EFFECTS OF EPIGENETIC ALTERATIONS ON THE APOPTOSIS REGULATING PROTEINS IN PANCREATIC CANCER

(1)

LITHUANIAN UNIVERSITY OF HEALTH SCIENCES MEDICAL ACADEMY

Aušra Lukošiūtė-Urbonienė

EFFECTS OF EPIGENETIC

ALTERATIONS ON THE APOPTOSIS

REGULATING PROTEINS

IN PANCREATIC CANCER

Doctoral Dissertation Medical and Health Sciences,

Medicine (M 001)

(2)

Dissertation has been prepared at the Laboratory of Surgical Gastro-enterology of Institute for Digestive System Research of Medical Academy of the Lithuanian University of Health Sciences during the period of 2016– 2020.

Scientific Supervisor:

Prof. Dr. Žilvinas Dambrauskas (Lithuanian University of Health Sciences, Medical and Health Sciences, Medicine – M 001).

Dissertation is defended at the Medical Research Council of the Lithuanian University of Health Sciences:

Chairperson:

Prof. Habil. Dr. Virgilijus Ulozas (Lithuanian University of Health Sciences, Medical and Health Sciences, Medicine – M 001).

Members:

Prof. Dr. Brigita Šitkauskienė (Lithuanian University of Health Sciences, Medical and Health Sciences, Medicine – M 001);

Prof. Dr. Rasa Ugenskienė (Lithuanian University of Health Sciences, Medical and Health Sciences, Medicine – M 001);

Prof. Dr. Sonata Jarmalaitė (National Cancer Institute, Natural Sciences, Biology – N 010);

Prof. Dr. Christoph Michalski (Ulm University, Medical and Health Sciences, Medicine – M 001).

Dissertation will be defended at the open session of the Medical Research Council of the Lithuanian University of Health Sciences on February 5th_, 2021 at 12 a. m., in the auditorium No. 4004 of the Department of Pediatrics at the Hospital of Lithuanian University of Health Sciences Kauno klinikos.

(3)

LIETUVOS SVEIKATOS MOKSLŲ UNIVERSITETAS MEDICINOS AKADEMIJA

Aušra Lukošiūtė-Urbonienė

KASOS VĖŽIO EPIGENETINIŲ

POKYČIŲ ĮTAKA APOPTOZĘ

REGULIUOJANTIEMS

BALTYMAMS

Daktaro disertacija Medicinos ir sveikatos mokslai,

medicina (M 001)

(4)

Disertacija rengta 2016–2020 metais Lietuvos sveikatos mokslų universitete, Medicinos akademijos, Virškinimo sistemos tyrimų instituto, Chirurginės gastroenterologijos laboratorijoje.

Mokslinis vadovas

prof. dr. Žilvinas Dambrauskas (Lietuvos sveikatos mokslų universitetas, medicinos ir sveikatos mokslai, medicina – M 001).

Disertacija ginama Lietuvos sveikatos mokslų universiteto Medicinos mokslo krypties taryboje:

Pirmininkas

prof. habil. dr. Virgilijus Ulozas (Lietuvos sveikatos mokslų universitetas, medicinos ir sveikatos mokslai, medicina – M 001).

Nariai:

prof. dr. Brigita Šitkauskienė (Lietuvos sveikatos mokslų universitetas, medicinos ir sveikatos mokslai, medicina – M 001);

prof. dr. Rasa Ugenskienė (Lietuvos sveikatos mokslų universitetas, medicinos ir sveikatos mokslai, medicina – M 001);

prof. dr. Sonata Jarmalaitė (Nacionalinis vėžio institutas, gamtos mokslai, biologija – N 010);

prof. dr. Christoph Michalski (Ulmo universitetas, medicinos ir sveikatos mokslai, medicina – M 001).

Disertacija ginama viešame Medicinos mokslo krypties tarybos posėdyje 2021 m. vasario 5d. 12 val. Lietuvos sveikatos mokslų universiteto ligoninės Kauno klinikų Vaikų ligų klinikos auditorijoje Nr. 4004.

(5)

Skiriu savo močiutės bendruomenės slaugytojos

Genovaitės Kazlauskienės atminimui

(6)

(7)

ABBREVIATIONS

ARE Adenine and uracil (AU) rich elements APAF-1 Apoptotic peptidase activating factor 1

BAX Apoptosis regulators also known as Bcl-2-like protein 4 Bcl-2 Apoptosis-suppressing oncoprotein

Bcl-2 family consists of a number of evolutionarily-conserved proteins that share Bcl-2 homology (BH) domain

BIRs Baculoviral IAP repeats BIRC2 cellular IAP1 (cIAP1) BIRC3 cellular IAP2 (cIAP2)

BIRC4 X chromosome linked IAP (XIAP/ILP1)

BIRC5 Survivin

BIRC6 Apollon (Bruce) BIRC7 Livin (ML-IAP)

BIRC8 IAP-like protein 2 (ILP2/TsIAP) CDKN2A Cyclin-dependent kinase inhibitor 2A CDK4 Cyclin-dependent kinase 4

CO Carbon monoxide

COX-2 Prostaglandin - endoperoxide synthase (cyclooxygenase) DAC 5-Aza-2ꞌ-deoxycytidine/Decitabine

DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid DRs Death receptors

dATP Deoxyadenosine triphosphate EGF Epidermal growth factor

ELAVL1 RNA-binding protein known as HuR FBS Fetal bovile serum

HuR Human antigen R

HO-1 Heme oxygenase 1

IAPs Inhibitors of apoptosis proteins

IPMNs Intraductal papillary mucinous neoplasms KRAS Kirsten rat sarcoma viral oncogene

LSMU Lithuanian University of Health Sciences MCNPs Mucinous cystic neoplasms

mRNA Messenger RNA is a single-stranded RNA molecule that is complementary to one of the DNA strands of a gen

PanIN Pancreatic intraepithelial neoplasms PDAC Pancreatic ductal adenocarcinoma

(10)

qRT-PCR Quantitative real time polymerase chain

RNA Ribonucleic acid

RBPs RNA-binding proteins siRNA Small interfering RNA

SMAD Intracellular protein that transduce extracellular signals from TGF-β ligands to the nucleus SMAC/DIABLO second mitochondria-derived activator of

caspase/direct IAP binding protein with low pl Survivin inhibitor of apoptosis repeat-containing 5 or BIRC5 TGF-β Transforming growth factor beta

TNF Tumor necrosis factors

TNFR Tumor necrosis factor receptor TP53 Tumor protein 53 also known as p53

TRAILR TNF-related apoptosis-inducing ligand receptor 3′UTR Untranslated region, founded on the 3' side XIAP X linked inhibitors of apoptosis protein or BIRC4

(11)

INTRODUCTION

With the aging of humanity there have been growing cases of pancreatic ductal adenocarcinoma cancer (PDAC). However, the results of treatment remain one of the worst [1]. The lethality of pancreatic cancer is determined by rapid invasion of the surrounding tissue, early metastatic disease and poor response to standard chemotherapy and radiotherapy [2]. With improving biotechnology sciences, there have been evolving faster and more efficient assessment of the individual patient’s tumor cytoprotective and oncogenic mechanisms [3]. Recent studies have revealed that defect in apoptotic pathway may be related with cancer development and resistance to chemo-therapy and radiochemo-therapy [4]. Knowledge of the molecular details of apoptosis regulation, and the proteins constituting the apoptosis core machinery has revealed new strategies for identifying small-molecule drugs that could one day yield more effective treatments for a wide variety of illnesses [5].

IAP (inhibitors of apoptosis proteins) are the protein’s family charac-terized by the presence of one or more baculoviral IAP repeats (BIRs) which are involved in regulating mitosis and inhibiting cells from undergoing apoptosis [6,7]. They alter activity in numerous cancer types (leukemia, hepatic, esophageal, ovarian, pancreatic cancer) and are implicated in progression of the disease, resistance to chemotherapy, worse outcome and prognosis [8,9]. However, epigenetic regulation of IAP and its direct effect to apoptotic potential and proliferation in pancreatic cancer cells is still unclear.

Normally, post-transcriptional regulation plays a critical role in the process of cell proliferation and apoptosis. However, in cancer cells, this control might be impaired by changes in the expression of RNA binding proteins [10]. Increasing evidence support that a key regulator of post-transcriptional gene regulation is Human antigen R (HuR or ELAVL1) [11]. Additionally, a deregulated HuR pathway may be relevant to cancer biology and may possibly promote abnormal expression of several proteins. Recent research has shown that hyper-expression of HuR increases the stability of IAP mRNA and determines the increased the resistance and vitality of tumor cells [12]. However, little is known about the role of ARE-binding protein HuR in the regulation of IAPs expression and/or function in pancreatic cancer cells.

Induction of apoptotic pathways in cancer therapy is often complicated by molecular defects in apoptosis signaling pathways, one of these pathways is gene silencing through DNA methylation [13]. Furthermore, it is known that pancreatic cancer is an epigenetic disease, characterized by widespread and profound alterations in DNA methylation [14]. Recent studies have been

(12)

to chemotherapy by altering expression of genes critical to drug response [15].

APAF-1 (apoptotic peptidase activating factor 1) is a key molecule in the intrinsic or mitochondrial pathway of apoptosis, which oligomerizes in response to cytochrome c release and forms a large complex known as apoptosome [16]. APAF-1 is important for tumor suppression and drug resistance because it plays a central role in DNA damage – induced apoptosis [17]. Inactivation of the APAF-1 gene may be a crucial factor disturbing the intrinsic pathway of apoptosis and is implicated in disease progression and chemoresistance in different cancer types including PDAC [18–21]. It is known that sensitivity to the treatment in tumor cells is increased by demethylation agent 5-Aza-2ꞌ-deoxycytidine (decitabine), which suppresses DNA methyltransferases activity. That results in reconstituting the expression of silenced genes and restoring their anti-tumorigenic activities [22]. Recent studies show, that restoring physiological levels of APAF-1 by decitabine treatment, markedly enhances chemo-sensitivity and rescues the apoptotic defects associated with APAF-1 loss in various cancers [19,23,24]. Despite recent progress in understanding the pathway of apoptosis in cancer, numerous questions such as the selection of genes targeted for this aberrant DNA methylation in pancreatic cancer remain poorly understood.

Therefore, the present study aimed to clarify the different effects of epigenetic alterations on the apoptosis regulating proteins in pancreatic cancer in order to provide new information regarding the role of epigenetic regulation pancreatic cancer’s patogenesis.

The aim of the study

The aim of this study was to assess the effects of some epigenetic alterations on the apoptosis regulating proteins in pancreatic cancer.

The objectives of the study

1. To investigate the expression of IAPs (IAP1, IAP2, XIAP, Survivin) in pancreatic ductal adenocarcinoma tissues (PDAC) and determine its association with histopathological features and clinical outcomes.

2. To investigate whether HuR is directly involved in IAP’s (IAP1 and IAP2) epigenetic regulation and to assess the effects of HuR silencing in pancreatic cancer cells.

3. To investigate the expression and methylation status of APAF-1 in PDAC tissue and to determine its association with tumor’s histopathological characteristics and clinical outcomes.

(13)

4. To assess the effect of decitabine treatment on the APAF-1 expression and methylation and subsequent changes in sensitivity of pancreatic cancer cells.

Novelty and relevance of the study

This research is important internationally, because it is the first study analyzing the complex value of epigenetic alterations on the apoptosis regulating proteins in pancreatic cancer.

There is little known about the role of ARE-binding protein HuR in the regulation of IAP1 and IAP2 in pancreatic ductal adenocarcinoma. There are no studies demonstrating the role of HuR and IAP separately in pancreatic cancer. In our study, new fundamental knowledge about the direct interaction of RNA stabilizing protein HuR and IAPs was achieved. Furthemore, we are the first ones to demonstrate that HuR RNA regulates the expression of IAPs in pancreatic cancer.

Additionally, while the aberrant patterns of DNA methylation are known to be associated with carcinogenesis in various cancers, however there was little known about APAF-1 and its methylation process to apoptotic potential and proliferation in PDAC. We provided new insights into pancreatic cancer’s epigenetic regulation by demethylation pathway on PDAC cells.

In conclusion, the identification and analysis of these epigenetic mecha-nisms allow us to better understand the value of tumor’s environmental factors changes in regulation of apoptotic potential in pancreatic cancer.

(14)

1. REVIEW OF LITERATURE

1.1. Pancreatic cancer

Pancreatic ductal adenocarcinoma (PDAC) is aggressively invasive, treatment-resistant malignancy and often asymptomatic at a curable stage, whereas the majority of patients present with local invasion or metastatic disease [2]. Early detection is considered essential in order to improve patient survival as most patients present with advanced, non-operable disease [2]. The lethality of pancreatic cancer is undermined by rapid invasion of the surrounding tissue, early metastatic disease and poor response to standard chemotherapy and radiotherapy [25]. Pancreatectomy remains the single most effective treatment modality, with recent advances in neoadjuvant and adjuvant chemotherapeutic regimens resulting in some added improvement in outcomes [25]. However, only 20 % of patients present with disease which is suitable for resection. Those who undergo resection and receive adjuvant therapy have a median survival of 12–22 months and a 5-year survival of 20– 25% [26]. The majority of patients developed systemic recurrence even after margin negative (R0) resections, suggesting that PDAC is a systemic disease, even in the absence of radiographic evidence of distant metastases [27]. Despite of the tenacious effort to develop new agents, none of the currently available chemotherapeutic agents have an objective response rate higher than 10% [28]. Recent advances in technologies for genome-wide measurements raised hope for the identification of such early biomarkers and epigenetic alterations as well as new therapeutic targets [14,29].

1.1.1. Epidemiology of pancreatic cancer

Pancreatic cancer (PDAC) which constitutes 90% of pancreatic cancers is the seventh leading cause of cancer death worldwide, and is the fourth or fifth most common cause of cancer death in developed countries [30]. Although accounting for only 3% of new cases, pancreatic cancer is responsible for 6% of all the cancer deaths each year [31]. In an era when the oncologic treatments of many solid organ cancers have made significant advances, it is sobering that the survival of patients with PDAC remains largely un-changed [27]. Based on current epidemiologic trends, it is expected to be the second leading cause of cancer mortality by 2030 [32]. While the National Cancer Institute’s Surveillance, Epidemiology and End Results Program (SEER) data suggest that mortality rates are slightly increasing overall at 0.4% each year from 2008–2018 [33], the prognosis of diagnosed patients

(15)

remains extremely poor, with a 1-year relative survival rate of 28% and 5-year rate of 7% [34,35]. Successful screening is difficult to accomplish because most PDAC present late in their natural history, and current interventions have not provided significant benefit [36].

1.1.2. The molecular biology of pancreatic cancer

As pancreatic cancer is fundamentally a genetic disease, it presents high heterogeneity in terms of mutational landscape of crucial signaling pathways [37]. Most recently, next generation sequencing technologies have revealed the genetic landscape of neoplasms that arise from preinvasive neoplasms of the pancreas [38]. Pancreatic cancer most commonly develops through a series of intraductal epithelial lesions called pancreatic intraepithelial neoplasms (PanIN), where minimally dysplastic epithelium progresses to more severe dysplasia and finally to invasive carcinoma with the successive accumulation of genetic mutations [3,39]. Precursor lesions include pan-creatic intraepithelial neoplasms (PanINs), intraductal papillary mucinous neoplasms (IPMNs) and mucinous cystic neoplasms (MCNPs) [37] . While low-grade lesions are frequently observed in normal adult pancreas or patients with chronic pancreatitis and are associated with a low risk of developing PDAC, high-grade PanIN3 lesions are almost exclusively found in patients with invasive PDAC [39]. Over the past two decades, tremendous effort has been devoted to identifying genetic alterations (at both the chromosomal and nucleotide levels) in pancreatic cancer, and these efforts have led to the discovery of gross chromosomal losses and gains at selected loci and mutations/deletions of oncogenes and tumor- suppressor genes [14]. In addition to these genetic changes, many alterations in gene expression and specific signaling pathways have been described in pancreatic cancer and its precursors.

The diversity of clinical outcomes and the molecular heterogeneity of histopathologically similar cancer types, incomplete knowledge of the genomic aberrations that drive carcinogenesis and the lack of therapeutics that specifically target most known genomic aberrations necessitates large-scale detailed analysis of cancer genomes to identify novel potential therapeutic strategies [3,40]. Prospective genomic profiling of advanced PDAC is feasible, and early data indicate that chemotherapy response differs among patients with different genomic/transcriptomic subtypes [41–43]. Data from resected PDAC genome sequencing studies indicate that PDAC lacks highly actionable simple somatic mutations [43]. The pancreatic cancer

(16)

the genetic alterations in order to develop an effective treatment [44]. A total of 20,661 protein-coding genes have been analyzed in 24 pancreatic cancers, leading to identification of a total of 1,562 somatic alterations. Over 1,300 genes were found to contain at least one genetic alteration, with 148 genes containing two or more alterations [38]. Only 5% of patients diagnosed with pancreatic cancer have a familial form of the disease, which underscores the importance of understanding the role of somatic changes in driving cellular transformation and developing therapies accordingly [37].

Jones et al. identified 12 core cellular pathways and processes that are altered through mutations in component genes in a survey of 24 pancreatic cancers [45] (Fig. 1.1.2.1). Overall, around 60 mutations in 12 different signaling pathways accompany the development of aberrant ducts in PDAC [46]. Many of these pathways consist of genes that have already been appreciated as players in pancreatic cancer formation and progression, such as DNA damage control (TP53), cell cycle regulation (CDKN2A), and transforming growth factor beta (TGF-β) signaling (SMAD4). Among many, changes in these pathways, which are normally responsible for the correct development of the pancreas, are recognized as main contributors in PDAC progression. In addition, crucial molecules and pathways from both the tumor itself and the surrounding stroma, such as EGFR-mediated pathways, proangiogenic or embryonic pathways influence PDAC resistance to therapy and correlate with poor prognosis [46]. Most importantly, the authors were able to show that while most patients’ carcinomas exhibited a genetic alteration corresponding to each of the 12 core pathways, the specific gene mutated for a given pathway in each patient often varied [38,45].

Considering the wide variety of signaling pathways dysregulated in pancreatic cancer and triggering its progression, targeted therapies have emerged as a possibility to augment available therapeutic strategies [46].

Therefore, pathway-based approach to identification of potential targets for drugs is particularly important, as the individual pathway components or genes that are altered in PDAC. However, elucidating which pathways to target in patients at various stages of disease progression will remain a challenge. Almost all PDAC harbor a key driver mutation in KRAS, and over half have mutations and/or copy number losses of TP53, SMAD4, and CDKN2A [43]. Therefore, investigation of pancreatic cancer has brought out four major driver genes: 1. KRAS - Kirsten rat sarcoma viral oncogene homolog ; 2. cyclin-dependent kinase Inhibitor 2A (CDKN2A); 3. Tumor protein p53 (TP53); 4. SMAD family member n°4 (SMAD4) [44].

(17)

Fig. 1.1.2.1. The molecular and cellular heterogeneity of pancreatic ductal

adenocarcinoma

12 core cellular pathways and processes that are altered through mutations in component genes in a survey of 24 pancreatic cancers. Figure adapted from Jones et al. [45]. 1. KRAS: one of the earliest and most universal genetic alterations

observed in pancreatic cancer. The prevalence of oncogenic KRAS mutation in PDAC ranges from 88% to 100% [45]. This mutation is a key initiator, as evidenced by its presence in PanIN [25]. This mutation is involved in interference with cellular cohesion, activates proliferation and inhibits apoptosis through the different pathways [44]. KRAS mutations have been recognized as the earliest event in PDAC initiation (PanIN1). During tumor development, KRAS alterations accumulate, together with other mutations that pile up progressively [46].

2. CDKN2A: The tumor suppressor gene CDKN2A is inactivated in over 90% of pancreatic ductal adenocarcinomas, with the vast majority of alterations arising as early as the PanIN-2 stage [38,44,46].

(18)

[25,47]. TGF-β regulates cell proliferation and differentiation, and thus acts as a critical tumor suppressor in normal cells [38]. Identifying early mutations in SMAD4 is important since it was found to be associated with a poorer prognosis and widespread metastases [44]. Inactivation or deletion of SMAD4 results in loss of SMAD4 dependent TGFβ signaling, which leads to aberrant cellular proliferation [37].

4. P53: The cellular tumor antigen p53 has several roles in the progression of the cell cycle, apoptosis and DNA repair [37]. Furthermore, 50–85% of PDAC cases carry mutation in the tumor protein 53 (TP53) gene, which occur in higher-grade, PanIN-3 lesions, contributing to the malignant progression of PDAC rather than its initiation [38,46]. The reliable identification and elimination of high-risk precursor lesions has provided an essential framework to define the genomic features that drive progression to advanced disease and develop effective screening and targeted therapeutics for earlier stage disease [48]. With increasing efforts to coordinate cancer genome projects, high resolution analyses will be conducted on primary patient tissue, revealing more information about the underlying genetic landscape of PDAC tumors [37].

1.1.3. Apoptotic pathways in pancreatic cancer

Ever since apoptosis was described by Kerr et al in the 1970’s, it remains one of the most investigated processes in biologic research [49]. Apoptosis is a fundamental anti-neoplastic mechanism in normal cells to prevent tumorigenesis [50]. It contributes to elimination of unnecessary and unwanted cells to maintain the healthy balance between cell survival and cell death. Nearly all neoplastic changes during the development of a normal cell to a cancer cell, like DNA-damage, oncogene activation or cell cycle dere-gulation, are potent inducers of the programmed cell death pathway [50]. In cancer, there is a loss of balance between cell division and cell death and cells that should have died did not receive the signals to do so. Defects can occur at any point along these pathways, leading to malignant transformation of the affected cells, tumor metastasis and resistance to anticancer drugs. The mechanism of apoptosis is complex and involves many pathways [51].

Pancreatic cancer is a disease with high resistance to most common therapies and therefore has a poor prognosis, which is partly due to a lack of reaction to apoptotic stimuli [52]. The hallmarks of nearly all cancers including PDAC are deregulation of the cell cycle machinery, self-sufficiency in growth signals, insensitivity to growth inhibitory signals, evasion of apoptosis, tissue invasion, metastasis and sustained angiogenesis [50]. The

(19)

demonstration that the fraction of apoptotic cells in PDAC predicts overall survival shows the important contribution of the apoptotic machinery towards the tumor biology of PDAC [53].

This programmed cell death process is mediated by several signaling pathways (referred to as intrinsic and extrinsic) triggered by multiple factors, including cellular stress, DNA damage and immune surveillance. The interaction of apoptosis pathways with other signaling mechanisms can also affect cell death [4]. Apoptosis avoidance is one of the hallmarks of pancreatic cancer that promotes formation, progression and resistance to treatment [52]. There are varieties of molecular mechanisms that tumor cells use to suppress apoptosis [13]. Generally, the mechanisms by which evasion of apoptosis occurs can be broadly dividend into: 1) disrupted balance of pro-apoptotic and anti-pro-apoptotic proteins, 2) reduced caspase function, 3) im-paired death receptor signaling (Fig. 1.1.3.1) [51].

Fig. 1.1.3.1. Summarizes the mechanisms that contribute to evasion

of apoptosis and carcinogenesis Figure adapted from Wong [51].

1. Disrupted balance of pro-apoptotic and anti-apoptotic proteins: many proteins have been reported to exert pro- or anti- apoptotic activity in the cell. It is not the absolute quantity but rather the ratio of these pro-and

anti-Dysregulated Apoptosis &

Cancer

Disrupted balance of pro-apoptotic and anti-apoptotic proteins

Impaired death receptor signaling Reduced caspase

(20)

[51]. Bcl-2 family member proteins are anti-apoptotic molecules that are known to be overexpressed in most cancers including PDAC [54]. When there is disruption in the balance of anti-apoptotic and pro-apoptotic members of the Bcl-2 family, the result is dysregulated apoptosis in the affected cells. BAX (Bcl-2-like protein 4) downregulation or mutation is involved in the regulation of apoptosis are upregulated in human pancreatic cancer cells [4]. Prolonged survival times in patients in whom apoptosis promoting factors are upregulated indicate that apoptotic pathways are of biological significance in pancreatic cancer [55]. The p53 protein, also called tumor protein 53 (or TP 53), is one of the best-known tumor suppressor proteins encoded by the tumor suppressor gene TP53. Defects in the p53 tumor suppressor gene have been linked to more than 50% of human cancers. Furthermore, genetic alterations of p53 are considered key to both pancreatic cancer progression [53].

Furthermore, overexpression Inhibitors of Apoptosis proteins (IAPs): XIAP, IAP1, IAP2 and Survivin has been demonstrated to suppress apoptosis [56]. IAPs have been found to be overexpressed in preinvasive and invasive pancreatic cancer [57]. One anti-apoptotic function of the IAP family is dependent on the inhibition of caspase activity [58]. Although the observed overexpression of cIAP2 and Survivin, suggests early contribution in tumorigenesis of PDAC, molecular pathways engaged by these molecules in preneoplastic lesions of the pancreas are unknown [50].

2. Reduced caspase activity: The caspases can be broadly classified into two groups: 1) those related to caspase 1 (e.g. caspase-1, -4, -5, -13, and -14) and are mainly involved in cytokine processing during inflammatory processes and 2) those that play a central role in apoptosis (e.g. caspase2, -3. -6, -7,-8, -9 and -10) [59]. During the past 15 years, a plethora of knowledge has been obtained on the mammalian caspases, with regard to their distinct physiological functions, their substrates, different activation mechanisms, the signal transduction pathways that lead to their activation as well as their involvement in the tumorogenesis [59]. These caspases could be considered to possess solid tumor suppressor function, but what is the evidence that deregulation of specific caspases per se induces inappropriate cell survival, leading to enhanced tumorigenic potential [60]. Activation of caspases is an important process for the intrinsic pathway and is controlled by anti- or pro-apoptotic proteins, such as XIAP, Bcl-2 and BAX [58].

3. Impaired death receptor signaling: Death receptors (DRs) - members of tumor necrosis factor (TNF) receptor superfamily, known to be involved in apoptosis signaling, independent of p53 tumor-suppressor gene [61,62] and are the key players in the extrinsic pathway of apoptosis [51]. So far, the best characterized DRs are CD95 (Fas/Apo1), TNF-related apoptosis-inducing ligand receptor (TRAILR) and tumor necrosis factor receptor (TNFR) [61].

(21)

Among these, TRAILR is emerging as most promising agent for cancer therapy, because it induces apoptosis in a variety of tumor and transformed cells without any toxicity to normal cells [61]. Several abnormalities in the death signaling pathways that can lead to evasion of the extrinsic pathway of apoptosis have been identified. Such abnormalities include downregulation of the receptor or impairment of receptor function regardless of the mechanism or type of defects, as well as a reduced level in the death signals, all of which contribute to impaired signaling and hence a reduction of apoptosis [51]. Selective triggering of DR-mediated apoptosis in cancer cells is a novel approach in cancer therapy [62].

All of these expression changes, as well as mutations in apoptotic proteins, are commonly found in pancreatic cancer cells and lead to tumor develop-ment, tumor growth and metastasis [52]. This deregulation of the apoptotic machinery may explain why pancreatic cancers are resistant to most adjuvant therapies, including immuno-, chemo- and radiotherapy [52].

1.1.4. Targeting apoptosis in cancer treatment

Induction of apoptotic pathways in cancer therapy is often complicated by molecular defects in apoptosis signaling pathways [6]. Recent studies have revealed that defect in apoptotic pathway may be related with cancer development and resistance to chemotherapy and radiotherapy [25]. Most chemotherapies act by induction of apoptosis. Therefore, evasion of apoptosis is mainly responsible for the insufficiency of current therapies and tumor cells use multiple pathways to escape apoptosis [50]. The clinical translation of effective pro-apoptotic agents involves drug discovery studies (addressing the bioavailability, stability, tumor penetration, toxicity profile in non-malignant tissues, drug interactions and off-target effects) as well as an understanding of tumor biology (including heterogeneity and evolution of resistant clones) [4]. Investigation of the molecular mechanism allowing tumors to resist apoptotic cell death would lead to an improved understanding of the physiology and the development of new molecular strategies in pancreatic cancer [52]. For over three decades, a mainstay and goal of clinical oncology has been the development of therapies promoting the effective elimination of cancer cells by apoptosis [4].

Deregulation of the apoptosis machinery and evasion of apoptosis is a general mechanism in PDAC [50]. Since nearly every step during carcino-genesis activates apoptosis, the development of anti-apoptotic strategies must be an early and essential event [50]. Consequently, pancreatic cancer has

(22)

restore apoptosis and thereby reducing tumor growth were made with considerable success at least under pre-clinical conditions (Fig. 1.1.4.1) [63].

Fig. 1.1.4.1. Effects causing pancreatic cancer and possible therapeutic

approaches [63]

Several review articles have shed light to the great potential of apoptosis-targeted therapies [13]. Some of which focus on Bcl-2 family proteins, IAPs and the approaches that have been used to modify their activity to reactivate apoptosis and thus eradicate cancer cells [64,65]. Overexpression of anti-apoptotic Bcl-2 family members has been associated with chemotherapy resistance in various human cancers, and preclinical studies have shown that agents targeting anti-apoptotic Bcl-2 family members have preclinical activity as single agents and in combination with other antineoplastic agents [54,64,66]. When designing novel drugs for cancers, the IAPs are attractive molecular targets [67]. So far, XIAP has been reported to be the most potent inhibitor of apoptosis among all the IAPs [68]. Some novel therapy targeting XIAP include antisense strategies and short interfering RNA (siRNA) molecules. Ohnishi et al reported that siRNA targeting of XIAP increased radiation sensitivity of human cancer cells independent of TP53 status [69]. Furthermore, apoptosis related genes are frequently methylated in tumors and are often associated to apoptosis resistance [70].

Future therapies need to combine various therapeutic strategies and have to modulate selectively the sensitivity of pancreatic cancer cells to apoptosis without affecting normal cells [63]. However, many troubling questions arise with the use of new drugs or treatment strategies that are designed to enhance apoptosis and critical tests must be passed before they can be used safely in human subjects [51].

(23)

1.2. Apoptosis-regulating proteins in pancreatic cancer 1.2.1. Epigenetic alterations in pancreatic cancer

Defects in the regulation of apoptosis contribute to many diseases, including pathologies associated with cell loss (e.g. stroke, heart failure, neurodegeneration and AIDS), and disorders characterized by a failure to eliminate harmful cells (e.g. cancer, autoimmunity) [5]. Therefore, defects in apoptotic pathways and the deregulation of apoptotic proteins, play decisive roles in the development of pancreatic cancer [50]. Cancers cells have developed numerous strategies of resistance to cell death such as DNA mutations in genes coding for pro-apoptotic proteins, increase expression of anti-apoptotic proteins (as IAP1, IAP2, XIAP and Survivin) and/or pro-survival signals, or discovered more recently, pro-apoptic gene (as APAF-1) silencing mediated by DNA hypermethylation [71].

1.2.2. IAPs family

The inhibitor of apoptosis proteins (IAPs) are a family of proteins that was discovered in 1993 in the baculovirus genome [72]. IAPs are characterized by a 70–80 amino acid BIR domain (baculoviral IAP repeat), a carboxy-terminal zinc finger domain and one or more additional functional domains that are necessary for caspase interaction [73]. There are eight human homologues characterized by the presence of one or more baculoviral domain in their primary structure (BIRs). Human IAP family members include neuronal apoptosis inhibitory protein (BIRC1, NAIP), cellular IAP1 (BIRC2, cIAP1), cellular IAP2 (BIRC3, cIAP2), X chromosome-linked IAP (BIRC4, XIAP, ILP1), Survivin (BIRC5), Apollon (BIRC6, Bruce), Livin (BIRC7, ML-IAP), and IAP-like protein 2 (BIRC8, ILP2 (TsIAP)) (Fig. 1.2.2.1) [74]. All IAPs share one to three common structures, BIR domain that allow them to bind caspases and other proteins [75]. At least one of three BIR domains is necessary for suppression of apoptosis through various mechanisms, including caspase inhibition or participation in survival signaling pathways [73,76].

(24)

Fig. 1.2.2.1. IAP protein family [75]

IAPs are involved in various cellular functions, including regulation of apoptosis, cell cycle, and intracellular signal transduction [58]. One of the main molecular mechanisms of these proteins is to bind caspases and inhibit their activity [77]. IAPs are regulated by a protein complex named SMAC/DIABLO (second mitochondria-derived activator of caspase/direct IAP binding protein with low pI) [67]. SMAC/DIABLO is synthesized as a precursor protein and is imported into the mitochondria by an N-terminal signal sequence. In case of cellular stress, SMAC/DIABLO is released into the cytosol from the intermembrane space [67].

Overexpression of IAPs has been demonstrated to suppress apoptosis, but the cellular function of the IAP family members is unclear [56]. However, given their role in cellular homeostasis, it is not surprising that deregulation of IAPs expression or function seems to be involved in a large number of cancer species. Dysregulated IAPs expression have been reported in many cancers (lung cancer, myeloid leukemia, prostate cancer, colorectal cancer) [68,78–80]. Livin was demonstrated to be highly expressed in melanoma and lymphoma [81,82] while Apollon, was found to be upregulated in gliomas and was responsible for cisplatin [83]. Concerning pancreatic cancer, there are only few data on the involvement of cIAP1, cIAP2, XIAP and Survivin

(25)

in the pathogenesis of this type of cancer [57]. Therefore, we chose these proteins for further detailed analysis in PDAC.

1.2.2.1. IAP1 and IAP2

IAP1 and IAP2 were originally identified by their association with TNF-R2 viaTRAF1 and TRAF2 and although they might bind to caspases 7 and 9, they cannot directly inhibit their proteolytic activity [84]. It has therefore been suggested that they might regulate apoptosis indirectly, by influencing signaling pathways elicited by the TNF receptor superfamily [67]. The broad

distribution of IAP1 and IAP2 in normal adult tissues contrasts with the low

expression of Survivin in these tissues [78]. Although seemingly unimportant for normal development, overexpression of IAP1, IAP2, or XIAP has been implicated in tumor cell survival [85], and studies by Zender have demons-trated that genetic amplification of IAP1 can both promote tumorigenesis and sustain tumor growth in a mouse model of liver cancer [86]. Ponnele’s study demonstrated that the two inhibitors of apoptosis c-IAP1 and c-IAP2, like Survivin, can display both nuclear and cytoplasmic expression in colon cell lines and in tumor samples. In addition, they suggested that the subcellular location of c-IAP1 and c-IAP2 could influence the prognosis in human sporadic colon cancers [78]. Lopes et al demonstrated abnormal expression of the IAP family in pancreatic cancer cells. Among the IAPs tested, the study concluded that drug resistance correlated most significantly with the expression of cIAP2 in pancreatic cells [57]. A functional and systematic investigation of the IAP family in PDAC conducted by Lemoine's group provide evidence that cIAP2 and XIAP play key roles in anti-apoptotic signaling. Downregulation of cIAP2 and XIAP by RNA interference in PDAC cell lines efficiently induced sensitivity towards cisplatin, doxorubicin or paclitaxel [50]. However, how cIAP1 and cIAP2 functions to sustain tumor growth, prevent apoptosis and the prognostic significance is still unclear, particularly in pancreatic carcinomas.

1.2.2.2. XIAP

X-linked inhibitor of apoptosis protein (XIAP) is the most potent and best-defined anti-apoptotic IAP-family member that directly neutralizes caspase-9 via its BIR3 domain and the effector caspases-3 and -7 via its BIR2 domain [75]. Of all mammalian IAPs, XIAP is the only one that is truly a physio-logical inhibitor of caspases in vivo [69]. A natural inhibitor of XIAP is

(26)

reactivating cell death execution. The central apoptosis-inhibitory function of XIAP and its overexpression in many different types of advanced cancers have led to significant efforts to identify therapeutics that neutralize its anti-apoptotic effect [68]. Most of these drugs are chemical derivatives of the N-terminal part of SMAC/Diablo. These “SMAC mimetics” either specifically induce apoptosis in cancer cells or act as drug-sensitizers [75]. XIAP targeting has been shown to be required not only for effective induction of apoptosis but also for potent suppression of long term survival [69].

1.2.2.3. Survivin

Survivin is the smallest member of IAPs, and its structure contains only a single BIR domain and lacks a carboxy-terminal RING finger domain (Fig. 1.4) [73]. Survivin is expressed during fetal development and is absent from non-neoplastic adult human tissues [87]. However, Survivin is overexpressed in almost every human tumor including pancreatic cancer and widely studied and commonly shown to predict poor prognosis and shorter survival [88–90]. Survivin has been implicated in control of cell division and inhibition of apoptosis, by different molecular mechanisms. It has been proposed as a new target for disrupting cell survival pathways in cancer cells [78]. Survivin does not directly bind caspases but inhibits apoptosis by cooperative interactions with other partners in vivo. For example, such a partner for an IAP-IAP complex is XIAP [87]. Krepela’s study concluded that the overexpression of Survivin in the majority of non- small cell lung carcinomas together with the abundant or upregulated expression of XIAP suggested that these tumors were endowed with resistance against a variety of apoptosis-inducing conditions [91]. In addition, downregulation of Survivin by RNA interference sensitizes PDAC cells towards TRAIL and irradiation-induced apoptosis. Interestingly, Survivin is expressed in a cell-cycle dependent manner in PDAC cells [92]. Many studies have investigated various approaches targeting Survivin for cancer intervention [93]. One approach in targeting Survivin is the use of siRNAs, which have been shown to downregulate Survivin and diminish radioresistance in pancreatic cancer cells [94].

1.2.3. RNA binding protein HuR

Normally, post- transcriptional regulation plays a critical role in the process of cell proliferation and apoptosis, but in cancer cells, this control might be impaired by changes in the expression of RNA binding proteins [10]. A key regulator of posttranscriptional gene regulation is Hu antigen R (HuR or ELAV1) a member of the embryonic lethal, abnormal vision in

(27)

Drosophila-like (ELAVL) family (17). Mechanistically, HuR binds to mRNAs primarily at U- or AU-rich sequences which are typically located in the 3'-untranslated region (UTR) of target transcripts [95]. HuR, a predo-minantly nuclear protein, translocates to the cytoplasm upon exposure to specific stressors (e.g., UV light, chemotherapeutics, or hypoxia) where it facilitates the stabilization and translation of mRNAs encoding key survival proteins [10].

The importance of HuR biology in tumorigenesis is supported by numerous clinico-pathologic studies across diverse tumor types, which consistently reveal a correlation between cytoplasmic HuR expression and tumor aggressiveness [96]. Increasing evidence support that diverse functions of HuR play a critical role in both carcinogenesis and cancer progression through the regulation of the stability or translation of target mRNAs that encode multiple cancer-related proteins (Table 1.2.3.1) [97].

Table 1.2.3.1. The diverse functions of HuR in cancer development and

progression through the regulation of the stability or translation of target mRNAs that encode multiple cancer-related proteins. Table adapted from Wang et al. [97]

Diverse function of HuR Effect on multiple cancer-related proteins

Tumor Growth

c-myc, P27 ↓

c-fos, EGF, GM-CSF, P21 ↑ Cyclin (A, B1 and D1) ↑

Tumorogenesis

ER, HER-2, C-FMs, COX-2 ↑ Wnt5a ↓

GATA3, Prot α, p53 ↑ Angiogenesis VEGF-A, HIF-1 α ↑ _{TSP-1, COX-2 ↑}

Tumor Inflammation

TNF-α, COX-2, TGF-β ↑ IL-1-6, IL-13 ↑

iNOS, TLR4 ↑

Invasion and metastasis MMP-9, uPa/uPAR, Snail ↑ _{RAB31, MTA1, VEGF-C ↑}

Treatment responses

Paclitaxel, Tamoxifen ↓

Aosohexaenoic acid, Aresnic trioxide ↓ Doxorubicin, Gemcitabine ↑

Consequently, elevated HuR levels have been linked to both increased PDAC cell survival and poor clinico-pathologic features by supporting an

(28)

deregulated HuR pathway may be relevant to cancer biology and may possibly promote the abnormal expression of several proteins (Table 1.2.3.1) [99]. More recently, HuR was shown to mediate the expression of the intrinsic cellular caspase inhibitor (XIAP), and this connection was linked to HuR’s ability to protect against cell death [12]. Hyper-expression of HuR increases the stability of XIAP mRNA and determines the increased resistance and vitality of tumor cells [100]. The same study group showed that silencing p53 prior to HuR overexpression resulted in increased survivin protein and mRNA stability in human oesophageal epithelial cells [101]. Furthermore, cytoplasmic expression of HuR was associated with IAP2 expression in oral squamous cell carcinoma cells [102].

However, the regulatory mechanisms, particularly at the post-trans-criptional level by HuR, involved in IAP1 and IAP2 expression are still not studied.

1.2.4. DNA methylation in pancreatic cancer

As mentioned before, induction of apoptotic pathways in cancer therapy is often complicated by molecular defects in apoptosis signaling pathways that is related with cancer development and resistance to chemotherapy and radiotherapy [6,52,103]. One-way tumor cells bypass apoptotic pathways is by silencing several genes through DNA methylation [70]. Therefore, DNA methylation has gained much recent interest for its role in cancer biology.

DNA methylation is important epigenetic mechanism of transcriptional control involving the transfer of a methyl group onto the C5 position of the cytosine to form 5-methylcytosine [104]. DNA methylation regulates gene expression by recruiting proteins involved in gene repression or by inhibiting the binding of transcription factor(s) to DNA [105]. Global hypomethylation can result in chromosome instability, and hypermethylation has been associated with the inaction of tumor suppressor genes [106]. DNA methylation plays an essential role in maintaining cellular function and a numerous studies have demonstrated a broad range of genes silenced by DNA methylation in different cancer types [107–109].

The introduction of genome-wide screening techniques has accelerated the discovery of a growing list of genes with abnormal methylation patterns in pancreatic cancer [14,110]. Studies of CpG islands have uncovered thousands of loci where differential methylation can segregate pancreatic tumor tissue from normal tissue [26]. The 289 methylation markers were identified corresponding to 85 and 129 genes that were hypermethylated and hypo-methylated in the pancreatic cancer genome, respectively [111]. This is also supported by the observation of Sato et al. where DNA hypomethylation is a

(29)

frequent epigenetic alteration in pancreatic cancer and is associated with the overexpression of affected genes [112]. Furthermore, it has become apparent that pancreatic cancer is an epigenetic disease, characterized by widespread and profound alterations in DNA methylation [14]. Abnormal methylation patterns in pancreatic cancer, and some of these epigenetic events play a role in the neoplastic process [42,111] and changes in the DNA methylation of key pancreatic developmental genes are known to be associated with carcinogenesis [42,111]. A variety of tumor suppressor, growth regulatory, and mismatch repair genes are inactivated by promoter region hyper-methylation in benign and malignant pancreatic neoplasms [112]. Thompson and al. found that changes in the DNA methylation of key pancreatic developmental genes are strongly associated with patient survival [26].

DNA methylation seems to be promising in putative translational use in patients and hypermethylated promoters may serve as biomarkers [110]. Moreover, unlike genetic alterations, DNA methylation is reversible what makes it extremely interesting for therapy approaches [15]. The potential reversibility of epigenetic changes in genes involved in tumor progression makes them attractive therapeutic targets, but the efficacy of epigenetic therapies in pancreatic cancer, such as the use of DNA methylation inhibitors, remains undetermined [14]. Assaying the promoter methylation status of these genes in circulating DNA from serum or urine is a promising new non-invasive approach for early detection of pancreatic cancer and has the potential to improve mortality from this disease [113]. Even though, some genetic and epigenetic markers were already detected in pancreatic juice and stool from patients with pancreatic cancer and precursor lesions, numerous mutations across several genes must be assayed separately to achieve high sensitivity [110].

5-Aza-2ꞌ-deoxycytidine (Decitabine/DAC) is a pyrimidine nucleoside analog that can integrate into DNA and block methylation by forming a covalent complex with DNA methyltransferase [23]. DAC has been used to reverse methylation and reconstitute the expression of silenced genes restoring their anti-tumorigenic activities, which has sparked interest in the use of decitabine in the treatment against cancer [22]. DAC may play a role in increasing the efficacy of various forms of chemotherapy. DAC treatment may have clinical implications when combined with chemotherapy or apoptosis-inducing gene therapy [24]. Therapeutic activity of hypo-methylating agents such as DAC have been used in clinical approaches in patients with myelodysplastic syndromes. Phase III clinical trials gave 60% of response in the arm treated with 5-aza and among them 7% of patients

(30)

DAC treatment induces caspase-9 expression in lung cancer cell lines, suggesting the potential use of DAC treatment as an adjuvant modality for cancer if administered along with apoptosis-inducing gene therapy [24]. Moreover, treatment with single-agent decitabine in a mouse model of PDAC, extended the survival of the animals and upregulated immune-related pathways. Therapy with DAC alone inhibits tumor growth and produces changes in lymphocyte and myeloid cell populations in the tumor microenvironment. These positive findings provide a basis for future studies of DAC combined with other immune checkpoint inhibitors as treatment for PDAC [114].

1.2.5. Apoptotic protease activating factor-1 (APAF-1)

Human APAF-1 (apoptotic protease activating factor-1) gene is located at chromosome 12q23 encoding cytoplasm protein (130 KD) and has a major role in programmed cell death [16,115]. In the presence of cytochrome c and dATP, APAF-1 oligomerizes to form a very large protein complex - apoptosome [16]. APAF-1 is the central and crucial part of the apoptosome that is assembled in response to several cellular stresses (i.e., hypoxia, DNA damage, oncogene activation) [116]. Activation by these signals finally leads to caspase activation via the intrinsic mitochondrial pathway resulting in apoptotic cell death [16,70,117]. Indeed, gene targeting studies revealed that a lack of APAF-1 greatly affects the execution of the intrinsic pathway-triggered apoptosis [118].

Since the APAF-1 gene is tumor suppressor gene and seldom mutates, promoter methylation appears to be the mechanism underlying its inactivation [16,18]. The structural features of the APAF-1 promoter suggest that methylation of the CpG island serves as the major mechanism of trans-criptional regulation of APAF-1 [119]. APAF-1 gene has different effects and expression patterns in cancer tissue of different sources [115]. DNA methylation can confer a selective growth advantage to cells when it occurs in the promoter regions of genes involved in growth regulation and DNA damage responses, which results in the development of cancer [118]. Aberration in the apoptosome formation and abnormal APAF-1 methylation events have been observed in different types of cancers types (melanoma, leukemia, neuroblastoma, gastric, lung and cervical cancers) [16,109,116, 120]. Corvaro et al. detected that the average expression level of APAF-1 is increased in PDAC when compared to the tumor-free pancreas [121]. Additionally previous study from our group, showed mRNA decrease of APAF-1 in pancreatic cancer [20]. However, the relative abundant basal

(31)

APAF-1 methylation in non-tumor tissue leads to a difficult interpretation of its role in tumorigenesis [70].

Restoring physiological levels of APAF-1 through DAC treatment is to known to ensure the apoptosome formation and the activation of Caspase 9 [70,122,123]. Furthermore, It was recently reported that APAF-1 gene is closely related to several cancer-inducing genes and tumor suppressor genes, such as p53 and Bcl2 [124]. APAF-1 loss may contribute to the low frequency of p53 mutations observed in highly chemoresistant tumor types [122].

It led to the realization of the potential use of these drugs in cancer therapy [42]. Recent studies showed, that restoring physiological levels of APAF-1 through decitabine treatment restores normal levels of APAF-1, markedly enhances chemosensitivity and rescues the apoptotic defects associated with APAF-1 loss in various cancers [19,23,24]. As the ability of DNA hypermethylation to silence tumor suppressor genes in cancer is well established, however the mechanisms of the selection of genes targeted for this aberrant DNA methylation in pancreatic cancer are still unclear.

(32)

2. MATERIALS AND METHODS

2.1. Human pancreatic cancer tissues collection

Ethical approval was issued by the Ethics Committee of the Lithuanian University of Health Sciences (Nr. BE-2-10). Consent for the use of surgical tissue specimens and clinical data for research purposes was obtained from all the patients or their representatives.

Pancreatic carcinoma tissues were obtained from the patients undergoing a pancreatoduodenectomy (Whipple resection) between 2011 – 2016 at the Department of Surgery, Lithuanian University of Health Sciences. None of the patients received neoadjuvant chemotherapy. The diagnosis of PDAC was confirmed by pathology. Adjacent normal pancreatic tissue samples obtained from the same patients and confirmed by histopathological examination as free of pancreatic cancer served as controls (“normal pancreas”). For qRT-PCR analysis freshly removed tissue samples were placed in RNALater (Ambion; UK), whereas tissues for protein extraction were snap frozen in liquid nitrogen in the operating room upon surgical removal and maintained at -80°C until use. All clinicopathological (patient’s age, gender, tumor stage, lymph node status, differentiation grade, lymphatic, microvascular, peri-pancreatic and perineural invasion) data was retrieved from a prospectively maintained database. Cancer specific survival data was provided by Lithuanian National Health database (February, 2020).

2.2. Immunohistochemistry

The antibodies against HuR 1:300 (mouse monoclonal, Invitrogen, USA) and IAP1, IAP2 1:100 (rabbit monoclonal, Abcam, USA) were used for immunohistological analysis of tissues from normal pancreas (n=5) and PDAC patients (n=20). Standard staining protocols were used. Paraffin-embedded tumor’s section was dewaxed with xylene and rehydrated by using alcohol solutions at different concentrations. Endogenous peroxidase activity was quenched with 0.3% hydrogen peroxide in methanol. To block the nonspecific binding, slides were treated with nonimmune normal rabbit/ mouse serum (Dako, USA) for 1 hour. All primary antibodies were incubated on slides for 24 hours at 4°C. After washing in TBST, slides were incubated in goat anti-rabbit, horseradish peroxidase conjugated secondary antibody (1:1000; Thermo Fisher Scientific, USA). Immunohistochemistry was developed using the DAKO Envision + system (Dako, USA) and counter-stained with hematoxylin.

(33)

2.3. Cell lines and growing conditions

Human pancreatic cancer cell line PANC-1, Capan-2 and MIA PaCa-2 were obtained from ATCC (American Type Culture Collection) and were used for the analysis. Cells were grown in monolayers in sterile 25-cm2 capacity flasks with 5-ml RPMI-1640 medium (Thermo Fisher Scientific, USA) supplemented with 10 % FBS (Thermo Fisher Scientific, USA) and 1% penicillin / streptomycin solution (Thermo Fisher Scientific, USA). Cells were cultured at 37°C temperature in a 5% CO2–95% air atmosphere humi-dified incubator.

2.4. Cells’ transfection

HuR and negative control siRNA were purchased from Ambion (UK). siHuR sequences:

Sense: UUAUCCGGUUUGACATT

Antisense sequence: UGUCAAACCGGAUAAACGCAA

Transfection was performed when cell cultures had reached 70–80 % confluence in 6-well plates. Lipofectamine RNAiMax (Invitrogen, USA) was used according to the manufacturer’s instructions for all transfections with OptiMem medium (Invitrogen, USA). All experiments included two groups of control cells: untreated control and a control treated with a siRNA negative control. Silencing efficiency was evaluated by Western blot analysis.

2.5. 5-aza-2’-deoxycytidine (decitabine) treatment of pancreatic cancer cells

5-aza-2’-deoxycytidine (C8H12N4O4, decitabine) was manufactured from Abcam (USA) and diluted in in dimethyl sulfoxide (DMSO, Carl Roth GmbH

Co KG, Germany) to 50 mg/ml concentration. In all experiments, Capan-2

and MIA PaCa-2 cells were cultured in 96-well cell culture plates (3 × 103 cells/ well) and treated with 5-aza-2’-deoxycytidine (decitabine) at 0, 1, 5, 10, 15 and 20µM concentrations and incubated for 24, 48 and 72 hours. Decitabine was refreshed every 24 h. Afterwards, APAF-1 mRNA expression and protein levels, cells’ apoptotic activity and viability were evaluated. The optimal concentration of 5-aza-2’-deoxycytidine (decitabine) to restore APAF-1 expression was selected based on the toxicity and potential side effects of the drug levels.

(34)

2.6. Western blot analysis

The homogenates of the tissues or cultured cells were lysed using RIPA lysis buffer (Abcam, USA) containing protease inhibitors (Roche Diagnostics, Switzerland) for 30 min on ice and centrifuged at 10000×g for 10 min at 4°C. The supernatants were assayed for protein concentration with a Pierce BCA protein assay kit (Thermo Fisher Scientific, USA). Fifty µg of protein where suspended in Novex Tris-Glycine SDS sample Buffer (2x) (Life Technologies, UK) with 3 µl reducing agent (Life Technologies, UK) and H2O (to a total volume of 30 µl). Prepared protein samples were heated at 97°C for 5 min before loading and 50 μg of the samples were subjected to 4–12 % sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE), and transferred to poly-vinylidene fluoride (PVDF) membranes for 50 min at 20 V. The membranes were blocked with a blocking buffer (Invitrogen, USA) for 30 min at room temperature and incubated overnight at 4°C with primary antibodies. The following primary antibodies were used: 1:1000 mouse monoclonal anti-HuR from Abcam (USA), 1:5000 rabbit monoclonal anti-IAP1 (Abcam, USA), 1:1000 rabbit monoclonal anti-IAP2 (Abcam, USA), 1:1000 mouse monoclonal anti-APAF-1 (Thermo Fisher Scientific, USA) and 1:5000 mouse monoclonal anti-GAPDH (Thermo Fisher Scientific, USA). The membranes were washed and incubated with the anti-mouse peroxidase-conjugated secondary antibody (Invitrogen, USA) for 30 min, washed and incubated with a chemiluminescence substrate/detection kit (Invitrogen, Life Technologies, USA). Results were analyzed with ChemiDoc™ MP Imaging System (Bio-Rad Laboratories, UK).

2.7. RNA extraction and real-time polymerase chain reaction (RT-PCR)

Total RNA extraction was performed from tissues and cultured cells using PureLink RNA easy kit (Invitrogen, USA) and TRI reagents (Zymo Research Corp., USA) according to the manufacturer’s protocol without DNA’se treatment. Purified RNA was quantified and assessed for purity by UV spectrophotometry NanoDrop 2000c (Thermo Fisher Scientific, USA). Complementary DNA (cDNA) was generated from 2 μg of RNA with High Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific Baltics, Lithuania). The amplification of specific RNA was performed in a 20 μl reaction mixture containing 1X PCR master mix, primers, 2 μl of cDNA template or 2 μl of RTase negative template for negative control (Table 2.7.1 and Table 2.7.2).

(35)

Table 2.7.1. Amplifications reagents volumes per 1 reaction

Volume per 1 reaction

TaqMan Universal PCR Master mix 10 µl 20x TaqMan Gen Expression Assay Mix 1 µl RNAse free water 7 µl

cDNA 2 µl

Table 2.7.2. The conditions for qRT-PCR reactions

Thermal Cycler

Times and Temperatures

Initial Setup Each of Cycles Denature Anneal/Extend

Sequence Detection Systems (7900HT, 7700, 7000)

HOLD HOLD CYCLE UNG activation

2 min 50°C 10 min 95°C 15 sec. 95°C 1 min. 60°C

Quantitative RT-PCR (qRT-PCR) analysis was performed using ABI 7500 fast Real-Time PCR system (Applied Biosystem, USA). For normalization, GAPDH housekeeping gene was used. Relative quantification was performed using the 2- ∆∆Ct method. The PCR primers used for detection of IAP1, IAP2, XIAP, Survivin, HuR, and APAF-1were obtained from Invitrogen (USA) (Table 2.7.3).

Table 2.7.3. The PCR primers used for detection

PCR

primer Forward sequence (FW) Reverse sequence (REV)

HuR GTGAACTACGTGACCGCGAA GACTGGAGCCTCAAGCCG

IAP1 CGGCTAACGCTGGTCCTCG AAATATCGCCGCCACCGAA

IAP2 TAAAAGGAAAGCACCAGTGCACAT ATAACTCTTGGCAACCGAATCAA

XIAP GAGAAGATGACTTTTAACAGTTTTGA TTTTTTGCTTGAAAGTAATGACTG TGT

Survivin CAAGGACCACCGCATCTCTAC CCAGCTCCTTGAAGCAGAAA

(36)

2.8. RNA immunoprecipitation

RNA immunoprecipitation experiments were performed with PANC-1 cells (10 x 106 _{cells/ flask) using anti-HuR antibodies according to the} protocol provided with the RNA-binding protein immunoprecipitation kit (catalog 17-701, Merck&Millipore, Germany). Magnetic beads with anti-IgG were used as negative controls for immunoprecipitation; thus, both HuR and GAPDH were undetectable. Total RNA bound to the precipitated HuR proteins obtained from the PANC-1 cells was isolated using the phenol-extraction method. Purified RNA was quantified and assessed for purity by UV spectrophotometry (NanoDrop, Thermo Fisher Scientific, USA). cDNA was generated with a High Capacity RNA-to-cDNA Kit (Applied Bio-systems, USA) and analyzed by qRT-PCR using IAP1 and IAP2 primers.

2.9. Bisulfite conversion

The extracted DNA underwent bisulfite conversion, which is based on the chemical conversion of unmethylated cytosine to uracil where methylated cytosine remains intact. Four hundred ng of genomic DNA were subjected to bisulfite conversion with the DNA Methylation-Gold Kit (Zymo Research Corp., USA) according to manufacturer's recommendation. Modified DNA was suspended in elution buffer and was immediately used or stored at -20 ̊C.

2.10. Methylation-specific PCR (MSP)

The promoter methylation status of APAF-1 gene was examined in DNA samples of 44 PDAC tissues and adjacent normal pancreatic tissues from the same patients. APAF-1 promoter methylation status was detected using the MSP method. Bisulphite-treated DNA samples were subjected to PCR, which was performed with two primer sets (Table 2.10.1). The primers were designed using MethPrimer software (Fig. 2.10.1).

Table 2.10.1. The PCR primers used for MSP

PCR

primer Methylated (M) Unmethylated (U)

FW GATATGTTTGGAGATTTTAGGACGA GATATGTTTGGAGATTTTAGGA TGA

REV TACCAAATCTATAAAAAAACGCGAT TACCAAATCTATAAAAAAACAC AAT

(37)

Fig. 2.10.1. Analysis of APAF-1 promoter methylation by MSP

(A) The arrow marker at position 520 bp indicates the transcription start site (TSS). (B) APAF-1 methylation analyses of PDAC patients (#) and adjacent tissues. APAF-1 primers designated as methylated (M) or unmethylated (U). Water was used as

template in the 'no template control'. Human methylated and unmethylated DNA were used for negative (NC) and positive (PC) control

MSP was performed in 25 µl volume containing 10 pM of each forward and reverse primers, 1 µl of treated DNA, 200 µM of dNTPs, 1.5 mM of MgCl2, 1.5 U of Taq polymerase, and 2.5 µl of 10X PCR buffer. MSP was performed in a thermal cycler using the following cycling profile: 94°C for 2 min, the amplification was conducted in 35 cycles at 94°C for 45 seconds, 58°C for 45 s, and 72°C for 30 s, followed by re-extension for 5 min at 72°C. The 5 µl PCR products were loaded onto 2% agarose gel, electrophoresed and visualized under ultraviolet light subsequent to being stained with ethidium bromide using Gel Doc™ XR+ imaging system (Bio-Rad Laboratories, UK). For methylation positive and negative control Human Methylated & Non-methylated DNA Set (Zymo Research Corp., USA) was used. The MSP analysis product was defined as methylation-positive when the methylated allele was present in the methylated DNA lane or both in the methylated and unmethylated DNA lanes, and the product was defined as methylation-negative when a band was present only in the unmethylated DNA lane (Fig. 2.10.1B).

(38)

2.11. Cell viability analysis

Cell viability was assessed by the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide) assay (Invitrogen, USA) at 24, 48 and 72 hours after the initial drug treatment with 5-aza-2’-deoxycytidine (decitabine) on Capan-2 and MIA PaCa-2 cells. Cells were incubated with 1.2 mM MTT 20 µM (5 mg/ml) for 4 h at 37°C in culture medium. After 4 hours of incubation, all solutions were removed, and the formazan product was dissolved with 200-μl Dimethyl Sulfoxide (DMSO, Carl Roth GmbH Co KG, Germany). The absorbance was measured on a microplate Sunrise™ Absorbance Reader (Tecan Austria GmbH, Austria) at a wavelength of 570 nm with a reference of 620 nm. Cell viability was compared with control sample, that was not treated with decitabine before. The viability of control sample was taken as 100%.

2.12. Cell apoptotic activity

Capan-2 and MIA PaCa-2 cells were cultivated on chamber slides for 24, 48 and 72 hours with decitabine treatment. For caspases 3 and 7 activation analysis, DMEM FluoroBrite Media (Thermo Fisher Scientific, USA) was prepared by adding 2 drops of CellEventTM _{Caspase-3/7 Green} ReadyProbesTM_{Reagent (Life Technologies, USA)/per 1 ml of media.} Afterwards, 500 μl of prepared Media was added to every cells’ chamber and incubated for 30 minutes at 37C. Then cell apoptosis was analyzed with Olympus IX71 fluorescent microscope. The fluorescent emission of the dye was observed using a standard FITC filter set when bound to DNA was 530 nm.Image-Pro Express 6.3 (Media Cybernetics, USA) software was used for image analysis.

2.13. Statistical analysis

Statistical analysis was performed by SPSS 23.0 software (SPSS Company, USA). As the hypothesis of ‘normal distribution of data’ was rejected by the Shapiro–Wilks test, nonparametric statistical tests were used. The comparisons were performed by the chi-square test, Fisher’s exact test or the Mann–Whitney test. Survival rates were summarized using the Kaplan-Meier method and the log-rank test was performed to compare differences in survival between groups. Statistical significance was defined as p<0.05

EFFECTS OF EPIGENETIC ALTERATIONS ON THE APOPTOSIS REGULATING PROTEINS IN PANCREATIC CANCER

Aušra Lukošiūtė-Urbonienė