllo. La presenza di ripetizioni alle estremità 5’ e 3’ finale della D-loop è

abbastanza comune nei vertebrati e può provocare variazioni di lunghezza intra e inter-specifiche significative (Drosopoulou et al. 2012). Il microsatellite ATA ripetuto all’estremità 3’ finale della D-loop è abbastanza comune tra le tartarughe, così come è comune in numerose specie provenienti da diverse famiglie. Lo studio di Drosopoulou et al, del 2012, su individui di sesso femminile di C.

caretta, campionati sull'isola greca Zacinto, riporta una variazione da circa 320 a circa 640 bp, della

lunghezza della regione del microsatellite di 34 animali. L'eteroplasmia, cioè la coesistenza di diversi genomi mitocondriali, dedotta sulla base delle differenze dimensionali dei microsatelliti, è stata osservata in un numero considerevole di casi (7/34, ossia il 20,6%).

(19)

1.7 Database degli aplotipi del genoma mitocondriale di C.caretta

Gli aplotipi conosciuti, a livello mondiale, vengono riportati nel lo studio di Shamblin del 2014. Tutti gli aplotipi ad oggi conosciuti della specie C.caretta, sono suddivisi in due aplogruppi di origine. Nel primo aplogruppo, l’aplotipo principale è il CC-A1.1. Nel secondo aplogruppo invece, l’aplotipo principale è CC-A2.1 e da esso si sono originati quasi tutti i successivi aplotipi.

Figura 9 Network degli aplotipi di 800 paia di basi di mtDNA di C.caretta campionata nel Mar Mediterraneo, nell’Oceano Atlantico e Indiano. MED=Mediterraneo, QRMX=Mexico, SEUS= Acque Sud-Orientali degli Stati Uniti, NWATL=Nord Atlantico, BRZ=Brasile, CPVD=Capo Verde, MAS= Isola Masirah (Shamblin et al. 2014).

All’interno del Mar Mediterraneo, gli aplotipi che ad oggi sono stati riscontrati, provengono dall’aplotipo CC-A2.1. Esso stesso è presente nel bacino suddetto, insieme ad altri 17 aplotipi, 13 dei quali, sono esclusivi del Mediterraneo. Un importante studio (Clusa et al. 2014) sulle tartarughe che nidificano nel Mediterraneo, ha mostrato che la specie C.caretta ha una notevole strutturazione genetica all’interno del bacino suddetto. L'ipotesi è che i giovani tartarughe marine provenienti da diverse colonie non siano

(20)

distribuiti in modo omogeneo tra le principali aree di foraggiamento del Mediterraneo, a causa di un complesso schema di correnti superficiali. L’estrazione di lunghi frammenti di DNA mitocondriale di tartarughe giovani provenienti da sei aree di foraggiamento (Catalano-Baleari Mare, bacino algerino, Mar Tirreno, Mar Adriatico, Mar Ionio settentrionale e meridionale Mar Levantino), e la successiva analisi bayesiana hanno portato alla stima dei contributi delle colonie nel Mediterraneo Nord-occidentale e Capo Verde per le aree di foraggiamento studiate. Giovani di C.caretta

provenienti dalla Libia prevalevano nell’area centrale ed occidentale del Mediterraneo, altri nel bacino algerino. Al contrario, il Mar Adriatico è stato caratterizzato da una grande presenza di individui provenienti dalla Grecia occidentale, mentre il Mar Levantino sud era abitato da un mix eterogeneo di tartarughe dalle orientale colonie del Mediterraneo (Turchia, Libano e Israele). Un altro studio rilevante, dal punto di vista genetico, è stato quello di Clusa nel 2013, dove, sono stati campionati piccoli di tartaruga morti o embrioni di uova che non si erano schiuse, provenienti da vari siti del Mar Mediterraneo tra il 2003 e il 2006. L’approccio genetico è servito per conoscere la struttura della popolazione nel Mediterraneo e per verificare se la specie avrebbe potuto colonizzare il Mediterraneo durante il Pleistocene. Anche in questo caso è stata amplificata la D-loop del DNA mitocondriale, un frammento (815 bp) da 168 larve morte campionate dalle colonie di Libia, Israele, Libano, Cipro e Grecia. Dal campione analizzato, è risultato il seguente network degli aplotipi del DNA mitocondriale (figura 10).

Figura 10. Network degli aplotipi descritti con cerchi composti da spicchi proporzionati al contributo delle varie rookeries (Clusa et al. 2013).

Il network presenta un’importante presenza dell’aplotipo CC-A2.1(77.33%), seguita da CC-A3.1 (12,50%). Dei restanti aplotipi, 13 erano unici di una specifica spiaggia di nidificazione e due sono stati condivisi tra i siti di nidificazione del Mediterraneo, anche se non si sono riscontrati ad alte

(21)

frequenze. La rete degli aplotipi mostrava un sottogruppo divergente, con due aplotipi unici in Libia (CC-A26.1 e CC-A65.1) e un aplotipo condiviso anche con Israele (CC-A2.9). La Turchia orientale ha presentato un sottogruppo con aplotipi unici (CC-A3.2 e CC-A52.1). Gli aplotipi unici della Turchia orientale hanno avuto un minor numero di mutazioni dall’ aplotipo ancestrale (CC-A2.1) di aplotipi dalla Libia. Un'ambiguità nella struttura di aplotipo è stata trovata tra l’aplotipo CC-A3.1 e gli aplotipi non condivise dalla Grecia occidentale (CC-A6.1 e CC-A32.1).

Gli aplotipi CC-A32.1 e CC-A6.1 condividono una lacuna ma differiscono di una transizione mentre CC-A32.1 e CC-A3.1 differiscono da tale gap ma condividono la transizione. Così, la spiegazione più parsimoniosa a questa ambiguità è che il passaggio fosse avvenuto

indipendentemente due volte (Clusa et al. 2013).

In un terzo lavoro (Carreras et al. 2007) sulla struttura genetica della popolazione della tartaruga marina nidificante sulle coste del Mediterraneo orientale,sono stato sequenziati un frammento della regione di controllo del DNA mitocondriale (n = 190) e sette microsatelliti (n = 112).

Sono stati campionati 112 individui provenienti da sette aree di nidificazione del Mediterraneo. La bassa variabilità osservata nella regione di controllo del mtDNA rispetto a quella delle

popolazioni dell'Atlantico (Bowen et al., 2005 e riferimenti) è probabilmente causata della recente origine delle popolazioni mediterranee, che sono state fondate da individui migrati dall’ Atlantico circa 12.000 anni fa (Bowen et al. 1993).

L'aplotipo CC-A2 è certamente uno di loro ed era probabilmente presente fin dall'inizio in tutte le spiagge di nidificazione del Mediterraneo. I nuovi aplotipi CC-A6 e CC-A29 (figura 11) si sono evoluti da esso, ma sono rimasti limitati a piccole aree all'interno del Mediterraneo orientale a causa della filopatria delle femmine. L'origine dell’aplotipo CC-A3 è incerto, in quanto potrebbe

provenire dall’ Atlantico o potrebbe essersi evoluto in modo indipendente nel Mediterraneo dall’ aplotipo CC-A2. La sostituzione che differenzia CC-A3 da CC-A2 ha avuto luogo almeno due volte: in Atlantico ha creato l’aplotipo CC-A3 dall’aplotipo CC-A2 e in Grecia ha creato l’ aplotipo CC-A32 dall’ aplotipo CC-A6, diventando così il primo esempio di omoplasia riportato per la regione di controllo del mtDNA in tartarughe marine. Qualunque sia l'origine dell’aplotipo CC-A3, il flusso di geni limitato, causato dalla filopatria delle femmine, ha limitato l'espansione geografica degli aplotipi CC-A3, CC-A6, CC-A32 e CC-A29 nel Mediterraneo. La differenziazione genetica sulla base del mtDNA ha rivelato l'esistenza di almeno quattro unità indipendenti all'interno del Mediterraneo orientale, la maggior parte di essi caratterizzati da un aplotipo esclusivo: (1) le spiagge di nidificazione della Grecia continentale e le adiacenti isole Ionie, caratterizzate dall’ aplotipo CC-A6; (2) Turchia orientale, caratterizzata dall’ aplotipo CC-A3; (3) Israele,

caratterizzata dall’ aplotipo CC-A29 e (4) di Cipro, che comprende solo l’aplotipo CC-A2 (Carreras et al. 2007).

(22)

Figura 11 Network degli aplotipi che compongono il campione dello studio di Carreras et al. Del (2007).

Anche nello studio condotto su individui campionati sulle coste della Calabria (Garofalo et al. 2009), è stata riscontrata un’alta percentuale di individui con aplotipo più comune CC-A2.1seguito da CC-A20.1. Le sequenze ottenute (815 bp) per i 71 individui campionati da 47 nidi sono risultate

essere appartenenti a sette aplotipi diversi, riportati in figura 12.

Figura 12 Mappa del Mediterraneo Centro-Orientale con le frequenze degli aplotipi riscontrati negli 11 siti di nidificazione (Garofalo et al. 2009).

L’aplotipo CC-A2 è condiviso da tutte le popolazioni nidificanti nel Mediterraneo, con una frequenza che arriva al 100% in quattro casi, vale a dire, Creta, Cipro, Libano e Libia. Dei sei rimanenti aplotipi, trovati nelle aree di nidificazione del Mediterraneo, inclusa la Calabria, cinque si

(23)

differenziano dall’aplotipo CC-A2 per un singolo step mutazionale e solo due aplotipi si differenziano da CC-A32 per un solo step mutazionale.

Uno studio ancora più recente, ha riguardato i vari territori di foraggiamento nel Mediterraneo (Clusa et al. 2014). Lo studio ha portato alla conoscenza della distribuzione degli individui di origine atlantica e mediterranea che frequentano le zone neritiche del Mediterraneo, che è riconducibile quasi interamente ai flussi di corrente superficiali (Clusa et al. 2014). Per ogni

foraging ground preso singolarmente, è stata determinata la composizione sulla base dei dati

genetici ottenuti in nidi (dieci Atlantici e tredici Mediterranei) già precedentemente geneticamente caratterizzati (Figura 13).

Figura 13. Composizione dei nidi di provenienza (%) per le sei principali località di foraggiamento a livello del Mar Mediterraneo.ATL (Oceano Atlantico), MIS (Misrata, Libya), WGR (Grecia

occidentale), WTU (Turchia occidentale), LEV (Israele; Libano; Cipro; Turchia orientale); OTHER (Sirte, Libia; Calabria, Italia; Creta, Grecia). Le spiaggie di nidificazione sono

contrassegnate con una stella (Clusa et al. 2014).

In base ai risultati ottenuti, si evidenzia la presenza di individui di origine atlantica nel bacino Algerino, che provengono in gran parte dalla Florida, sotto l’azione della Corrente del Golfo (Garofalo et al. 2013). Il contributo maggiore degli individui di origine atlantica si ha nel bacino Algerino e va a diminuire procedendo verso est; la spiegazione più immediata di questo pattern è che i giovani entrano attraverso lo stretto di Gibilterra, trascinati dal flusso di corrente in ingresso (il bilancio idrico negativo del Mediterraneo provoca un continuo afflusso di masse d'acqua

(24)

Poiché l'evaporazione dovuta all'effetto del sole è tale da non poter essere compensata dall'apporto di acqua fluviale e piovana, è sempre presente una corrente entrante dallo stretto di Gibilterra. In sostanza il Mediterraneo viene rifornito da acqua oceanica che dopo aver passato lo stretto di Gibilterra fluisce verso Est. La figura 14 riporta in forma schematizzata, la corrente entrante in Mediterraneo, che si spinge verso Est dividendosi in un ramo principale ed in altri secondari. Il ramo principale, sotto l'effetto della forza di Coriolis, si dirige verso destra e si addossa alla costa africana perdendo via via intensità fino ad estinguersi (Clusa et al. 2014).

Probabilmente soltanto gli adulti (> 70 cm CCL) o al più individui large-juveniles, sono poi in grado di contrastare tale corrente e nel caso degli adulti, di ripercorrere all'indietro la stessa strada per tornare a riprodursi e nidificare nell’Atlantico occidentale. Per cui i giovani atlantici

condividono il foraging ground di individui Mediterranei senza incrociarsi con loro.

Figura 14. Principale modello di circolazione superficiale del Mar Mediterraneo (Bergamasco and Malanotte-Rizzoli 2010).

Anche un aplotipo Libico (CC-A2.9), individuato dallo studio di Clusa e Carreras (Clusa et al. 2014), caratterizza individui presenti nel bacino Algerino. Questa componente libica è

probabilmente soggetta ai vortici di corrente a mesoscala tipici dello Ionio, che intrappola i piccoli appena schiusi e ne previene la dispersione verso est; dal bacino Ionico è possibile che correnti verso ovest sospingano i Libici verso il bacino Algerino, nel Mar Tirreno e nel Catalano-Balearico. Nel bacino Sud Levantino invece, vi è una buona parte dei nidi della Turchia occidentale, insieme a quelli di Israele e Libano (Garofalo et al. 2013).

(25)

1.8 Scopo del lavoro

Lo scopo della tesi è stato individuare gli aplotipi degli individui campionati al largo dell’isola di Linosa per la definizione della struttura genetica delle tartarughe pescate accidentalmente alle Isole Pelagie. Sono stati determinati i valori di due dei principali indici di diversità genetica del DNA mitocondriale. Successivamente, è stata effettuata un’analisi di Mixed Stock, che ha permesso di risalire alla più probabile composizione percentuale della popolazione campionata rispetto agli aplotipi mitocondriali tipici delle principali spiagge di nidificazione del Mediterraneo.Questo permette di stimare quale sia il luogo natale delle tartarughe delle Isole Pelagie.

(26)

2. Materiali e Metodi

2.1 Campionamento

Per le analisi del DNA mitocondriale, sono stati campionati 76 esemplari di C.caretta presenti al Centro di Recupero Tartarughe Marine di Linosa, in gran parte derivanti da catture accidentali da parte di pescatori le cui reti hanno catturato l’animale durante il suo soggiorno in zona bentonica. La loro taglia è sempre entro i 70 cm proprio perchè esemplari di maggiori dimensioni, sono più difficoltosi da recuperare e trasportare.

La tipologia di campione è sia sangue che anticoagulante litioeparina (LH) prelevati prima della liberazione degli animali, tra Luglio 2004 e Ottobre 2007.

Il prelievo è stato effettuato con un ago cannula al centro dello spazio fra collo e arto anteriore. I campioni sono stati conservati in frigo tra 0° e 7 ° prima di essere traslocati al laboratorio di Biologia Molecolare di Sesto Fiorentino, dove si sono svolte le successive analisi.

Di alcuni campioni erano presenti due o tre provette, di altri, un unico saggio.

Tabella 2. Lista dei campioni analizzati, con data di campionatura e codice di riconoscimento dell'animale sul lato sinistro e destro.

(27)

Genetic ID

DATA L R CAMPIONE NOTE

C001 20-Jun-04

34/03 IT1300 IT0961 LH C002

28-Jun-04

01/04 IT0987 IT0986 SIERO C003

28-Jun-04

02/04 IT0985 IT0984 SIERO C004 8-Jul-04 06/04 IT0992 IT0993 LH C005

12-Jul-04

08/04 IT0998 IT0996 LH C006

16-Jul-04

IT0655 IT0656 LH campionata a Lampedusa C007 18-Jul-04 05/04 IT0990 IT0991 LH C008 17-Aug-04 27/04 IT1239 IT1240 LH C009 4-Jul-05 02/05 IT1249 IT1250 LH C010 9-Jul-05 03/05 IT1264 IT1265 LH C011 18-Jul-05 30/04 IT1257 IT1256 LH C012 19-Jul-05 04/05 IT1276 IT1541 LH C013 23-Jul-05 05/05 IT1277 IT1248 LH C014 23-Jul-05 06/05 IT1278 IT1279 LH C015 23-Jul-05 07/05 IT1577 IT1576 LH C016 26-Jul-05 08/05 IT1283 IT1282 LH C017 28-Jul-05 09/05 IT1285 IT1284 LH C018 28-Jul-05 33/04 IT1255 IT1254 LH C019 29-Jul-05 10/05 IT1299 IT1298 LH C020 29-Jul-05 11/05 IT1297 IT1296 LH C021 29-Jul-05 12/05 IT1274 IT1275 LH C022 29-Jul-05 13/05 IT1293 IT1292 LH C023 30-Jul-05 15/05 IT1263 IT1542 LH C024 9-Aug-05 16/05 IT1578 IT1579 LH C025 18-Aug-05 17/05 IT1551 IT1552 LH C026 24-Aug-05 19/05 IT1547 IT1548 LH C027 25-Aug-05 18/05 IT1550 IT1549 LH C028 26-Aug-05 20/05 IT1554 IT1553 LH C029 26-Aug-05 22/05 IT1544 IT1543 LH C030 26-Aug-05 23/05 IT1556 IT1555 LH C031 28-Aug-05 24/05 IT1557 IT1558 LH C032 1-Sep-05 25/05 IT1560 IT1559 LH C033 27-Sep-05 14/05 IT1294 IT1295 LH C034 27-Jun-06 36/06 IT1349 IT1350 LH C035 8-Jul-06 37/06 IT1347 IT1348 LH C036

14-Jul-06

38/06 IT1332 IT1331 SIERO C037

15-Jul-06

39/06 IT1346 IT1345 LH C038

15-Jul-06

40/06 IT1344 IT1343 SIERO C039

15-Jul-06

41/06 IT1341 IT1342 SIERO C040

15-Jul-06

42/06 IT1339 IT1340 LH C041 15-Jul- 43/06 IT1337 IT1338 LH

(28)

C042 15-Jul-06

44/06 IT1335 IT1336 SIERO C043

17-Jul-06

46/06 IT1381 IT1380 LH C044

17-Jul-06

47/06 IT1328 IT1330 SIERO C045

19-Jul-06

48/06 IT1327 IT1326 SIERO C046 25-Jul-06 45/06 IT1334 IT1333 LH C047 29-Jul-06 49/06 IT1395 IT1394 LH C048 14-Oct-06 54/06 IT1392 IT1393 LH C049 6-Jul-07 01/07 IT1385 IT1386 LH C050

10-Jul-07

02/07 IT1387 IT1388 SIERO C051

16-Jul-07

07/07 IT1316 IT1317 SIERO C052

16-Jul-07

08/07 SIERO C053

17-Jul-07

09/07 IT1305 IT1306 SIERO C054 17-Jul-07 10/07 LH C055 18-Jul-07 12/07 IT1390 IT1391 LH C056 19-Jul-07 11/07 IT1301 IT1302 LH C057 19-Jul-07 13/07 IT1304 IT1303 LH C058 21-Jul-07 14/07 IT1315 IT1314 LH C059 23-Jul-07 15/07 IT1323 IT1322 LH C060 23-Jul-07 16/07 IT1815 IT1816 LH C061 23-Jul-07

17/07 IT1311 IT1313 SIERO C062

23-Jul-07

18/07 IT1312 IT1310 SIERO C063

23-Jul-07

19/07 IT1308 IT1307 SIERO C064

23-Jul-07

20/07 IT1309 IT1389 SIERO C065

24-Jul-07

21/07 IT1526 IT1527 SIERO C066

2-Aug-07

25/07 IT1533 IT1532 SIERO C067

7-Aug-07

22/07 IT1803 IT1804 SIERO C068

7-Aug-07

23/07 IT1805 IT1806 SIERO C069

8-Aug-07

24/07 IT1535 IT1534 SIERO C070 8-Aug-07 26/07 IT1531 IT1530 LH C071 8-Aug-07 27/07 IT1529 IT1528 LH C072 8-Aug-07 28/07 IT1801 IT1802 LH C073 17-Sep-07 36/07 IT1824 IT1825 LH C074 9-Oct-07

IT1545 IT14524 SIERO C075 IT0420 IT0421 LH C076

24-Jul-05

(29)

2.2 Estrazione di DNA da campione di sangue con l’ausilio di solventi organici

Il protocollo standardizzato, usato per l’estrazione del DNA da sangue di Caretta caretta prevede l’utilizzo di solventi organici, che consentono di separare in due fasi nettamente distinte gli acidi nucleici dalle componenti proteiche e lipidiche; in principio occorre far digerire il campione e le membrane citoplasmatiche, per far fuoriuscire il contenuto cellulare su cui poi far lavorare i solventi organici. Il primo intervento prevede la digestione overnight in uno shaking incubator a 38° C, con uno spin di 13,000 rpm: si preleva 90 μl di sangue, che vengono messi a digerire in un buffer di estrazione (600 μl) con proteinasi K (10 μl). Il buffer di estrazione è una soluzione alcalina che viene preparata con Tris-Hcl (100mM), EDTA (5mM), NaCl (100), SDS (0,5%):

La proteinasi K è un’endopeptidasi, isolata dal fungo Tritirachium album, con elevata specificità di taglio per i legami adiacenti ai gruppi carbossilici di amminoacidi alifatici e aromatici.

Dopo che le proteasi K hanno svolto il loro compito, vengono allontanate dagli acidi nucleici grazie all’aggiunta di solventi organici come il fenolo (C6H6O) o il cloroformio (CHCl3). Viene

centrifugato il campione digerito per 20’’ a 13.000 rpm. In questo modo i detriti solidi precipitano e si può recuperare la fase liquida in cui sono in soluzione varie molecole biologiche. Al campione recuperato si aggiunge un egual volume (700 o 600 μl a seconda dell’efficienza della digestione enzimatica) di Fenolo:Cloroformio:Alcole Iso-Amilico (24:24:1), che denatura le proteine e le precipita insieme ai lipidi e agli altri metaboliti; dopo mescolamento e centrifuga di 5 minuti a 13.000 rpm, sono visibili le due fasi, ben separate: la fase surnatante contiene acidi nucleici in soluzione acquosa, mentre la fase sottostante contiene le altre molecole con fenol cloroformio.Un secondo passaggio del surnatante con egual volume di Cloroformio:Alcole Iso-Amilico (24:1) aumenta ulteriormente la fase del fenolo, facilitandone la separazione, e dopo mescolamento e centrifuga sono nuovamente distinguibili le due fasi. A questo punto il surnatante viene passato con 1 ml di Etanolo 100%, che fa condensare il DNA in un flocculo spesso visibile a occhio nudo. Centrifugando a 13.000 rpm per 10 minuti si precipita il pellet; l’etanolo viene quindi rimosso con la pipetta e in asciugatore a 60° C per 10 minuti. Al termine del processo di estrazione il pellet viene risospeso in 200-300 μl di TE (10mM Tris-HCl, 1mM EDTA) o in 200 μl di acqua deionizzata DNAsi free per PCR.

(30)

2.3 Reazione a catena della polimerasi

La PCR (Polymerase Chain Reaction, o Reazione a Catena della Polimerasi) fu ideata dal biochimico statunitense Kary B. Mullis nel 1983. E’ una metodologia utilizzata per ottenere

quantità che ammontano a μg di copie di segmenti specifici di DNA o di RNA, partendo da quantità minime (anche una sola molecola) presenti in una preparazione di acidi nucleici. Ebbe poi, negli anni successivi, un tale sviluppo da rivoluzionare molti campi della ricerca di base e applicata. Le sue numerose applicazioni riguardano la genetica molecolare, la diagnostica, la medicina forense, le analisi alimentari e microbiologiche e gli studi di filogenesi molecolare.

E’ una tecnica che riproduce in vitro, in maniera controllata e mirata, la replicazione del DNA ad opera dell’enzima DNA polimerasi.

Nell’arco di poche ore posso essere riprodotte anche migliaia di copie di un frammento di DNA all’interno di due regioni con sequenza nota.

La DNA polimerasi utilizza come stampo un singolo filamento di DNA, di cui assembla il

complementare: occorre dunque denaturare la doppia elica e questo è possibile con temperature di circa 90°C.

Gran parte degli enzimi perde la sua funzionalità in condizioni termiche così estreme, ma non la Taq polimerasi, entrata in uso ormai da anni per la PCR.

Si tratta di un enzima termoresistente, che è stato isolato da un batterio delle sorgenti calde,

Thermus Aquaticus; ha un optimum intorno ai 72°C e resta stabile fino a 95°C.

Sebbene lo stampo utilizzato dalla DNA polimerasi sia appunto il singolo filamento, l’enzima non è comunque in grado di realizzare il filamento complementare ex novo: di fatto, riesce solo ad

allungare un frammento già presente. Per riprodurre la reazione in vitro, dunque, è necessario fornire alla Taq anche questo attacco oligonucleotidico, cioè il primer. Poiché la reazione avviene in parallelo sul filamento forward e sul filamento reverse, sono necessari due primers fiancheggianti la regione di interesse, dai quali possa partire l’allungamento.

I primers sono solitamente oligonucleotidi di 17-24 basi, con un contenuto di GC di almeno il 40%: guanina e citosina formano tre legami a idrogeno, contro i due di adenina e timina, e rendono dunque più saldo l’attacco al DNA stampo. Il contenuto in GC determina poi due parametri

importanti dei primers: la temperatura di melting (Tm), alla quale circa metà del DNA è in forma di singola elica, e la temperatura di annealing (Tann), alla quale i primers si attaccano allo stampo. Generalmente la temperatura di annealing differisce da quella di melting per pochi gradi (Tann=

(31)

Per eseguire un protocollo corretto, le dosi delle componenti, sono le seguenti: DNA stampo 1μl Buffer Ci 10X Cf 1X MgCl2 Ci 50mM Cf 1.5mM dNTPs Ci 10mM Cf 0.3mM Primer Fwd1 Ci 10μM Cf 0.5μM Primer Rev1 Ci 10μM Cf 0.5μM DNA Taq Polimerasi 5U/ μl 1/2U ddH2O ad arrivare a 15 μl

- La Taq DNA polimerasi ha solitamente una emivita di 30 min a 95 °C. Questo fatto limita il numero di cicli della PCR ed il tempo di denaturazione del primo step. Infatti considerando

un’incubazione di 1 min a 95 °C per ogni ciclo di PCR il numero di cicli effettuabili non può essere superiore a 30-35. Diminuendo il tempo di denaturazione a 15-30 sec i cicli di PCR possono

solitamente essere aumentati fino a 45. È inoltre possibile ridurre la temperatura di denaturazione dopo i primi 10 cicli di PCR. Ad esempio per ampliconi di lunghezza inferiore a 3 Kbp si può effettuare la denaturazione a 88 °C (per frammenti di DNA amplificati con meno del 50% di contenuto in G+C).

La PCR si basa essenzialmente su tre steps, ripetuti ciclicamente:

- Denaturazione della doppia elica di DNA, tra i 90 e i 95°C.

In questa fase occorre ottimizzare due parametri essenziali: 1) la denaturazione ottimale del DNA stampo su cui si effettua la PCR; 2) il mantenimento delle attività della Taq DNA polimerasi. 1) Normalmente il DNA si trova nella classica conformazione a doppio filamento in cui i due filamenti (strands) del DNA sono tenuti assieme dai legami a ponte di idrogeno formati tra le basi azotate complementari (A: T; G: C). Il DNA deve essere portato ad una condizione di singola elica (single-stranded) in modo che successivamente si verifichi l’appaiamento (annealing) alle molecole di primer (anch’esse a singolo filamento). Per fare ciò la soluzione contenente il DNA viene portata ad una temperatura al di sopra della sua “temperatura di fusione (Tm)” (melting temperature), nella quale i legami ad idrogeno, non più stabili, permettono la separazione tra i due singoli filamenti del DNA. Nel tampone di reazione in cui viene normalmente effettuata la reazione di PCR la

temperatura di fusione è solitamente compresa tra 92 e 96 °C e la denaturazione viene favorita dalla presenza di concentrazioni saline relativamente alte (circa 150mM NaCl). Spesso la temperatura di fusione viene anche chiamata “temperatura di denaturazione”, anche se dal punto di vista chimico-fisico sono due concetti diversi.

(32)

- Annealing dei primers, tra i 30 e i 65°C.

Questo secondo step consiste nella programmazione della temperatura e del tempo di appaiamento dei primer. La temperatura di annealing (Ta) dei primer dipende dal loro contenuto in G+C e dalla loro lunghezza e quindi dalla temperatura di fusione tra primer e la sua elica complementare sul DNA stampo. Considerando primer di lunghezza media di 20 basi una formula empirica spesso utilizzata per il calcolo della Tm è la seguente: Tm = [4(G + C) + 2(A + T)] °C. Dove G, C, A e T indicano il numero di nucleotidi contenenti le basi azotate guanina, citosina, adenina o timina. Nel caso che i due primer abbiano Tm diverse generalmente si considera quello con la Tm più bassa. Solitamente si utilizza come temperatura di annealing la Tm-5 °C anche se spesso l’utilizzo diretto della stessa Tm può portare ad avere ottime rese nella reazione di PCR. Nel mettere a punto le reazioni di PCR si possono seguire essenzialmente due tipi di criteri riguardo alla Ta: 1) Ta costante durante i cicli; 2) Ta che diminuisce ciclo dopo ciclo (touch-down) Nella gran parte delle reazioni la Ta rimane costante per tutta la durata della reazione e non si effettuano variazioni lungo i cicli. La strategia di reazione touch-down permette di rendere i primi cicli di PCR estremamente “stringenti”, cioè tali da promuovere l’amplificazione solo di frammenti specifici rendendo instabili eventuali annealing dei primer a sequenze di DNA non perfettamente complementari. In effetti una Ta troppo bassa porta all’annealing dei primer a sequenze non esattamente complementari e quindi

all’amplificazione di frammenti non specifici, mentre una Ta troppo alta può ridurre la resa in quanto solo una frazione delle molecole del primer riesce ad innescare la polimerizzazione a causa dell’elevata instabilità del loro appaiamento con il DNA stampo. Il tempo di annealing infine non deve essere troppo lungo (in modo da sfavorire appaiamenti a stampi con bassa complementarietà). Di solito si utilizzano tempi dell’ordine di 30 sec o meno.

- Estensione dei nuovi filamenti ad opera della polimerasi, tra i 65 e i 72°C.

Il terzo step della reazione di PCR è legato alla programmazione della temperatura e del tempo di estensione dei primer. La temperatura utilizzata è solitamente compresa tra 68 e 72 °C. La Taq DNA polimerasi ha un’attività specifica a 37 °C molto simile a quella del frammento di Klenow della DNA polimerasi I di E. coli. Tuttavia l’attività della Taq DNA polimerasi ha il suo massimo a circa 70 °C e l’estensione dei primer avviene ad una velocità di circa 100 basi/sec. Generalmente 1 min è sufficiente per amplificare con una buona resa stampi lunghi circa 1 Kbp. Il tempo di estensione viene quindi calibrato sulla lunghezza dello stampo da amplificare tenendo conto che una preparazione di Taq DNA polimerasi, a causa della sua processività non alta, solitamente non amplifica con buona resa frammenti di DNA di lunghezza superiore a 3 Kbp. In alcuni casi (soprattutto per l’amplificazione di stampi oltre le 3 Kbp) può essere conveniente incrementare il tempo di estensione ciclo dopo ciclo per andare incontro alla diminuzione della concentrazione di Taq DNA polimerasi (o altre DNA polimerasi termostabili) attiva.

(33)

Tabella 3. Impostazioni del termociclatore per la reazione di terminazione di catena Temperatura Tempo di mantenimento Numero Cicli

94°C 5 min X1 94°C 40 sec X35 52°C 40 sec 72°C 1 min 72°C 5 min X1 HOLD 4°C

I cicli successivi al primo sfruttano poi come DNA stampo i filamenti neo-sintetizzati nei cicli precedenti, con aumento esponenziale del DNA ad ogni ciclo: per N copie iniziali di DNA e n cicli di PCR, il numero Y di copie finali dovrebbe corrispondere a Y = N 2n; di fatto bisogna considerare un’efficienza di reazione (E), compresa tra 0,7 e 0,8, da cui la formula che più realisticamente descrive il processo risulta: Y=N(1+E) n.

Solitamente vengono realizzati tra i 30 e i 45 cicli, al termine dei quali, per ogni filamento di DNA stampo iniziale, si sono ottenuti diversi miliardi di copie.

L’operatore può impostare il numero di cicli, così come le temperature esatte, sul macchinario che effettua la PCR, il termociclatore.

Figura 15. Steps di un ciclo di PCR.

Nel presente studio, in alcuni casi, il campione è stato sottoposto a PCR dopo essere stato diluito 1:10 post estrazione.

L’esito della PCR è stato ogni volta valutato attraverso elettroforesi su gel d’agarosio all’1%: l’intensità delle bande su gel e la loro nitidezza indicano l’entità dell’amplificazione e la qualità degli amplificati, permettendo la progettazione delle procedure successive.

(34)

2.4.1 Preparazione del gel di agarosio

In questo studio, il gel è stato preparato ad una concentrazione dell’1%, ovvero aggiungendo un grammo di agarosio (Invitrogen) a 100 ml di TBE 0.5X (Tris-Acido Borico-EDTA, pH 8.3). L’agarosio, che si presenta sotto forma di polvere, viene sciolto nella soluzione tampone in una beuta di vetro Pyrex. Viene poi messo nel forno a microonde per il tempo necessario affinché si sciolga, ma evitando che la soluzione giunga a bollore.

Si fa raffreddare la soluzione fino a quando diventa tiepida e si aggiunge, senza respirarne i vapori, il Bromuro di Etidio (Sigma) (in un gel da 100 ml si aggiungono 2 μl di EtBr). Il Bromuro di Etidio è una molecola organica aromatica planare, altamente cancerogena, che si intercala tra le basi del DNA. Dopo l’inserzione nell’elica, il colorante rimane perpendicolare all’asse dell’elica, e forma delle interazioni di van der Waals con le coppie di basi sovra e sottostanti. L’interazione del fluorocromo col DNA fa sì che questo aumenti la sua fluorescenza rispetto a quella del colorante libero in soluzione. Il Bromuro di Etidio assorbe nell’ultravioletto ed emette fluorescenza con radiazioni elettromagnetiche di lunghezza intorno ai 590 nm. In seguito si versa la soluzione ottenuta nella slitta, già predisposta con i pettini per i pozzetti, e si lascia solidificare.

A questo punto il gel è pronto per essere inserito nella camera elettroforetica, dove si aggiunge TBE 0.5X fino a ricoprire completamente la superficie del gel e si rimuovono i pettini in modo che i pozzetti vengano riempiti dal tampone.

Stabilita la quantità di DNA da caricare sul gel, vi si aggiunge un volume di Blu di Bromofenolo (BBF) (Sigma). Lo scopo del BBF è semplicemente quello di permettere all’operatore di capire quanto il gel abbia corso, e quindi staccare la corrente quando la corsa è giunta a termine ed i campioni possono essere controllati. Inoltre serve a trattenere il DNA all’interno del pozzetto senza farlo disperdere nel tampone.

In un pozzetto a parte viene inserito un marcatore di riferimento composto da una serie di

frammenti di dimensioni note che serviranno come riferimento nella lettura dei risultati. Il marker da noi utilizzato è il GeneRuler 1Kb (MBI Fermentas), ottenuto con frammenti di DNA del fago lambda precedentemente digerito con enzimi di restrizione. I frammenti che si formano differiscono tra loro solo di circa 1000 basi, e formeranno delle bande sul gel, anch’esse fluorescenti agli UV, che ci serviranno come riferimento per l’identificazione approssimativa delle dimensioni dei frammenti di DNA e per stimare la quantità di DNA.

Attraverso l’utilizzo di una pipetta, vengono caricati i campioni contenenti DNA e BBF ed il GeneRuler nei pozzetti. Caricato il gel si pone il coperchio della cella elettroforetica, si collegano i due cavi del coperchio all’alimentatore e si imposta il voltaggio a 80V per una elettroforesi di circa 20 min.

Una volta terminata la corsa, si posiziona il gel su un transilluminatore a raggi UV così da poter visualizzare i frammenti di DNA. L’immagine viene inviata ad un computer e può essere visualizzata col programma Quantity One 4.6.7.

(35)

Figura16. Una volta verificato che l’estrazione del DNA è avvenuta con successo, è possibile amplificare la regione di controllo del DNA mitocondriale tramite reazione a catena della polimerasi.(Smith et al. 1989)

Riferimenti

Documenti correlati

Questo percorso reattivo ha due vantaggi principali: il primo è che dopo la mesilazione, l’unica reazione che può avvenire è quella che porta alla formazione di GAP-PB, mentre con HDI

Considering the inverse comorbidity between Alzheimer’s disease (AD) and lung cancer (LC) as a case study [22–24], we applied our MF framework to 17 transcriptomic datasets,

A key difference between wine and flor yeast comes from the differences in growth style: during wine fermentation yeasts are in suspension in the vessel as a pelagic growth whereas

Nonostante i risultati ottenuti negli esami clinici e radiografici sostengano la presenza di differenze rilevanti negli esiti dei pazienti con fratture di tipo A, B e C, le

l’ingresso dei neolaureati nel contesto lavorativo, aiutandoli prima di tutto a trovare strategie e metodi che consentano loro di far dialogare in modo proficuo il

If the rational soul becomes a monopoly for the humans, Aquinas must find for animals another vital and organizing principle, and it is here that the term

– Estimation of eddy diffusivity with Dirichelet boundary condition, using second-order Tikhonov regularization with 1% of noise: vertical eddy diffusivity K zz and horizontal