• Non ci sono risultati.

CAPITOLO 3 MATERIALI E METODI

N/A
N/A
Protected

Academic year: 2021

Condividi "CAPITOLO 3 MATERIALI E METODI"

Copied!
34
0
0

Testo completo

(1)

CAPITOLO 3

(2)

3. Materiali e Metodi

3.1. Sintesi del costrutto genico CalHSP70

Presso i laboratori della Metapontum Agrobios era stato già isolato il gene codificante per il gene HSP70 basandosi sulle sequenze presenti in banca dati (EMBL). Il cDNA era stato retrotrascritto da RNA totale estratto da piantine di Arabidopsis thaliana sottoposte a shock termico. Il cDNA corrispondente era stato clonato nel plasmide pCR-Blunt II-TOPO (Invitrogen)e sequenziato per verificare la corrispondenza rispetto alla sequenza presente in banca dati. Il gene isolato ha la stessa sequenza aminoacidica del gene di Arabidopsis presente in EMBL con il numero AY059885.

3.2. Disegno dell’oligoncleotide

È stato scelto di usare la sequenza del signal peptide della proteina calreticulina per disegnare l’oligonucleotide da clonare in 5’ rispetto al gene HSP70 di Arabidopsis thaliana per indirizzare la proteina fusa verso il reticolo endoplasmatico e quindi destinarla alla secrezione. La sequenza dell’oligo è stata disegnata utilizzando come riferimento la sequenza nucleotidica della calreticulina di Nicotiana plumbaginifolia, (numero NCBI Z71395.1 (GI:1419087). Le sequenze nucleotidiche e aminoacidiche del gene della calreticulina sono riportata nell’allegato 1, pagina 107. Il sito di taglio della proteina matura della calreticulina è stato predetto utilizzando il programma “SignalP 3.0 Server” (www.cbs.dtu.dk/services/SignalP) (Figura 1).

Il risultato ottenuto dal programma indica che con il 97% di probabilità, il signal peptide viene tagliato tra l’aminoacido in posizione 27 e quello in posizione 28.

(3)

Figura 1. Determinazione del sito di cleavage del signal peptide della calreticulina:

È stato quindi disegnato un oligonucleotide che comprendeva la sequenza nucleotidica corrispondente ai primi 27 amminoacidi del gene della calreticulina (signal peptide) e a seguire 44 nucleotidi della sequenza del gene HSP70 (l’ATG del gene HSP70 è in frame rispetto all’ATG del signal peptide). In 5’ dell’oligonucleotide è stata uno inserita la sequenza di cleavage del sito di restrizione XbaI (lungo 6 basi) e 16 nucleotidi corrispondenti alla “5’ untraslated region”. La lunghezza dell’oligo disegnato è di 147 basi.

# Most likely cleavage site between pos. 27 and 28: VSA-EV SignalP-HMM result:

>Sequence

Prediction: Signal peptide Signal peptide probability: 0.990 Signal anchor probability: 0.010

(4)

La sequenza finale dell’oligo è qui riportata :

figura 2. Sequenza dell’oligonucleotide CalHSP70. In minuscolo è riportata la sequenza del Signal Peptide della calreticulina mentre in maiuscolo è riportata la sequenza dell’HSP70. La sequenza di cleavage dell’enzima XbaI è indicata in rosso.

3.3. Sintesi del costrutto genico

L’oligo del signal peptide lungo 147 basi è stato sintetizzato chimicamente (PRIMM S.r.l. – Milano). Avendo l’estremità 5’ complementare al gene dell’HSP70, era possibile utilizzare l’oligo come un primer in una reazione di PCR e cosi ottenere il gene HSP70 con il signal peptide per la calreticulina presente in 5’.

La reazione PCR è stata effettuata utilizzando il primer CalHSP da 147 basi come primer forward ed un primer di 19 basi, corrispondente alla porzione 3’ del gene HSP70, come primer reverse

Il DNA stampo usato è costituito dall’ORF del gene HSP70 già clonato in pCR-Blunt II-TOPO (pTopoHSP70).

147 basi Oligo

signal peptide HSP70

Gene HSP70 di Arabidopsis thaliana

HSP Bam 3’

tctagatctc acaacagtgg ccatggctac tcaacgaagg gcaaacccta gctctctcca tctaattact gtattctctc tgctcgtcgc tgtcgtctcc gctATGG CGGGTAAAGG TGAAGGTCCA GCTATCGGTA TCGATCTCGG

(5)

Reazione : DNA (ptopo HSP70) 1 μl Buffer 10x (invitrogen) 5 μl MgCl 50 mM 1,5μl dNTPs 10 mM 2 μl CalHSP 5’ μl* HSP Bam 3’ 1 μl Taq (invitrogen) 0,2 μl H2O sterile. 38,7 μl 50 μl

Sono state effettuate 3 reazioni ognuna con una concentrazione diversa di primer CalHSP 5’ in modo da individuare la concentrazione ottimale di primer. Questa prova è stata necessaria data la potenziale difficoltà nell’ottenere il frammento amplificato utilizzando nella reazione di amplificazione primers di lunghezza molto diversa con temperature di melting estremamente distanti.

Il ciclo di amplificazione scelto per la reazione è stato di tipo touchdown ossia la temperatura di annealing (impostata nel primo ciclo di amplificazione a 72°C diminuiva di 0,2S°C ogni ciclo per 20 cicli.

°C Tempo

95°C 4 min

95°C 30 sec

72°C 45 sec

decremento 0,2°C ogni ciclo fino a 68°C

72°C 45sec 95°C 30 sec 60°C 45 sec 72°C 45 sec 72°C 7 min 4°C ∞ x 20 cicli x 20 cicli

* sono state utilizzate 3 concentrazioni del Primer CalHSP 5’ in tre reazioni di PCR : 20pm (A), 40 pm (B) e

(6)

Con questa prova è stato determinato che la reazione che ha dato la miglior resa era quella contenente 20 pmoli di primer CalHSP5’(molarità equivalente tra il primer forward ed il primer reverse) come si può osservare nella figura 3.

Figura 3. A: Analisi elettroforetica su gel di agarosio all’1% delle 3 reazioni PCR (campioni A, B e C) per amplificare il gene HSP70 da Arabidopsis thaliana inserendo in 5’ il signal peptide della calreticulina. Il gel è stato preparato secondo il protocollo 4.1 riportato pagina 68. I campioni A, B e C hanno rispettivamente una concentrazione di 20, 40 e 100 pmoli di primer forward mentre la concentrazione del primer reverse resta costante a 20 pmoli. Con la lettera X è stata indicata una reazione in cui sono stati utilizzati i primer che consentono l’amplificazione del gene HSP70 (HSP705’bis +HSP703’bis). B: I campioni A e X sono stati separati per un tempo maggiore per poter apprezzare la differenza nel peso molecolare.

Dalla figura 3 è possibile dedurre che la concentrazione ottimale dell’oligo forward da usare è di 20 pmoli – la concentrazione usata nel campione A – il quale mostra un’amplificazione paragonabile all’amplificazione del controllo positivo (campione X).

Con questa informazione è stato possibile procedere ad un’altra amplificazione del gene con gli stessi primer, per produrre una maggior quantità dell’amplificato da utilizzare per i successivi clonaggi. La PCR è stata eseguita questa volta usando una Taq phusion (Finnzymes) che è una taq polimerasi con alta fedeltà e alta processività.

A B C X

1Kb Bianco

A

B

(7)

x 20 cicli

x 20 cicli

Infatti il tasso di errore di questa polimerasi è stato determinato in 4.4 x 10-7 e grazie anche alla sua attività esonucleasica è anche in grado di correggere eventuali mismatch inseriti. Questa polimerasi è stata scelta perché il prodotto della reazione doveva essere esente da mutazioni puntiformi poiché dovrà essere inserito in pianta dove doveva esprimersi e produrre la proteina CalHSP70 con la sequenza aminoacidica corretta. La reazione con la taq phusion è stata la seguente:

Componenti Quantità DNA ptopoHSP70 1 μl Ph - Buffer 5x 10 μl dNTPs 10mM 1 μl CalHSP 5’ 20pm /µl 1 μl HSP Bam 3’ 20pm /µl 1 μl

Taq phusion (Finnzymes) 0,5 μl

H2O sterile. 35,5 μl 50 μl Ciclo di amplificazione: °C Tempo 98°C 30 sec 98°C 10 sec 72°C 30 sec

decremento 0,2°C ogni ciclo fino a 68°C

72°C 45 sec 98°C 10 sec 60°C 30 sec 72°C 45 sec 72°C 7 min 4°C ∞

(8)

La reazione è stata ripetuta per ottenere più prodotto amplificato da inserire in un vettore e da usare per trasformare dei batteri per il clonaggio. Sono state preparate 2 reazioni da 100 μl ciascuna utilizzando le stesse condizioni sperimentali. Il prodotto della prima reazione è stato caricato su un gel di agarosio all’1%.. La banda corrispondente al prodotto dell’amplificazione ottenuto, dopo la corsa elettroforetica è stata ritagliata dal gel e purificata con il kit GENECLEAN II da Q·BIOgene, seguendo le istruzione fornite dalla ditta. Per maggiori informazioni vedere il protocollo 4.2 riportato pagina 68.

2.4. Clonaggio del Costrutto CalHSP70 nel vettore pCR-Blunt II-TOPO.

Il frammento amplificato CalHSP70 ottenuto è stato inserito in un plasmide “pCR-Blunt II-TOPO” utilizzando il kit Zero Blunt® TOPO® PCR Cloning Kit (Invitrogen) seguendo le istruzione fornite dalla ditta utilizzando come reazione della Topoisomerasi :

4 μl DNA CalHSP70 1 μl salt solution. 1 μl vettore.

Il vettore di clonaggio pCR-Blunt II-TOPO e informazioni sul sistema di clonaggio TOPO sono riportato nell’allegato 2 pagine 108 e 109. Questa miscela è stato lasciata 5 minuti a temperatura ambiente e utilizzata per trasformare 40 µl di cellule competenti One Shot® TOP10. La reazione è stata lasciata incubare mezz’ora in ghiaccio e poi sottoposta a shock termico a 42°C per 42 secondi. La reazione è stata lasciata 2 min in ghiaccio e poi sono stati aggiunti 300 µl di terreno SOC. La coltura è stata incubata a 37°C per un’ora e successivamente piastrata su terreno LB + 50 mg/l di kanamicina. La composizione del terreno di coltura LB è riportato nel protocollo 4..9., pagina 76. La piastra è stata lasciata tutta la notte a 37°C.

(9)

3.5. Analisi dei cloni

L’efficienza di trasformazione è stata molto elevata. 15 colonie singole sono state inoculate in 3 ml di LB + kanamicina ed il DNA è stato estratto dalle cellule batteriche secondo il protocollo 4.3 riportato a pagina 70. Il DNA plasmidico estratto è stato digerito con gli enzimi XbaI/ BamH1che consentono l’escissione dell’intero gene.

→ Digestione con Xba1 / BamH1 :

DNA plasmidico 5 μl

Enzima Xba 1 (Roche) 1 μl

Enzima Bam H1 (Roche) 1 μl

Buffer 10 x 3 μl

H20 20 μl .

Volume finale 30 μl

Il frammento atteso :

Sito di taglio Sito di Taglio

Xba 1 Bam H1

2126 bp.

I campioni ottenuti sono stati chiamati con un numero più la denominazione “bis”. Nella figura seguente è riportato il risultato dell’analisi di restrizione effettuata sul DNA plasmidico.

CalHSP

Polilinker pTOPO Polilinker pTOPO

(10)

Figura 4. Digestione con Xba1 / BamH1 del clone pTOPOCalHSP70.

Gel elettroforetico di Agarosio all’1% sul qual sono stati caricati 30 μl della digestione del vettore pTOPO contenente l’inserto CalHSP70 con gli enzimi Xba1 / Bam H1. I cloni selezionati per ulteriori analisi molecolari sono cerchiati in rosso.

Le bande corrispondenti al gene CalHSP70 sul gel sono evidenziate con un circolo rosso – solo 3 campioni (1 bis, 12 bis e 13 bis) presentano questa banda che è corrispondente al peso molecolare atteso come schematizzato nel disegno riportato sopra. La banda di 2000 bp del ladder 1Kb è indicata nella foto con la freccia blu. In molte colonie si evidenzia la presenza del solo vettore linearizzato. Alla luce di questo risultato le colonie 1 bis, 2 bis, 12 bis, 13 bis sono state scelte per ulteriore analisi con PCR con 2 coppie di primers :

→ Reazione A = M13 F + M13 R – Frammento Atteso : circa 2350 bp. → Reazione B = HSP 5’ bam + HSP ter 3’ int – Framento Atteso : 400 bp HSP 5’ bam : ATGGCGGGTAAAGGTGAA

HSP ter 3’ int : GGAAATCTCGTCGATGGTTC

Reazione :

DNA 1 μl

Buffer 10 x (invitrogen) 5 μl

MgCl 50 mM 1,5 μl

(11)

dNTPs 10mM 1 μl Primer 5’ 1 μl Primer 3’ 1 μl Taq (invitrogen) 0,2 μl H2O sterile. 39,3 μl 50 μl Ciclo di amplificazione: °C Tempo 95°C 5 min 94°C 30 sec 55°C 45 sec 72°C 1.30 sec 72°C 7 min 4°C ∞

L’amplificazione con i primer M13 F + M13 R (Reazione A) :

I campioni di interesse – 1 bis, 12 bis e 13 bis (cioè i 3 campioni che presentavano la banda giusta nella precedente analisi con enzimi di restrizione) presentano tutti un’amplificato ad un’altezza poco al di sopra della banda di 2000 bp del marcatore (evidenziata con la frecca blu.) come evidenziato dalla Figura 5.

Figura 5 Gel di Agarosio all’1% sul quale sono stati caricati 20 μl della PCR effettuata sul DNA di pTopoCalHSP70 con i primer M13 F + M13 R. La lunghezza attesa del frammento amplificato è 2350 bp.

x 35 cicli

Reazione A : primers M13F + M13R

(12)

L’amplificazione con i primer specifici (Reazione B)

Figura 6 Gel elettroforetico di Agarosio all’1% sul quale sono stati caricati 20 μl della PCR con i primer HSP5’ bis + HSP ter 3’ int sul DNA di pTopoCalHSP70. La lunghezza attesa del

frammento amplificato è di 400 bp.

I campioni 1 bis, 12 bis e 13 bis presentano tutti una banda leggermente al di sotto della banda dei 500 bp del marcatore (evidenziata con la freccia blu), anche se la banda del il 12 bis meno intensa.

Entrambe le reazioni PCR presentano oltre alla banda attesa anche bande aspecifiche. Questo è probabilmente dovuto alla ibridazione dei primer in altri punti del DNA stampo e non solo nel punto previsto per l’amplificazione del gene. Ciò non rende invalido i risultati ottenuti e, alla luce dei risultati di queste 2 PCR e alla digestione con Xba 1 / Bam H1, i campioni 1 bis, 12 bis e 13 bis sono stati scelti per essere sequenziati

3.6. Sequenziamento costrutto genico CalHSP70.

Il sequenziamento dell’intero gene è stato effettuato utilizzando 4 diversi primers che ci hanno permesso di sequenziare l’intero gene. I primers utilizzati nella reazione sono stati: M13F, M13R, HSP5’int (CAAGGATTCCCAAAGTGCAGC), HSP3’int. (AATCTCGTCGATGGTTC). L’indicazione della posizione dei primers rispetto alla sequenza CalHSP70 è riportata nell’allegato 3 a pagina 110.

Reazione B : primers HSP5’bis + HSP ter 3’ int

(13)

La sequenza è stata effettuata utilizzando il kit BigDye terminator v3.1 cycle sequencing kit (Applied Biosystem) e caricando le reazioni sul sequenziatore 3031 (Applied Biosystem).

Reazione :

DNA : 4 μl

Primer 2pm/ μl : 1,6 μl

Buffer 10 x : 2 μl

MIX per sequenza 1 μl

H2O 1,4 μl

L’analisi delle sequenze è stata effettuata utilizzando il programma Chromas 2.23. La verifica della corrispondenza del gene sequenziato rispetto alla sequenza attesa è stata effettuata utilizzando il programma ClustalW (EBI). I tre cloni sequenziati contengono tutti il costrutto CAlHSP70 ma dall’analisi delle sequenze si evince che solo la colonia 1Bis contiene la sequenza corretta; la sequenza di questo clone è riportata nell’allegato 3. I cloni 12 bis e 13 bis contengono invece diverse mutazioni puntiformi e delezioni.

C’è da sottolineare che la presenza di mutazioni puntiformi e di delezioni era attesa vista la lunghezza (147 basi) dell’oligonucleotide utilizzato. Quest’oligonucleotide infatti trova l’omologia di sequenza al DNA stampo, durante la fase di annealing della PCR, solo in corrispondenza della sua estremità 3’ (che rappresenta l’estremità 5’ dell’HSP70). La rimanente parte – che corrisponde alla sequenza del signal peptide della calreticulina, rimane non appaiata. La condizione di oligonucleotide non appaiato di questo tratto di DNA per la sua lunghezza di circa 90 basi sono condizioni nelle quali è favorita la formazione di loop all’interno dell’oligo dove una parte dell’oligo si ibrida su se stesso. Proprio per ridurre questo fenomeno è stata utilizzata una temperatura di annealing abbastanza elevata è ciò ci ha permesso di ottenere almeno una colonia che conteneva la sequenza corretta. Il clone 1bis è stato scelto per il clonaggio del gene CalHSP70 nel vettore per l’espressione in piante pJazz. La sequenza del clone 1bis è riporto nell’allegato 4, pagine 111.

(14)

3.7. Clonaggio del Costrutto CalHSP70 nel vettore pJAZZ per l’espressione in pianta.

Il frammento CalHSP70 della colonia 1bis, ritagliato dal vettore, separato su gel di agarosio e purificato con il GENECLEAN II Kit (Q·BIOgene). Il frammento è stato inserito in un vettore binario “pJAZZ” per l’espressione in pianta utilizzando il kit della T4 DNA Ligasi della Roche seguendo le istruzione fornite dalla ditta. Il plasmide pJAZZ è derivato dal pBin 19 (Bevan, 1984) ma contiene già le sequenze del promotore CaMV35S e del terminatore Nos. Inoltre il plasmide contiene la cassetta Nos-Neo-Nos che permette l’espressione del gene Neomicina Phosphotransferasi e conferisce resistenza all’antibiotico kanamicina nelle cellule trasformate.

L’enzima T4 DNA ligasi catalizza la formazione di legami fosfodiesteri tra il residuo idrossil sullo zucchero in 3’ e il fosfato il 5’ in DNA a doppia elica. Avviene anche la riparazione di rotture di un’elica in DNA a doppia elica. In questo protocollo l’inserto e il vettore linearizzato vengono incubati insieme alla La T4 DNA Ligasi nella soluzione tampone fornita nel kit che è stata diluita fino ad una concentrazione di 1 x . E’ stato utilizzato un rapporto molare vettore:inserto di 1 : 3 che corrisponde al rapporto molare ottimo per favorire la reazione. L’inserto e il vettore sono stati incubati insieme alla T4 DNA Ligasi (Roche) nella soluzione tampone fornita. Per l’inserimento di un frammento ad estremità appiccicose in un vettore, era consigliato usare 1 unità di enzima per ottenere 95 % di inserimento dopo un tempo di incubazione di 16 ore a 4°C., ma la reazione è stata lasciata solo 12 ore. Il prodotto della reazione viene separato su gel di agarosio. Parallelamente è stata effettuata la legazione del vettore senza l’inserto per verificare l’efficienza di inserimento dell’inserto.

(15)

CalHSP70

XbaI

pJazz::CalHSP70

CalHSP7 0 nos SphI kan 14500 bp LB RB neo Nos Prom ter PstI nos 35S HindIII

5'

3'

SFORMAZIONE DI POMODORO CON IL GENE A

ARABIDOPSIS MUTATO IN ORIENTAMENTO SE

Hind III Hind III

Hind III

BamHI

La schematizzazione del clonaggio del costrutto CalHSP70 in pJAZZ è riportata nella figura 7

Figura 7. Schema di clonaggio del costrutto CalHSP70 in pJAZZ per ottenere il vettore per l’espressione in pianta d pJHSP70.

(16)

Reazioni di Ligasi O/N a 12°.C

pJazz + 1 bis (Reazione A)= pJCalHSP70

pJazz Xba/Bam 1 μl

pTopo1 bis Xba/Bam 3 μl

H2O 13 μl

Ligation buffer 2 μl

Ligasi 1 μl

Valore elettroporazione 2,18 pJazz self (Reazione B)

pJazz Xba/Bam 1 μl

H2O 16 μl

Ligation buffer 2 μl

Ligasi 1 μl

Valore elettroporazione 2,14

Le misceli di ligasi sono state trasformate in cellule DH10B mediante elettroporazione. Sono state utilizzate 40 μl di cellule + 3 μl di ligasi. Dopo l’elettroporazione sono stati aggiunti 300 μl di mezzo di coltura “SOC” (composizione riportato nel protocollo 4.10., pagina 77) e le cellule sono state incubate a un’ora a 37°C. Entrambe le reazioni di trasformazione sono state piastrate su terreno LB in 2 repliche, la prima contenente 100 μl di soluzione, la secondo con 200 μl.

Dopo incubazione O/N sono state prelevate 20 colonie singole per i cloni derivanti dalla trasformazione con la ligasi A (pJCalHSP70) e inoculate in 5 ml di LB liquido. I diversi cloni sono stati lasciati tutta la notte a 37°C a moltiplicare.

Valore usati per l’elettroporazione : KV : 1,8

Ohmes : 100 ΜF : 25

(17)

Da queste 20 colonie è stato estratto il DNA plasmidico seguendo il protocollo 4.3 per la mini-prep riportato a pagina 70. Il DNA plasmidico cosi ottenuto è stato analizzato con enzimi di restrizione e con PCR .

3.8. Analisi dei plasmidi

→ Digestione con Hind III Reazione :

DNA plasmidico 10 μl

Enzima Hind III (NEB) 0,2 μl Buffer 10 x (NEB) 3 μl

H20 16,8 μl .

Volume finale 30 μl

→ Digestione con Xba/Bam Reazione :

DNA plasmidico 10 μl

Enzima Xba (100u/ μl) 0,2 μl Enzima Bam H1 (100/ μl) 0,2 μl Buffer 10 x (NEB) 3 μl BSA 10 x. (NEB) 3 μl H20 13,6 μl. Volume finale 30 μl

calHSP70

Hind III Hind III Hind III

sonda

35S

Nos

EcoRI XbaI

(18)

Dalla digestione HindIII ci si attendevano 3 bande (considerando che ci sono 3 siti HindIII rispettivamente in posizione +6, +1437 e +2729 nel plasmide pJCalHSP70) rispettivamente di 1431, 1292 e circa 12kb (backbone del plasmide, terminatore nos e segmento 3’ del gene HSP70) come schematizzato nella figura seguente.

Frammenti attesi:

Sito di taglio Sito di Taglio Sito di Taglio Hind III Hind III Hind III

1363 bp 1292 bp

Figura 8. Siti di taglio dell’enzima Hind III.

Il risultata della digestione del plasmide pJHSP70 con HindIII è riportato nella Figura 9. Tutte le colonie analizzate mostrano i frammenti di restrizione attesi.

Figura 9. Gel elettroforetico di Agarosio all’1% sul qual sono stati caricati 30 μl della digestione del vettore pJR2 contenente il costrutto genico CalHSP70 con Hind III. Le 2 frecce blu mettano in evidenza le bande del marcatore a 1000 basi e a 1500 basi. Tutti campioni presentano 2 bande comprese tra 1000 e 1500 bp, come atteso.

Promotore 35 S CalHSP Terminator

Nos

(19)

Dalla digestione con gli enzimi Xba I e Bam H1, invece, ci si attendevano due frammenti rappresentanti il costrutto CalHSP e il vettore pJazz rispettivamente di 2126 basi e di circa 12500.

Sito di taglio Sito di Taglio Xba 1 Bam H1

2126 bp.

Nella figura seguente è riportato il risultato della digestione del plasmide pJHSP70 con gli enzimi BamHI e XbaI Anche in questo caso tutte le colonie analizzate mostrano il giusto inserto.

Figura 10. Analisi di restrizione con . Gel elettroforetico di Agarosio all’1% sul qual sono stati caricati 30 μl della digestione del vettore pJR2 contenente il costrutto genico CalHSP70 con XbaI/BamHI. La 2 freccia blu mette in evidenza la band del marcatore a 2000 basi.

Promotore CaMV 35 S

CalHSP Terminator

Nos

(20)

8 di questi campioni (A1, A2, A3, A14, A17, A18, A19, e A20.) sono stati selezionati in base ai risultati delle digestioni per ulteriore analisi con PCR: Questa PCR è stata effettuata con 3 coppie di Primer :

1. HSP Bam 5’(ATGGCGGGTAAAGGTGAA) + HSP Bam 3’ (TTAAGCCTTTTGGCGGGATCC ) (controllo presenza gene) Frammento atteso : circa 2000 bp.

2. 35S F 05 + HSP Bam 3’ (controllo presenza promotore a monte del gene) Frammento atteso : circa 2500 bp.

3. M13F + M13R (controllo integrità del costrutto incluso promotore e terminatore) Frammento atteso : circa 3400 bp.

Reazione : DNA 1 μl Buffer 10 x (invitrogen) 5 μl MgCl 50 mM 1,5 μl dNTPs 10mM 1 μl Primer 5’ 1 μl Primer 3’ 1 μl Taq (invitrogen) 0,2 μl H2O sterile. 39,3 μl 50 μl

Tutte le colonie analizzate attraverso PCR con le tre coppie di primers hanno dato il frammento di amplificazione atteso.

Due colonie (A19 e A20) sono state selezionate per la verifica della sequenza. La sequenza è stata effettuata con 7 primers che consentono di verificare la sequenza

(21)

dell’intera cassetta. I risultati della sequenza hanno confermato la correttezza della cassetta per l’espressione in pianta CaMV35S::CalHSP70.

3.9. Trasformazione di Rhizobium tumefaciens.

Il plasmide pJCalHSP70 colonia A19 è stato inserito in cellule competenti di R. tumefaciens ceppo LBA4404 attraverso elettroporazione.

Le cellule di R. tumefaciens sono state preparate e trasformate seguendo il protocollo 4.4. pagina 71, in accordo il metodi descriti da Mozo e Hooykaas, 1991 e da Mersereau et.al, 1990. 40 µl di cellule sono state utilizzate per l’elettroporazione con 200 ng di plasmide pJcalHSP70.

Le cellule trasformate sono state piastrate su terreno di coltura AB solido contenente Streptomicina 500 mg/l e Rifampicina 100 mg/l e Kanamicina 50. La composizione del terreno di coltura AB è riportato nel protocollo 4.14., pagina 79. La rifampicina è un antibiotico che inibisce la RNA polimerasi DNA-dipendente, col risultato di una soppressione della sintesi di RNA. Possiede uno spettro di azione molto ampio nei confronti della maggior parte dei germi gram + e gram – che non hanno acquisito geni di resistenza. La streptomycina è un antibiotico che ferma la crescita batterica creando danni nelle membrane batteriche e inibendo la sintesi proteica. Le piastre sono state lasciate 2 giorni a 28°C per permettere alle cellule di R. tumefaciens contenenti il plasmide di formare colonie.

3.10. Verifica dell’integrità della cassetta in R. tumefaciens.

Sono state selezionate 10 colonie singole dalla piastra di trasformazione. I ceppi sono stati inoculati in 3 ml di AB. Su questi ceppi è stato effettuato il protocollo 4.5 pagina 72 per l’estrazione del plasmide. Il DNA così ottenuto è stato sottoposto ad amplificazione PCR con primer specifici per il gene HSP70 e digerito con l’enzima HindIII per controllare il plasmide attraverso Southern Blot.

(22)

3.10.1. Analisi con PCR del DNA plasmidico

2 µl di DNA batterico sono stati amplificati con i primers :

‰ Hsp 5’ int (CCATGGCTACTCAACGAAGG)

‰ Hsp 3’ Bam (GAAGTTGATTAAGCCTTTTGGCGGGATCC)

che consentono l’amplificazione di circa 1000 basi nella regione 3’ del gene HSP70. Analisi con PCR del DNA plasmidico estratto da Rhizobium tumefaciens.

→ PCR : Reazione :

DNA 2 μl

Buffer 10 x (invitrogen) 5 μl Banda Attesa : circa 1000 bp.

MgCl 50 mM 1,5 μl dNTPs 10mM 1 μl Primer Hsp 5’ int 1 μl Primer Hsp 3’ Bam 1 μl Taq (invitrogen) 0,2 μl H2O sterile. 38,3 μl 50 μl

Il ciclo di amplificazione era identico a quello riportato a pagina 43.

Figura 11 : Gel elettroforetico di Agarosio all’1% sul qual sono stati caricati 20 μl del prodotto della PCR. I 2 campioni evidenziati con un circolo rosso mostrano il frammento al peso molecolare atteso.

Due colonie analizzate hanno mostrato il corretto frammento amplificato e sono state selezionate per l’analisi di restrizione ed il successivo Southern Blot.

(23)

3.10.2Analisi del DNA plasmidico per mezzo di Southern Blot.

→ Digestione con Hind III Reazione :

DNA plasmidico da agro 14 μl

Enzima Hind III 0,2 μl

Buffer 10 x (…) 3 μl

H20 16,8 μl .

Volume finale 30 μl

Tutti 30 μl del prodotto della digestione sono stati caricati su gel di agarosio e separati mediante elettroforesi. Il DNA è stato successivamente trasferito su membrana di nylon (Amersham) mediante Southern Blot utilizzando una soluzione di NaOH 0,4 M per il trasferimento. Dopo trasferimento O/N il filtro contenente il DNA è stato incubato in stufa ad 80°C per 2 ore in modo da fissare più fortemente il DNA alla membrana.

Il filtro è stato successivamente ibridato con il gene HSP70 marcato con 32P α-dCTP L’ibridazione è stata effettuata utilizzando 1 x 106 cpm/ml di sonda in 20 ml di soluzione di ibridazione a 65°C.

Figura 11. Southern Blot vettore pJR2 contenente il costrutto genico CalHSP70 digerito con HindIII. Due campioni (A19_5 e A19_6) sono venuti positivi.

A19 1 A19 2 A19 3 A19 4 A19 5 A19 6 positivo

(24)

L’analisi Southern ha confermato l’integrità della cassetta ed il clone pJCalHSP70-A19_6 (denominato pJCalHSP70/LBA4404) è stato utilizzato per la trasformazione genetica di espianti di tabacco.

3.11. Trasformazione degli espianti fogliari di .Nicotiana tabacum

3.11.1. Messa in coltura dei semi di N. tabacum.

Semi di Nicotiana tabacum sono stati sterilizzati effettuando due lavaggi con EtOH 70% lasciandoli in immersione per circa cinque minuti e la successiva sterilizzazione con una soluzione di Ace 10% + SDS 0,1% per 10 minuti. I semi sono stati poi lavati cinque volte con H2O bi-distillata per eliminare ogni traccia degli agenti usati per la

sterilizzazione. I semi sterilizzati sono stati messi a crescere in Magenta box contenenti terreno MSO. La composizione del terreno di coltura MSO è riportato nel protocollo 4.11, pagina 77. I Magenta sono stati incubati in camera di crescita con un temperatura costante di 24°C e con un fotoperiodo di 16 ore di luce, 8 ore di buio. Le piantine ottenute sono state periodicamente trasferite su terreno fresco.

3.11.2 Preparazione dell’inoculo di Rhizobium tumefaciens.

Il clone pJCalHSP/LBA4404 è stato preinoculato in 3 ml di terreno AB contenente 50 mg/l di kanamicina e incubato a 28°C per 2 giorni. Dopo tale periodo il preinoculo è stato utilizzato come starter per una coltura di 100 ml di cellule di Rhizobium tumefaciens da utilizzare negli esperimenti di trasformazione. La coltura è stata incubata O/N a 28°C.

2.11.3. Lavaggio dell’Rhizobium tumefaciens.

La coltura di Rhizobium tumefaciens, dopo incubazione O/N, è stata centrifugata 15 minuti a 4000 rpm. Il surnatante è stato eliminato ed il pellet è stato risospeso 20 ml di AB senza antibiotico in ogni falcon. I falcon sono stati centrifugati 10 minuti a

(25)

4000 rpm ed il pellet è stato risospenso in 2 ml di AB senza antibiotici. Questi lavaggi servano ad eliminare le tracce di antibiotico e ad aumentare la concentrazione della coltura.

Dopo lettura allo spettrofotometro la concentrazione della coltura di Rhizobium tumefaciens è stata portata a OD600=1.

3.11.4 Preparazione degli espianti :

Foglie di tabacco provenienti da piantine allevate in Magenta sterili in camera di crescita sono state utilizzate per la trasformazione. Le foglie sono state tagliate con l’aiuto di un bisturi in quadrettino di circa 1 cm. Questi espianti sono stati deposte con la pagina superiore a contatto con il terreno in piastre per coltura cellulari contenenti terreno REG senza antibiotici La composizione del terreno di coltura REG è riportato nel protocolli 4.13. pagina 78. Gli espianti sono stati lasciati 2 giorni in camera di crescita a temperatura costante di 24°C e con un fotoperiodo di 16 ore di luce, 8ore di buio.

3.11.5 Co-coltivazione

Gli espianti delle foglie di tabacco preparati come descritto al paragrafo precedente sono state prelevate dalle piastre e immerse nella soluzione contenente l’Rhizobium tumefaciens. Poiché l’Rhizobium tumefaciens penetra nelle cellule vegetali attraverso ferite, gli espianti sono stati punzecchiati subito dopo l’immersione nella soluzione di Rhizobium tumefaciens. Gli espianti sono stati lasciati 10 minuti nella soluzione con l’Rhizobium tumefaciens, dopo di che sono stati blottati su carta da filtro e lasciati pochi minuti per togliere l’eccesso di soluzione, e trasferiti nuovamente sulle stesse piastre contenenti il terreno REG. Gli espianti sono stati lasciati 2 giorni in co-coltivazione con l’Rhizobium tumefaciens in camera di crescita a temperatura costante di 24°C e con un fotoperiodo di 16 ore di luce, 8 ore di buio. Le piantine ottenute sono state periodicamente trasferite su terreno fresco.

(26)

3.11.6 Selezione.

Dopo 2 giorni gli espianti sono stati trasferiti su terreno di coltura REG contenente gli antibiotici Kanamicina (200 mg / l ) che ha la funzione di selezionare gli espianti trasformati, e la Carbenicillina (500 mg / l ), che è un batteriostatico ed ha la funzione di controllare la crescita batterica.

3.12. Rigenerazione.

Gli espianti trasformati sono stati lasciati su terreno REG con antibiotici Kanamicina (200 mg / l) e Carbenicillina (500 mg / l ) per un periodo di 3 – 4 settimane finché non si sono formati calli dai quali si sono sviluppati nuovi germogli putativamente transgenici. I germogli sono stati excissi e trasferiti in Magenta box su terreno MSO½ contenente Kanamicina (100 mg / l) e Carbenicillina (250 mg / l ). Queste nuove piante sono state lasciate 3 settimane a sviluppare. Alla fine di questo periodo si erano formate piantine complete di 4 – 5 foglie e una apparato radicale a forma meno ramificata rispetto a quello delle piante non trasformate. La diversa forma delle radici è dovuta alla presenza dell’antibiotico kanamicina nel mezzo di coltura. 25 di queste piantine – le più sviluppate – sono state micropropagate e messe a crescere in Magenta con MSO½ contenente una maggior concentrazione di Kanamicina (200 mg / l) e la stessa concentrazione di Carbenicillina (250 mg / l ). La composizione del terreno di coltura AB è riportato nel protocolli 4.14, pagina 79.

3.13 Controllo della presenza del trasgene nelle piante trasformate.

Da ognuno delle 25 piantine è stato estratto il DNA genomico con il metodo P. Peterson seguendo il protocollo 4.6. pagina 74. Il DNA è stato estratto anche da una delle piante non trasformate da utilizzare come controllo. Il DNA ottenuto è stato risospeso in 50 μl di Tris-EDTA 10:1.

Il controllo della presenza del gene è stato effettuato mediante amplificazione PCR del DNA genomico utilizzando i primers

(27)

CalHSP5’int (CCATGGCTACTCAACGAAGG)e AtHSP70int ter (GGAAATCTCGTCGATGGTTC)

che permettono l’amplificazione di un frammento di circa 500 basi che comprende il signal peptide della calreticulina e la porzione 5’ del gene HSP70. Inoltre l’amplificazione è stata effettuata anche con i primers che riconoscono il gene nad5 (Ecke et al. 1990), che rappresenta un gene costitutivo, per controllare la qualità del DNA. Reazione : DNA 3 μl Buffer 10 x (invitrogen) 5 μl MgCl 50 mM 1,5 μl dNTPs 10mM 1 μl Primer 5’ 1 μl Primer 3’ 1 μl Taq (invitrogen) 0,2 μl H2O sterile. 37,3 μl 50 μl

La PCR con i primer specifici è stato fatta anche sulla pianta non trasformata (NT) che non dovrebbe dare un’amplificato per controllare che non ci siano nel genoma di tabacco delle sequenze che vengono riconosciute dai primers utilizzati per l’amplificazione.

3.14. Analisi dell’espressione del costrutto CalHSP70 con RealTime PCR

3.14.1. Estrazione di RNA

14 piante transgeniche, scelte tra quelle positive all’analisi PCR che presentavano una sviluppo maggiore, sono state selezionate per l’estrazione dell’RNA. Per estrarre l’RNA è stato usato il kit TōTALLY RNA™ dell’Ambion.

L’RNA estratto è stato trattato con la DNAsi (kit DNA-free™ Ambion) per rimuovere eventuale DNA presente nell’estratto. Per controllare se il trattamento con DNAsi è stato efficace l’RNA è stato amplificato con i primer per il gene 18s. Se il

(28)

DNA contaminante è stato completamente rimosso dal trattamento con la DNAsi non dobbiamo ottenere alcuna banda amplificata.

Reazione : RNA 2 μl Buffer 10 x (invitrogen) 5 μl MgCl 50 mM 1,5 μl dNTPs 10mM 1 μl Primer 18s For 1 μl Primer 18s Rev 1 μl Taq (invitrogen) 0,2 μl H2O sterile. 38,3 μl 50 μl

Per visualizzare il risultato della reazione, abbiamo caricato 20 μl del prodotto della PCR su un gel di agarosio (Figura 12).

Figura 12 Gel Elettroforetico di agarosio all’1% sul quale sono stati caricato 20μl di del prodotto della RT-PCR con primer per il gene 18 S per controllare la presenza di DNA contaminante l’estratto di RNA dopo trattamento con DNAsi.

Nel primo gruppo (la foto in alto) nei campioni 16 e 20 è visibile la banda a 400 bp dell’amplificato, da cui possiamo concludere che i campioni 16 e 20 contenevano

3 4 5 12 16 17 1Kb 18 19 20 21 23 24 Controllo H2O

PCR

1 Kb 13 15 16 20 22 25 controllo 1Kb Controllo H2O

(29)

DNA oltre a contenere RNA. Questi 2 campioni sono stati trattati una seconda volta con DNAsi insieme al secondo gruppo di campioni (foto in basso). Nel secondo gruppo i campioni 5, 17, 18, 21 e 23 presentano contaminazione da DNA nonostante il trattamento. Questi campioni sono stati scartati e gli altri (3, 4, 12, 13, 15, 16, 19, 20, 22, 24, 25 e NT – non trasgenico) sono stati utilizzati per la reazione di trascrizione inversa.

3.14.2 Sintesi del cDNA

Il cDNA è stato sintetizzato con il kit TermoScript RT-PCR dell’Invitrogen. I campioni scelti per essere retrotrascritti in cDNA sono stati divisi in 2 gruppi, in base alla quantità di RNA presente nell’estratto.

La quantità è stata stimata in base alle foto dei gel presentati nei risultati pagina 83, figura 3. I campioni 3, 4, 15, 16, 19 e 20 costituiscono il primo gruppo (gruppo A) e sono i campioni che hanno una concentrazione più bassa di RNA nell’estratto. I campioni NT, 12, 13, 22, 24 e 25 sono i campioni che presentono una alta concentrazione di RNA nell’estratto costituiscono il gruppo B.

Tutti campioni sono stati sottoposti a denaturazione per eliminare la presenza di eventuali loop nei singoli RNA. L’RNA totale è stato denaturato a 65°C insieme ai dNTSs e al primer per la trascrizione inversa.

Reazione : gruppo A gruppo B

RNA 18 μl 12 μl

Random Primer (Esomeri) 2 μl 2 μl

dNTP 4 μl 4 μl

H2O sterile. 0 μl 6 μl

24 μl 24 μl

Questa miscela di acidi nucleici e nucleotidi è stata incubata 5 minuti a 65°C per assicurare la dentrurazione. A queste miscele sono stati aggiunti :

(30)

cDNA sintesi buffer 5 x 8 μl DTT 2 μl RNaseOUT™ 2 μl H20 DEPC 2 μl Termoscript™ RT 2 μl (15 u / μl) 40 μl

La reazione di retrotrascrizione è stata eseguita con le seguenti condizioni : °C Tempo

25°C 10:00 minuti

50°C 50:00 minuti

4°C ∞

Il cDNA ottenuto è stato usato per un’amplificazione per determinare l’espressione del gene inserito attraverso la tecnica della real time PCR

3.14.3. PCR Real Time

La RealTime PCR permette di ricavare la quantità di DNA o cDNA presente in ogni campione all’inizio della reazione andando a valutare la fluorescenza sviluppata dalla degradazione della sonda durante la fase esponenziale della reazione. La quantità di DNA presente in un campione viene determinata rispetto ad uno standard di riferimento e può essere espressa in valore assoluto (quantità di acido nucleico) se il riferimento è costituito da quantità note di DNA, oppure può essere espresse in unità arbitrarie se il campione di riferimento è costituito da un campione in cui la quantità di DNA non è nota. È possibile però, con la costruzione di una retta di taratura, determinare se la quantità di DNA nei campioni è maggiore o minore dello standard. L’attendibilità dell’esperimento è determinata da algoritmi che permettono il calcolo della quantità di cDNA secondo la retta di taratura. La pendenza della retta di taratura deve essere compresa tra -3.0 e -3.6.

I primers e la sonda da utilizzare nelle reazioni di qRT-PCR per determinare l’espressione del costrutto CalHSP70 sono stati progettati con l’ausilio del

(31)

programma Beacon Designer-2.1 (BioRad) ed è stata utilizzata una sonda TaqMan. I primers e la sonda sono stati disegnati nella regione +611 - +733 del gene HSP70. Nelle nostre condizioni l’espressione del costrutto CalHSP70 è stato calcolato rispetto ad un campione standard scelto nell’ambito dei campioni da analizzare. L’espressione del gene specifico nei vari campioni è normalizzata rispetto all’espressione del corrispondente gene housekeeping (nel nostro caso è stato scelto il gene 18s) per annullare le differenze che potrebbero essere dovute alle diverse quantità di partenza di cDNA.

È stata utilizzata una sonda Taqman avente come fluoroforo il FAM e come quencer il TAMRA.

Di seguito sono riportate le sequenze dei primer e delle sonde utilizzate nella RealTime PCR TaqmanAt_HSP70 AACTGCTGCTGCTATTGCTTACGGTCTT qRT-At_HSP70F GTCTCAACGTGATGCGTATCATC qRT-At_HSP70R AGTACCACCTCCCAAATCAAAGAT taqman_18S AAGGCAGCAGGCGCGCAAA 18srRNA-F-88 GAAACGGCTACCACATCCAAG 18srRNA-R-149 CCCCGTGTTAGGATTGGGT

I campioni sono stati preparati per la reazione come segue (con i reagenti del Kit) :

H20 8, 625 μl Mix 2x 12, 5 μl Primer qRT HSP70 F 0,75 μl (10 pM / μl) Primer qRT HSP70 R 0,75 μl (10 pM / μl) TaqmanAt_HSP70 0,375 μl cDNA 2 μl 25 μl

(32)

Abbiamo fatto un’amplificazione di prova con tutti campioni per determinare qual campione potremmo usare come riferimento per la costruzione della retta di taratura. Abbiamo scelta il campione numero 24 perché presentava un ciclo soglia (Ct) relativamente basso.

Nell’esperimento di qRT-PCR sono state effettuate 3 repliche per ogni campione per ridurre l’errore strumentale e calcolare l’errore standard. L’amplificazione è stata effettuata utilizzando la Platinum qPCR supermix-UDG (Invitrogen) utilizzando un iCycler iQ Multicolor Real Time PCR (Bio-Rad)

Il ciclo della amplificazione è stato il seguente :

Cycle 1: ( 1X) Step 1: 50,0ºC for 02.00 Cycle 2: ( 1X) Step 1: 95,0ºC for 02.00 Cycle 3: ( 30X) Step 1: 95,0ºC for 00.15 Step 2: 60,0ºC for 00.45

Data collection and real-time analysis enabled.

Cycle 4: ( 1X)

Step 1: 4,0ºC HOLD

3.15. Analisi della produzione della proteina CalHSP70

Dopo aver indagato sui livelli di espressione del transgene a livello di quantità di RNA siamo andati a vedere se la proteina codificata dal gene era presente ed il collocamento subcellulare della proteina era conforme all’atteso. Il primo passaggio è consistito nell’effettuare una estrazione di microsomi dal tessuto dalla piante scelte e in questo caso dalle foglie (il reticolo endoplasmatico viene chiamato microsoma quando viene estratto dalla cellula). Circa 500 mg di tessuto fogliare per ogni campione sono stati omogeneizzati in un mortaio con 4 ml di soluzione di estrazione. Il liquido recuperato da quest’operazione è stato centrifugato in una microcentrifuga, per pellettare i residui cellulari e il surnatante è stato recuperato e ultracentrifugato.

(33)

Dopo aver ultracentrifugato l’isolato per un’ora a 30 000 giri per minuto (circa 100.000 x g), abbiamo ottenuto un pellet in fondo ai tubi, e un surnatante. I microsomi sono contenuti nel pellet, e le proteine solubili sono contenute nel surnatante. Abbiamo recuperato sia il surnatante che il pellet, quest’ultimo è stato risospeso in 60 μl della soluzione di risospensione. Siamo andati a determinare la concentrazione di proteine sia nel surnatante sia nel pellet risospeso. La quantificazione è stato fatto seguendo il protocollo DC Protein Assay della Bio-Rad che è descritto pagina 75.

Questo protocollo sfrutta una reazione colorometrica. Le proteine vengono solubilizzate con detergente, poi interagiscono con colorante che sviluppa 90% del massimo del colore in un tempo di solo 15 minuti, dopo di che il colore cambia non più di 5% in un ora e non più di 10% in 2 ore. Ci sono 2 parti della reazione che porta allo sviluppo del colore : primo, avviene una reazione tra le proteine e il rame che si trova nella prima soluzione usata, e secondo, avviene l’ossido-riduzione del reagente di Folin contenuta nella seconda soluzione usata, da parte delle proteine trattate con rame. Il reagente di Folin cambia colore seguito alla perdita di 1, 2 o 3 atomi di ossigeno, portando alla formazione di uno o più prodotti che presentano un’assorbimento massimo a 750 nm e un’assorbimento minimo a 405 nm.

Per la retta di taratura è stata costruita utilizzando la proteina BSA con concentrazione variabile tra 0,2 e 2,2 μg/µl. Sono state utilizzati 10 campioni a concentrazione crescente.

I campioni dei microsomi di tabacco sono state diluiti 1:10 per ottenere una colorazione che potesse rientrare nel range di linearità della retta di taratura e misurati. Ogni campione è stato preparato in 2 repliche La concentrazione delle diluizioni di ogni replica è stata determinata con la lettura allo spettrofotometro ed è stato calcolato il valore medio. In base a questi dati è stato possibile ricavare la concentrazione proteica dei campioni e calcolare i µl necessari ad avere una quantità totale di proteine di 60 µg.

(34)

Abbiamo preparato 4 gel denaturanti SDS-PAGE concentrati al 12% per la separazione (resolving gel) e al 4% per la parte superiore dei gel (stacking gel). 2 gel sono stati utilizzati per la visualizzazione delle proteine mediante colorazione con Comassie Brilliant blue mentre sui rimanenti 2 gel sono stati caricati gli stessi campioni per poter effettuare il western blot. Per alcuni campioni (CTRL, 3, 16 e 20) sono state caricate su gel oltre alle proteine del ER (proteine microsomiali) anche le proteine citoplasmatiche indicate dalla sigla s. Su ogni gel sono stati caricati 60µg di proteine totali ad eccezione dei campioni 13 (40µg) e CTRL-s e 3-s (30µg). Per questi ultimi campioni la concentrazione iniziale era bassa e quindi non è stato possibile caricare 60 µg su un minigel SDS-PAGE. Infatti la quantità massima che è possibile caricare nei pozzetti è di 20-22 µl.

È stato eseguito il Western blot seguendo il protocollo riportato a pagina 75. I gel destinati all’analisi Western sono stati blottati su membrana 0,2 µm PVDF utilizzando l’elettroblotter Hoefer miniVE blot Module (Amersham Biosciences). Il trasferimento delle proteine sulla membrana è stato effettuato a 25 Volts per 2h a 4°C utilizzando il Transfer buffer avente la seguente composizione: Tris 25mM, Glicina 150mM Etanolo 20%). Le proteine trasferite su filtro sono state poi incubate con un anticorpo policlonale specifico per HSP70 e un anticorpo secondario coniugato con l’enzima fosfatasi alcalina. Il complesso antigene-anticorpo è stato rivelato mediante la reazione specifica dell’enzima con il substrato (Immuno-Star Anti-Rabbit Detection Kit . Bio-Rad). Il filtro è stato esposto con la lastra autoradiografica per 10 min. .

Figura

Figura 1.  Determinazione del sito di cleavage del signal peptide della calreticulina:
figura 2. Sequenza dell’oligonucleotide CalHSP70. In minuscolo è riportata la sequenza del Signal  Peptide della calreticulina mentre in maiuscolo è riportata la sequenza dell’HSP70
Figura 3. A:  Analisi  elettroforetica su gel di agarosio all’1% delle 3 reazioni PCR (campioni A, B  e C) per amplificare il gene HSP70 da Arabidopsis thaliana inserendo in 5’ il signal peptide della  calreticulina
Figura 4. Digestione con Xba1 / BamH1 del clone pTOPOCalHSP70.
+7

Riferimenti

Documenti correlati

(Kluegel, et. European University Institute. Available Open Access on Cadmus, European University Institute Research Repository... The American economy during the 1970s

The after-Expo usage of the facilities helps us to evaluate if World Expo 2010 was successful or not in the implementation of its goals, goals of a mega-events that, in

According to the federal policy agency, the Royal Canadian Mounted Police (RCMP), in its first assessment of the scope of trafficking in Canada, the majority of

When explaining why liberals should not attempt to force their ideals of what constitutes a good society upon the nonliberal peoples, Rawls says: “If all societies were required to

L’obiettivo del presente elaborato è duplice: in primo luogo, attraverso l’analisi dei dati raccolti dall’Osservatorio sulla componentistica automotive italiana 2018,

In particular, to date almost nothing has been published by statistical offices of the major Arab countries of immigration (Gulf States and Libya).. Secondly, statistics

nel 1961. Questa esposizione è una pietra miliare per comprendere e inquadrare storicamente e criticamente l’evolversi della ricerca orafa contemporanea, già in questa

Il modello Logit è un modello lineare generalizzato (GLM) che, dato il vettore delle variabili indipendenti X a disposizione, restituisce come output una stima